Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression

Christelle Alexa Garcia Perez; Shungo Adachi; Quang Dang Nong; Nikko Adhitama; Tomoaki Matsuura; Toru Natsume; Tadashi Wada; Yasuhiko Kato; Hajime Watanabe

doi:10.1371/journal.pgen.1009683

. 2021 Jul 28;17(7):e1009683. doi: 10.1371/journal.pgen.1009683

Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression

Christelle Alexa Garcia Perez ¹, Shungo Adachi ², Quang Dang Nong ¹, Nikko Adhitama ¹, Tomoaki Matsuura ¹, Toru Natsume ², Tadashi Wada ¹, Yasuhiko Kato ^1,^*, Hajime Watanabe ^1,^*

Editor: Daniela Delneri³

PMCID: PMC8351930 PMID: 34319983

Abstract

Long noncoding RNAs (lncRNAs) are vastly transcribed and extensively studied but lncRNAs overlapping with the sense orientation of mRNA have been poorly studied. We analyzed the lncRNA DAPALR overlapping with the 5´ UTR of the Doublesex1 (Dsx1), the male determining gene in Daphnia magna. By affinity purification, we identified an RNA binding protein, Shep as a DAPALR binding protein. Shep also binds to Dsx1 5´ UTR by recognizing the overlapping sequence and suppresses translation of the mRNA. In vitro and in vivo analyses indicated that DAPALR increased Dsx1 translation efficiency by sequestration of Shep. This regulation was impaired when the Shep binding site in DAPALR was deleted. These results suggest that Shep suppresses the unintentional translation of Dsx1 by setting a threshold; and when the sense lncRNA DAPALR is expressed, DAPALR cancels the suppression caused by Shep. This mechanism may be important to show dimorphic gene expressions such as sex determination and it may account for the binary expression in various developmental processes.

Author summary

Long noncoding RNAs are vastly transcribed throughout the genome. Among them, RNAs overlapping the protein-coding RNA in sense orientation have been poorly studied because of the difficulty in differentiating their sequences from their overlapping coding RNAs although this class of RNAs has been reported to comprise the majority of the long noncoding RNAs. In the crustacean Daphnia magna, a long noncoding RNA, called DAPALR, is transcribed from the male determining gene, Doublesex1, and overlaps with the Doublesex1 5´ UTR. DAPALR activates Doublesex1 but this regulatory mechanism remains unknown. We found the RNA binding protein Shep bound to the Doublesex1 5´ UTR. In vitro and in vivo experiments indicated that Shep suppresses translation of the mRNA and DAPALR increases Doublesex1 translation efficiency by sequestration of Shep. Since male-specific expression of Doublesex1 is also regulated at the transcriptional level, we propose that Shep cancels the unexpected expression of Doublesex1 and maintains the feminized state for sexual dimorphism but DAPALR suppresses this repression by sequestration of Shep. We infer that this mechanism is not only for binary sex regulation but could function in the binary regulation of other genes in various biological processes.

Introduction

Long noncoding RNAs (lncRNAs) are vastly transcribed in the genome and play a diverse role in the cell such as epigenetic regulation, transcription, and post-transcriptional regulation [1,2]. Based on the direction of the transcription of lncRNA, it can be categorized in its orientation as sense and antisense. While a growing knowledge about antisense lncRNA has been accumulated, knowledge about sense lncRNA is still limited. Especially, sense-overlapping lncRNAs that overlap protein-coding genes in the same sense strand remain poorly studied. This is despite the projection that sense-overlapping lncRNAs are actually the most abundant type of lncRNA based on the proportions of lncRNA classes in PacBio Iso-seq annotation [3].

Previously, we identified a sense-overlapping lncRNA called Doublesex1-alpha-promoter-associated-long noncoding-RNA (DAPALR) that can regulate Doublesex1 (Dsx1) [4]. Dsx1 is responsible for male determination in Daphnia magna. It consists of two isoforms, Dsx1α and Dsx1ß [5]. DAPALR is transcribed from upstream of the transcription start site of Dsx1α isoform and overlaps with its 5´ UTR [4]. Both isoforms of Dsx1 and DAPALR are highly expressed in males and it has also been identified that DAPALR and its overlapping region with Dsx1α 5´ UTR can induce Dsx1 expression in trans but its molecular mechanism remains unknown [4]. In this study, we identified the Shep as a DAPALR binding protein. Loss-of-function experiments and overexpression of Shep showed that Shep functions as a suppressor of Dsx1. In vivo and in vitro post-transcription assays showed that Shep binds to and represses the Dsx1 mRNA and DAPALR sequesters Shep to activate the Dsx1 translation.

Results

Identification of Shep as a sense lncRNA binding protein

As our previous study showed that the 205 bp of DAPALR fragment overlapping with Dsx1α 5´ UTR (Fig 1A) is the core region for the enhancement of Dsx1 expression [4], we attempted to identify proteins that interact with the core region. We used the 205 bp overlapping sequence as bait for the RNA pulldown experiment. Through RNA pulldown using a FLAG-peptide tagged bait RNA incubated with D. magna lysate followed by mass spectrometry (Fig 1B) [6,7], we identified two candidate proteins: Alan shepard (Shep) and CUG binding protein 1 (CUGBP1). Among the pulled-down proteins, Shep and CUGBP1 resulted to high, significant p-values, which means that they have the highest probability for binding to the overlapping sequence of DAPALR as they did not associate with the negative bait samples like the Dsx1ß 5´ UTR (S1 Table). While both of the identified proteins are known to have RNA binding activities, we focused on Shep in this study because it has been reported to upregulate the expression of the target gene by suppressing the insulator activity [8] and Sup-26, the ortholog of Shep in Caenorhabditis elegans, regulates translation of the sex-determining gene tra-2 [9].

We searched the D. magna genome database, D. magna Genome BLAST (http://arthropods.eugenes.org/EvidentialGene/daphnia/daphnia_magna/BLAST/), for the Shep ortholog and found a single Shep ortholog. It consists of 5 exons and codes for 458 amino acids of a polypeptide including the two RNA Recognition Motifs (RRMs) (Fig 1C). The multiple sequence alignment with other Shep orthologs demonstrated that the RRMs are highly conserved among species and throughout evolution (Figs 1B, S1 and S2).

As we identified the Shep as a DAPALR binding protein and DAPALR shows sexually dimorphic expression, we examined if Shep also shows sexual dimorphism. While Dsx1 and DAPALR both have male-specific expression, Shep was expressed both in male and female embryos and did not exhibit sexual dimorphism (Fig 1D). The expression of Shep started to increase after 30 hours post-ovulation (hpo), mirroring the expression pattern of Dsx1 in males [5].

Knockdown of Shep mRNA enhances the Dsx1 expression

To elucidate the functions of Shep, loss-of-function analyses were performed using the Dsx1 reporter strain [10]. In this strain, the mCherry gene was inserted at the translation initiation codon of the endogenous Dsx1 gene in one allele, in addition to the ubiquitous expression of the H2B-GFP. We injected the Shep-targeting siRNA into the eggs obtained from the Dsx1 reporter strain and found that Shep knockdown resulted in a 5-fold and 3-fold increase of mCherry fluorescence in female and male embryos, respectively (Fig 2A and 2B). The enhanced mCherry expression pattern by Shep RNAi (S3A Fig) was similar to that of DAPALR overexpression in female [4] and male embryos (S3B Fig). In male embryos, the enhanced mCherry signals could be observed not only in its male-specific organs such as the first antennae and its thoracic appendages but ubiquitously in its whole body (Fig 2A). While in female, high expression of mCherry signals was observed especially in the yolk region (Fig 2A). However, the mCherry fluorescence recapitulating the Dsx1 expression was not enhanced in the male specific organs such as first antennae, showing that sex reversal did not occur.

In contrast to the prominent enhancement of the mCherry signals, no significant increase of Dsx1 transcript was observed in males (Fig 2C) and a two-fold increase of Dsx1 transcript level was observed in females (Fig 2C). Reduction of the Shep mRNA by RNAi (Fig 2D) suggested that the the mCherry enhancement was due to the reduction of Shep protein. The finding that the Dsx1 transcription level does not reflect the enhancement of the mCherry expression suggests the possibility that Shep suppresses the translation of Dsx1.

Shep mutant enhances the Dsx1 expression

Next, we tried to introduce a mutation in the Shep gene using the CRISPR/Cas system. We used two types of gRNAs targeting each RRM, injected those gRNAs with Cas9 protein into eggs from the Dsx1 reporter strain, and obtained a line that has 15 nt insertion just before the RRM1 domain-coding sequence (Fig 3A, 3B and S2 Table). This line could be maintained and they developed normally into adults, producing offspring.

Fig 3 — **(A)** Nucleotide and amino acid sequence comparison between wildtype and *Shep* mutant. **(B)** PAGE analysis of PCR products by genomic PCR to amplify the Cas9/gRNA targeting region in the *Shep* coding sequence in the *Shep* mutant line. **(C)** Lateral view of the 2w *Shep* male and female mutant lines showing increase in mCherry fluorescence. The red signal from the guts (dotted lines) represents the autofluorescence of *Chlorella*, the main food used in daphniid cultivation. An1: first antennae, TA: thoracic appendages, Ge: genital. **(D)** Gene expression profile of *Dsx1* in 1w female and male wildtype control and *Shep*-. RT-qPCR results are shown as expression levels normalized with housekeeping genes *L32*, L8 and *Cyclophilin* and relatively compared to the wildtype control. Error bars indicate the standard error of the mean (n = 3). ns: not significant (Student’s T-test).

There were no noticeable differences between the mutant and wildtype at embryonic stages (S4 Fig). We also observed the mCherry expression of mutant daphniids at the adult stage when sexually dimorphic traits are more evident [10]. In the Shep mutant, both males and females showed significantly higher mCherry fluorescence than the wildtype (Fig 3C). Female daphniids of the Dsx1 reporter strain do not usually have mCherry fluorescence [10], but the Shep mutant displayed mCherry signals in its whole body especially the appendages. High expression of mCherry signal could also be observed in the first antennae that is one of the major male-specific traits. However, the first antennae did not develop elongated like in males, signifying that sex reversal and male differentiation did not occur. On the other hand, the male mutant showed increased mCherry signals not only in male-specific regions such as the first antennae and genital but also in other regions. These suggest that Shep may suppress Dsx1 in both male and female. In contrast to the drastic difference of the mCherry expression between the Shep mutant line and wildtype, we could not find a significant difference in Dsx1 mRNA expression levels between the Shep mutant and wildtype (Fig 3D) in either male or female. This finding also supports the possibility that Shep controls Dsx1 expression at post-transcriptional levels.

Using the CRISPR/Cas system, we first aimed to produce Shep mutant lines that have deletion mutations in the RRM domain. However, the embryos with indel mutations in both of the two RRM domains could not hatch and they exhibited delayed or deformed phenotypes (S5 Fig: delayed development, deformed embryos, and unhatched eggs), suggesting that Shep is also essential for development and morphogenesis.

Shep overexpression suppresses Dsx1 expression

As our findings suggested that the diminished function of Shep increased the mCherry expression at the post-transcriptional level, we further investigated if Shep overexpression can suppress the Dsx1 expression. We injected in vitro transcribed Shep mRNA into male eggs obtained from the Dsx1 reporter line. As a result, we found that mCherry fluorescence was reduced in the Shep mRNA injected embryos (Fig 4A and 4B). Shep mRNA level was confirmed to increase after injection (Fig 4C) but the transcript level of Dsx1 did not show any significant difference from the control (Fig 4D). These results also suggest that Shep does not affect Dsx1 transcription or change the mRNA stability; rather its effect is at the translational level.

Fig 4 — **(A)** Ventral view of male embryos of *Dsx1* reporter strain injected with GFP mRNA as control and GFP plus *Shep* mRNA observed at 30 h after injection. mCherry fluorescence allowed visualization of *Dsx1* expression while GFP fluorescence in the nucleus enabled observation of body structures. The merged images of mCherry and GFP and the bright field images were used to understand the localization pattern of mCherry expression. An1: first antennae, T1: first thoracic legs, Ge: genital. **(B)** Relative mCherry fluorescence intensity calculated between *GFP* mRNA- and GFP plus *Shep* mRNA-injected male embryos. Error bars indicate the standard error of the mean (n = 5). **(C)** Gene expression profile of *Shep* in *GFP* mRNA- and *GFP* plus *Shep* mRNA-injected male embryos. (D) Gene expression profile of *Dsx1* in *GFP* mRNA- and *GFP* plus *Shep* mRNA-injected male embryos. RT-qPCR results are shown as expression levels normalized with housekeeping genes *L32*, L8 and *Cyclophilin* and relatively compared to the control. Error bars indicate the standard error of the mean (n = 3). *p<0.05, ***p<0.001, ns: not significant (Student’s T-test).

TGE element is responsible for the post-transcriptional regulation or DAPALR function

As the C. elegans ortholog of Shep, Sup-26 has been reported to bind to the target sequence named tra-2 and GLI element (TGE) to regulate the Tra2 gene translation [9], we searched a similar sequence to the TGE in Dsx1α 5´ UTR and DAPALR. In the overlapping region of Dsx1α 5´ UTR and DAPALR, a highly conserved sequence with TGE was found (Fig 5A). To prove that the TGE-like motif is essential for the Shep function in Daphnia, either 40 nt of RNA including the potential TGE, or the 30 nt RNA that lacks the potential TGE was overexpressed in female embryos of the Dsx1 reporter strain. When the RNA containing the TGE-like motif was expressed, the mCherry expression could be observed. The enhancement of the mCherry expression was the same result as the DAPALR overexpression [4]. In contrast, the deleted TGE did not have any effect on the reporter mCherry expression (Fig 5B), which was the same result as the injection of unrelated RNA. These results suggest the possibility that the TGE-like motif has a potential role in the function of Shep and DAPALR in Dsx1 regulation.

Fig 5 — **(A)** Shep binding site consensus sequence and its similarity with TGE core consensus sequence. Position of the potential binding site was also shown located at the 3´end of the transactivation element of *DAPALR*. Sequence of the mutated Shep binding site used for the experiment was also shown. **(B)** Ventral view of female embryos of *Dsx1* reporter strain injected with control plasmid, plasmid expressing intact TGE and plasmid expressing deleted TGE. mCherry fluorescence allowed visualization of *Dsx1* expression while GFP fluorescence in the nucleus enabled observation of body structures. The merged images of mCherry and GFP and the bright field images were used to understand the localization pattern of mCherry expression. dotted lines: yolk area. **(C)** Ventral view of female embryos of wildtype strain injected with *Dsx1* 5′ UTR-GFP reporter mRNA and reporter mRNA plus *Shep* mRNA and *Dsx1* 5′ UTR without TGE-GFP reporter mRNA observed at 30 h after injection. GFP fluorescence signals showed efficiency of translation. The bright field images were used to understand the localization pattern of GFP expression. **(D)** Relative GFP fluorescence intensity calculated among three treatments. Error bars indicate the standard error of the mean, n = 5. The end points of the line above the bars show which samples were compared statistically. ***p<0.001(Student’s T-test).

Shep binding site (TGE) is a target sequence of translational regulation

To test our hypothesis that the potential Shep binding site located in the 5´ UTR is the target of translational regulation of DAPALR and that the Shep functions as a translational suppressor, we examined translational efficiency in the presence or absence of Shep binding site in the mRNA. The GFP reporter mRNA harboring the Dsx1α 5´ UTR and the same mRNA only lacking the potential Shep binding site were prepared. These reporter mRNAs were individually injected into female wild-type eggs. Results showed that mRNA lacking TGE-like motif showed much higher expression of the GFP than wildtype mRNA (Fig 5C and 5D), suggesting that endogenous Shep may suppress the translation by binding to the Dsx1α 5´ UTR. Significant reduction of the GFP fluorescence was observed when Shep mRNA was co-injected with the intact Dsx1α 5´ UTR::GFP reporter mRNA (Fig 5C and 5D), indicating that Shep functions at the post-transcriptional level by suppressing translation.

Shep binds the TGE for translational repression of Dsx1

To confirm that Shep binds to and regulates Dsx1 translation through the TGE-like motif, we performed the suppression experiment in vitro. The luciferase gene was fused to two Dsx1α 5´ UTRs, one with an intact TGE-like motif and the other with the deleted TGE sequence. The mRNAs were synthesized in vitro and were translated with or without the Shep mRNA. The luciferase activity of the Dsx1 reporter mRNA which harbors the Shep binding site was significantly reduced by the addition of Shep mRNA (Fig 6A). While the translation of the reporter mRNA without the Shep binding site remained unaffected by the presence of Shep, indicating that Shep suppresses the translation of the reporter mRNA through the TGE-like motif.

Fig 6 — **(A)** Relative luciferase activity after *in vitro* translation assay of *Dsx1* 5′ UTR-Luc reporter mRNA with intact TGE and *Dsx1* 5′ UTR-Luc reporter mRNA without the TGE upon addition of *Shep* mRNA, *Shep-FLAG* mRNA and *EcR-FLAG* mRNA (negative control). Samples were compared against the expression of the *Dsx1* 5′ UTR-Luc reporter mRNA with intact Shep binding site without the addition of any other mRNAs. **(B)** Enrichment of the RNAs with and without the TGE after FLAG pulldown assay. Samples are compared against the negative control, RNA without the Shep binding site pulled using EcR-FLAG. **(C)** Relative luciferase activity after *in vitro* translation assay of *Dsx1* 5′ UTR-Luc reporter mRNA with intact TGE upon addition of *Shep* mRNA, *DAPALR* full RNA, *DAPALR* core element and *GFP* mRNA (negative control). Samples were compared against the expression of the *Dsx1* 5′ UTR-Luc reporter mRNA without the addition of any other mRNAs. The endpoints of the line above the bars show which sample were additionally compared statistically. **(D)** Relative luciferase activity after *in vitro* translation assay of *Dsx1* 5′ UTR-Luc reporter mRNA with Shep and different concentrations of full region of *DAPALR* and its core element. Error bars indicate the standard error of the mean, n = 3. Black asterisks show significant statistics compared with the expression of the *Dsx1* 5′ UTR-Luc reporter mRNA. Gray asterisks show significant statistics compared with the Reporter mRNA with Shep. Error bars indicate the standard error of the mean, n = 3. *p<0.05, **p<0.01, ***p<0.001, ns: not significant (Student’s T-test).

To further confirm the direct interaction of Shep and its proposed binding site, we conducted a pulldown experiment using a FLAG-tagged Shep. We first confirmed that the FLAG-tagged Shep functioned the same as the wildtype Shep in suppressing the Dsx1 reporter mRNA in the presence of the TGE while the unrelated FLAG-tagged protein (Flag-EcR) as the negative control showed no effect on the translation of Dsx1 with or without the TGE (Fig 6A). The luciferase reporter mRNA harboring the intact TGE motif and another RNA without the motif were separately incubated to interact with the in vitro translated FLAG-tagged Shep and other controls, the Shep and the unrelated FLAG-tagged EcR. After pulldown using the M2 Anti-FLAG Affinity Gel, only the RNA with the intact TGE in the Shep-FLAG treatment showed highly significant enrichment (Fig 6B). The RNA without the TGE failed to bind with the Shep-FLAG, proving the exclusive binding of Shep to the RNA harboring the TGE. These results support that the TGE-like motif is indeed the Shep binding site and it is through this binding site that Shep regulates the Dsx1 translation.

DAPALR regulates translation efficiency

To exhibit the DAPALR-Shep regulation at the translational level, we performed the suppression experiment in vitro with the addition of the full region of DAPALR and its partial region harboring the core element that has the Shep binding site. Consistent with the in vivo experiment results, the addition of either the DAPALR or its core element to the Dsx1 reporter mRNA with the Shep binding site, enhanced the luciferase translation activity even in the presence of Shep (Fig 6C). Different concentrations of the full and core element of DAPALR were also tested and results showed that the effect of the two DAPALR versions were not significantly different from one another and their rescue efficiencies were both dose-dependent (Fig 6D). The concentration of DAPALR needed to be at least 5 times higher than the reporter mRNA and Shep to be able to observe its decoy activity. These results showed the role of DAPALR in canceling the suppression of Shep to Dsx1 translation.

Discussion

Amidst the increasing knowledge of lncRNAs, the function of sense overlapping lncRNA is still lacking. Here we investigated function of the Shep as a key player to harness the lncRNA and the gene expression of Dsx1. In females where Dsx1 is transcriptionally silenced, Shep loss-of-function increased the Dsx1 expression but it was still not as high in the manipulated females compared to that in males. Therefore, the Shep loss-of-function did not lead to sex reversal from female to male. In males, the Dsx1 expression was enhanced by the Shep loss-of-function throughout the body. Importantly, DAPALR overexpression led to similar change of the Dsx1 expression pattern both in females [4] and males (S3B Fig). To understand functional relationship on Dsx1 expression between Shep and DAPALR, we also performed in vitro experiments. The FLAG pulldown experiment showed the exclusive binding of Shep to the TGE and suppression experiment showed that Shep inhibits the translation of Dsx1 in presence of the TGE. Moreover, addition of DAPALR relieved the suppression caused by Shep and activated Dsx1 translation.

Based on the results, we propose the noise canceling mechanism as a function of the sense overlapping lncRNA and Shep. In females, Dsx1 transcription is repressed for avoiding masculinization. However, due to stochasticity in gene expression [11,12], there would be the noise in gene expression. In a previous study, we proved that improper expression of Dsx1 changes the expression profile of its downstream genes resulting in intersex [13]; which suggested that the stochastic transcription of Dsx1 causing population heterogeneity, should be avoided. In the presence of the Shep, the Dsx1 mRNA from the transcriptional noise cannot be translated immediately because of the binding of the Shep at the TGE-like motif. When the sense overlapping lncRNA DAPALR is expressed, the Shep is sequestered from the mRNA by the DAPALR and the Dsx1 translation is unlocked. This mechanism may function to avoid the unexpected expression of the Dsx1 to accomplish sexual dimorphic expression.

In our decoy model, a quantitative relationship between Shep, DAPALR, and Dsx1 mRNA needs to be considered. Although quantitative estimation of Shep in the DAPALR- and Dsx1-expressing cells is difficult, we assume that the quantity of Shep in the cell may define a threshold to cancel the effect of noisy transcription and the stochastic transcript below the threshold may not be translated because of the presence of Shep. The copy number of the DAPALR is one-tenth of the Dsx1 mRNA [4], which may be a sufficient quantity to unlock the Shep suppression. The less abundance of DAPALR may be related to the more localized expression in comparison to the Dsx1 because the extracted total RNA for qPCR was from the whole embryos. In this scenario, DAPALR may be expressed in cells only at the early stage of male differentiation and decrease the threshold of Dsx1 expression by sequestering the Shep protein. Then, the translated Dsx1 protein may activate its own promoter by a positive feedback loop to maintain Dsx1 expression. And since Shep seems to be ubiquitously expressed in different tissues in the whole body, this RBP may be able to silence Dsx1 expression in non-sexually dimorphic tissues that do not express DAPALR. This hypothesis is consistent when DAPALR was overexpressed ubiquitously or Shep expression was silenced by siRNA and the Dsx1 reporter mCherry expression was observed throughout the body even in the non-sexually dimorphic tissues. Further studies to prove this hypothesis could be investigated in the future.

Interestingly, both Dsx1 and Tra-2 are key regulators of sex determination [14] and they should be strictly regulated to avoid sexual ambiguity. Although there is no knowledge about the sense lncRNA at Tra-2 locus, a similar mechanism may function in Drosophila. The Shep is also known to function in neurogenesis [15] and the Shep functions at a translational level [16]. It may also be possible that the Shep suppresses the translation under the control of unknown lncRNA and the genes whose noisy expression is harmful to the cell may have such kind of noise-canceling system. The tight regulation of Dsx1 through Shep-dependent suppression and by lncRNA exhibits one mechanism of how nature keeps intersex and sexual ambiguity rare.

Shep has been reported to have many functions such as antagonizing chromatin insulator activity, transcriptional and post-transcriptional control, especially in neurogenesis [8,16,17]. Localization of Shep in the cytoplasm [9] also supports the possibility that Shep functions at a post-transcriptional level.

In this study, we focused on the Shep and found that the Shep functions as a noise canceler and the DAPALR unlocks it. For further understanding of the DAPALR, the other RNA binding protein, CGUBP1, should be considered to understand the robust sex-determination system in D. magna.

A similar mechanism is known in the lncRNA named linc-MD1, in which miRNA is sequestered from the mRNA by the lncRNA [18], and a competing endogenous RNA hypothesis has been proposed [19]. Our finding suggests that the RBP such as the Shep can be a target of competing endogenous RNA in a broad meaning.

In a previous study enumerating a list of post-transcription regulators that Shep binds to, 5 out 77 Shep targets are noncoding RNAs [16]. While none of which mechanisms have been studied extensively and that the three-way network of translation regulation involving an mRNA, noncoding RNA, and RBP may be the first involving Shep; this regulation may occur more commonly. It is predicted that the sense-overlapping lncRNAs comprise the majority of the lncRNA present [3]. And as Shep is expressed not only in neurons but other tissues [15,16], the unique role of DAPALR-Shep-Dsx1 may not only be for binary sex ultrasensitivity but also for binary regulation of other genes in various biological processes.

Materials and methods

Daphnia magna strains and transgenic lines culture

All of the wild-type (WT) and transgenic Daphnia magna lines share the same genetic background (NIES strain) and were cultured in AdaM medium [20] as previously described [5]. The transgenic line mostly used was the Dsx1-reporter strain that has the mCherry gene introduced upstream of the Dsx1 coding sequence [10]. This line also has GFP fused to histone H2B gene under the control of the elongation factor 1α1 promoter/enhancer. Another transgenic line was established from crossing the Dsx1-reporter line to wildtype and finally choosing the progeny that does not have the H2B-EGFP gene. Male daphniids were obtained by exposing 2–3 weeks old female to 1 μg/L of the synthetic JH analog Fenoxycarb (Wako Pure Chemical, Osaka, Japan) [21].

Preparation of bait RNAs and RNA pulldown assay

Preparation of Flag peptide conjugated bait RNAs were carried out as described previously [6]. Briefly, the T7-tagged cDNA template was amplified by the polymerase chain reaction (PCR), transcribed in vitro using the MEGAscript T7 kit (Invitrogen, Carlsbad CA, USA) and purified with an RNeasy Mini Kit (Qiagen). The 3´ end of purified cRNA was dialdehyded with 0.1 M NaIO₄, precipitated with 2% LiClO₄ in acetone and then washed with acetone. The pellet was dissolved in 0.1 M sodium acetate, pH 5.2 and then mixed with 30 mM hydrazide–Flag peptide. The resulting imine-moiety of the cRNA was reduced by adding 1 M NaCNBH3. The Flag -tagged-RNA was purified with an RNeasy Mini Kit (Qiagen).

For the pulldown assay, 1- or 2-day-old female larvae were lysed with lysis buffer [10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (pH 7.5), 150 mM NaCl, 50 mM NaF, 1 mM Na3VO4, 5 μg/ml leupeptin, 5 μg ml aprotinin, 3 μg/ml pepstatin A, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mg/ml digitonin] using pre-chilled Dounce homogenizer (type A pestle) and cleared by centrifugation. One mg of cleared lysate was incubated with five pmol of Flag-tagged bait RNA, anti-FLAG antibody (Sigma) and protein G conjugated magnetic beads (Thermo) rotate for 1h at 4°C. The magnetic beads were then washed three times with wash buffer [10 mM HEPES (pH 7.5), 150 mM NaCl, 0.1% Triton X-100] and co-immunoprecipitated RNA and proteins were eluted with Flag elution buffer [0.5 mg/ml Flag peptide, 10 mM HEPES (pH 7.5), 150 mM NaCl, 0.05% Triton X-100]. The bait RNA-associated proteins were then precipitated with TCA. Precipitated protein was re-dissolved in guanidine hydrochloride and reduced with TCEP, alkylated with iodoacetamide, followed by digestion with lysyl endopeptidase and trypsin. The digested peptide mixture was applied to a Mightysil-PR-18 (Kanto Chemical) frit-less column (45 3 0.150 mm ID) and separated using a 0–40% gradient of acetonitrile containing 0.1% formic acid for 80 min at a flow rate of 100 nL/min. Eluted peptides were sprayed directly into a mass spectrometer (QSTAR Elite, Sciex). The mass spectrometry and tandem mass spectrometry spectra were obtained in information-dependent acquisition mode and were queried against the Daphnia magna protein database (http://arthropods.eugenes.org/EvidentialGene/daphnia/daphnia_magna_new/Genes/earlyaccess/) with an in-house Mascot server (version 2.2.1. Matrix Science; [7].

Microinjection

Following the established protocol for microinjection [5], eggs were obtained from 2–3 week old D. magna right after ovulation and were transferred to ice-chilled M4 medium [22] with 80 mM sucrose. An injection marker, 1 mM Lucifer Yellow (Invitrogen, Carlsbad CA, USA), was mixed into the injection cocktail (plasmids, RNAs, and proteins) for each experiment. After injection, the surviving eggs were transferred into each well of 96-well plates which had 100 μL of M4-sucrose medium and were then kept in an incubator at 23°C.

CRISPR/Cas-mediated mutagenesis

Guide RNAs (gRNAs) were designed to recognize sequences that code for any of the two RNA Recognition Motifs (RRMs) of the Shep using the ZiFiT software from the website http://zifit.partners.org/ZiFiT/CSquare9Nuclease.aspx. The gRNA sequences were as follows: RRM1 (5´-CGACGACCGGCGGCAGTACC-3´) and RRM2 (5´-ACTTGCCGCCGCACATCACC-3´). To avoid the off-target effects, each gRNA sequence was confirmed to have more than 6 base pair mismatches with the other genes by using the Daphnia Genome Database because the DNA region with up to five base pair mismatches with the gRNA is susceptible to editing by the Cas9/gRNA complex [23,24]. These gRNAs were synthesized by the cloning-free method [25] and were transcribed using the MEGAscript T7 kit (Invitrogen, Carlsbad CA, USA). Series of purification procedures then followed: column purification using mini Quick Spin RNA gel columns (Roche Diagnostics, Mannheim, Germany), phenol/chloroform extraction, and ethanol precipitation. Finally, the purified RNAs were dissolved in DNase/RNase-free water and were mixed with Cas9 protein for microinjection into female eggs of Dsx1 reporter strain as previously described [5].

Somatic mutations of the injected embryos were confirmed by amplification of the target loci from the genomic DNA isolated from each sample. The genomic DNA was extracted by homogenization in 90 μL of 50 mM NaOH with zirconia beads of 1.0 ⌀ size. Samples were heated at 95 ^oC for 10 min, followed by a neutralization and stabilization step by adding 10 μL of 1 M Tris-HCl (pH 7.5) and 2 μL of 5 mM EDTA. Centrifugation followed at 13,000 g for 5 min, before the use of the supernatant as a template for PCR amplification of the target sequences. Using Hot Start Ex Taq Polymerase (Takara Bio, Shiga, Japan), RRM1 and RRM2 regions were amplified using the primer sets: Forward (5´- AAGGCTACAGCAGCTCGA -3´), Reverse (5´- CCGCGAATGTAGAGGTTG -3´) and Forward (5´- CCCACTAATTTGTACCTGGC -3´), Reverse (5´- CGCATTTCTCTCTGGATTC -3´) respectively, and amplicons were analyzed through native PAGE gel electrophoresis. Moreover, screening for germ-line mutagenesis was done by culturing the offspring of the injected embryos until they produced the next generation. The same genotyping procedure mentioned above was then performed until a positive mutant line was found and established.

RNAi

Small interference RNAs were designed using the Block-iT RNAi Designer at http://www.invitrogen.com/rnaidesigner.html. The siRNA targeting Shep gene sequence is as follows: shep_siRNA (5´-GCCTCCTATCAAGCGTCAA-3´). While for the negative control targeting a random sequence that does not affect the development of the Daphnia, this siRNA sequence was used: control_siRNA (5′-GGUUAAGCCGCCUCACAUTT-3′) [26]. Two nucleotides dTdT were added to each 3′ end of the siRNAs. The siRNAs were diluted with the injection marker 1 mM Lucifer Yellow dye (Invitrogen, Carlsbad CA, USA) to have the final concentration of 100 μM and were injected into eggs of the Dsx1 reporter daphnia strain at 2–3 weeks of age which were destined to be male or female. Samples were then observed at 30 h after injection and collected at 48 h for RNA extraction and cDNA synthesis as previously described [4]. RT-qPCR was then performed to check the expression level changes of the genes of interest (Shep, Dsx1, and mCherry) between the control_siRNA- and shep_siRNA-injected samples.

Quantitation of the fluorescence

Samples were observed and their photos were taken using Leica DC500 CCD Digital Camera mounted on Leica M165FC fluorescence microscope (Leica Microsystem, Mannheim, Germany). Fluorescence photography was done using GFP and mCherry filters under the following conditions: 1.0 s exposure time, 3.0x gain, 1.0 saturation and 1.0 gamma for GFP and 2.0 s exposure time, 8.0x gain, 1.0 saturation and 1.6 gamma for mCherry. mCherry and GFP fluorescence intensities were calculated using the ImageJ software, following the calculation protocol of a previous study [27]. The total embryo fluorescence of each sample was normalized by the background fluorescence measurement. In addition, Relative Fluorescence Intensity (RFI) was calculated by dividing the total embryo fluorescence of the injected embryos by the uninjected embryos from the same clutch to nullify the differences in auto-fluorescence between embryos from different mothers. The RFIs of the control samples were then compared against the RFI of the treated embryos. At least 5 control and treated embryos were used for quantitation of the fluorescence at 30 h and 48 h post-injection.

Quantitative RT-PCR

To analyze the temporal changes in Shep expression level during embryogenesis, cDNA previously synthesized [28] from male and female daphniids at different time points: 0, 6, 12, 18, 24, 30, 48, and 72 h after ovulation were used. These samples were subjected to RT-qPCR using the cDNA synthesized from the total RNA of daphniids at each stage.

To measure the expression levels of Shep and Dsx1 in RNAi, mutagenesis and overexpression experiments, the cDNAs of each sample were prepared in three replicates for RT-qPCR analysis. mRNA transcripts were measured using Mx3005P Real-Time QPCR System (Agilent Technologies) under the following conditions: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min and using SYBR Green qPCR SuperMix (Invitrogen, Carlsbad CA, USA) and specific primers designed (S3 Table) to amplify short PCR products (<150 bp). Expressions based on the Ct value during amplification were calculated and normalized by quantitating the expression level of several reference genes: the ribosomal protein L32, ribosomal L8 gene and Cyclophilin gene [29]. The geometric mean of the reference genes was calculated for normalization as previously described [30]. The normalized expression levels of the treated samples were then relatively compared to the expression levels of the control to get the final values. Lastly, gel electrophoresis and dissociation curve analysis were performed to confirm the correct amplicon size and the absence of non-specific bands.

Ectopic expression of intact and deleted Shep binding site

From pCS-EF1a1::Dsx1 exon3 [4], the region of Dsx1 exon 3 except for the 40 nt sequence which contains the putative binding site of Shep (Shep BS) was removed for the construct of pCS-EF1a1::Shep BS using the following primer set: Forward (5´- GTGTGTGTGTGTGTGTTGACGTT -3´) and Reverse (5´- AACACACACACACACACACCCGGGCATTGTGATTG -3´). This plasmid was then used as a template to delete the potential Shep binding site using the primer set as follows: Forward (5´-GTGTGTGTGTTGACGTTTTTCCAATATATAGATGGAGGC-3´) and Reverse (5´- GCCTCCATCTATATATTGGAAAAACGTCAACACACACAC-3´). Embryos injected with each plasmid were compared to embryos injected with pCS-EF1a1::EF1a1 UTR, which only has the EF1α1 5´UTR and 3´UTR [4]. These three plasmids (200 ng/μl) were each injected into female eggs of the Dsx1-reporter strain. Injected eggs were observed 30 h after injection to observe and calculate for the fluorescence intensity differences.

RNA synthesis

To prepare the GFP reporter mRNA harboring the Dsx1α 5′ UTR, the expression plasmid pEX-A2JI that has the EF1α1 3´ UTR and T7 promoter was first synthesized by Eurofins Genomics. Second, the GFP coding sequence of the 4xEcRE-H2B-GFP plasmid [31] was fused with the EF1α1 3´ UTR. Third, Dsx1α 5′ UTR was amplified with PCR using the pCS-EF1a1::Dsx1 exon 3 as a template and fused with the GFP harboring EF1α1 3´ UTR to construct the mRNA template plasmid pEX-Dsx1 5′ UTR::GFP. Fourth, using this plasmid, the potential Shep binding site was removed with the same primer set described above, resulting in the generation of the pEX-Dsx1 5′ UTR mutant::GFP. To overexpress Shep, chimeric Shep cDNA harboring the EF1α1 5′ UTR and 3´UTR was designed and subcloned downstream to the T7 promoter as described previously [27]. The Shep CDS of this plasmid was then replaced with the CDS of GFP to serve as control mRNA.

In vitro transcription and poly(A) tail addition for all mRNAs were performed using T7 RNA polymerase and Poly(A) Tailing kits, respectively (Ambion, Foster City, CA, USA). The size of synthesized RNAs and length of the attached poly(A) tail were analyzed by denaturing formaldehyde gel electrophoresis and were taken into account for the RNA amounts used for microinjection.

Luciferase-based in vitro translation assay

Luciferase reporter mRNAs were prepared by using pEX-Dsx1 5′ UTR::GFP and pEX-Dsx1 5′ UTR mutant::GFP and replacing its GFP CDS with the Luciferase gene sequence from pG5luc (Promega Corporation, Madison, WI). 0.1 μM of these mRNAs were then transcribed using the nuclease-treated rabbit reticulocytes lysate (RRL) in vitro translation system from Promega. Following the manufacturer’s protocol, each reaction contained 70% v/v of RRL, 0.02 mM amino acid mixture, 0.5 U/μL RNase Inhibitor (Nacalai Tesque Inc., Kyoto, Japan), and specific concentrations of the mRNAs based on their molecular size. After denaturing at 65°C for 3 min, luciferase reporter mRNAs were added after pre-incubating the RRL in vitro translation mixture at 30°C for 10 min. The assembled reaction was then further incubated at 30°C for 90 min and stopped by the addition of 60 μM puromycin. Firefly luciferase activity was then observed using LuminoSkan Ascent where 50 μL Bright-Glo Luciferase assay reagent (Promega Corporation, Madison, WI) was added to 3 μL of the translated reaction. The luminescence data were normalized by subtracting the measurements from the in vitro translation reaction without any reporter mRNAs. In the different experiments, the Shep mRNA, Shep-FLAG mRNA, DAPALR full RNA (3.6 kb), RNA transcribing the core element of DAPALR harboring the Shep binding site (40 nt) and negative controls (EcR-FLAG and GFP mRNAs) were added together with the reporter mRNAs to test their effect on the translation activity. The full sequence of DAPALR and its core element are shown in S6 Fig.

UV crosslinking and FLAG pulldown assay

3 x FLAG (5´-GACTACAAAGACCACGACGGTGATTACAAAGATCACGACATCGATTACAAGGATGACGATGACAAA-3´) was fused to the 3´ end of the Shep CDS in pCS-EF1a1::Shep to make the mRNA template plasmid pCS-EF1a1::Shep-FLAG. Shep-FLAG mRNA was transcribed in vitro and poly(A) was added following the same protocol mentioned above. It was then translated using the nuclease-treated rabbit reticulocytes lysate (RRL) in vitro translation system from Promega following the same protocol above. The reaction lysate was then divided equally into two tubes wherein 10 μg of the luciferase reporter mRNA with the Shep binding site was added into one tube and the reporter mRNA without the Shep binding site was added into the other. Both treatments were irradiated under ultraviolet (UV) light at 200 mJ/cm² and were then transferred to a tube containing 50 μL of PVP-treated anti-FLAG M2 Affinity Gel, rotated at 4°C for 2 h. Washing was done five times using the High-salt wash buffer [50 mM Tris-HCl (pH 7.4), 1 M NaCl, 1 mM EDTA, 1% Igepal CA-630, 0.1% SDS, 0.5% sodium deoxycholate] and the gel was resuspended using PK buffer [100 mM Tris-HcL (pH 7.4), 50 mM NaCl, 10 mM EDTA] with 200 μg of proteinase K for 20 min at 37°C as previously described [32]. Total RNA extraction [4] was then performed wherein 10 μg of yeast tRNA (Invitrogen, Carlsbad CA, USA) was added as co-precipitant to ensure the collection of a minute amount of RNA, which was followed by cDNA synthesis. RT-qPCR targeting the bait RNAs and the tRNA as a reference gene was conducted using the primer sets enumerated in S3 Table. The geometric mean of the expression levels of the tRNA genes (Met and Phe) was calculated for normalization as previously described [30]. The wildtype Shep mRNA and an unrelated mRNA, EcR-FLAG were used as negative controls. The normalized expression levels of all samples were then relatively compared to the expression level in the EcR-FLAG pulldown experiment with the RNA that has no Shep binding site to get the final values.

Supporting information

S1 Fig. Phylogenetic tree of the RRM domains of the Shep orthologs.

RRMs of Shep orthologs are labeled with red while the Sex-lethal (SXL) RRM is boxed in blue. The percentages of the replicate tree in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches. The bar indicates branch length and corresponds to the mean number of the differences (P<0.05) per residue along each branch. Evolutionary distances were computed using the p-distance method.

(TIF)

Click here for additional data file.^{(589.7KB, tif)}

S2 Fig. Multiple sequence alignment of the evolutionarily conserved RRM domains of Shep.

Alignment of the RNA Recognition Motifs (RRMs) of the different Shep orthologs from different organisms. The color is based on the physicochemical property of the amino acid-based on ClustalW. The boxes represent the position of the two RRM regions.

(TIF)

Click here for additional data file.^{(1.7MB, tif)}

S3 Fig. Similarity of DAPALR overexpression and Shep knockdown phenotype.

(A) Ventral view of female and male embryos of Dsx1 reporter strain injected with control siRNA and Shep siRNA and observed at 30 h after injection. mCherry fluorescence allowed visualization of Dsx1 expression while GFP fluorescence in the nucleus enabled observation of body structures. The bright field images were used to understand the localization pattern of mCherry expression. (B) Ventral view of male embryos of Dsx1 reporter strain injected with control plasmid and DPALR-expressing plasmid observed at 30 h after injection.

(TIF)

Click here for additional data file.^{(1.4MB, tif)}

S4 Fig. Embryonic stage of generated Shep mutant line.

Ventral view of female and male embryos of Shep mutant line observed at 30 h after ovulation. mCherry fluorescence allowed visualization of Dsx1 expression while GFP fluorescence in the nucleus enabled observation of body structures. The bright field images were used to understand the localization pattern of mCherry expression.

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

S5 Fig. Diverse phenotype of Shep mutants and their genomic mutations.

(A) Ventral and lateral views of the different phenotypes observed after injection of Cas9 and Shep-targeting gRNAs: (from L to R) normal development, delayed development, abnormal development and unhatched egg. Phenotypes of uninjected embryos showing normal development were also shown as control phenotypes at each stage. mCherry fluorescence allowed visualization of Dsx1 expression while GFP fluorescence in the nucleus enabled observation of body structures. The merged images of mCherry and GFP were used to understand the localization pattern of mCherry expression. Bright field showed photos of embryos taken using visible light. Scale bar = 200 μm. (B) PAGE analysis of PCR products by genomic PCR to amplify the region targeted by each RRM-targeting gRNAs. Asterisks show the genomic mutations in RRM1- and RRM2-coding sequences of embryos showing the different phenotypes after Shep mutagenesis.

(TIF)

Click here for additional data file.^{(2MB, tif)}

S6 Fig. The nucleotide sequence of DAPALR and its core element.

The full sequence of DAPALR is shown. Its overlapping region with Dsx1 5´ UTR (205 bp) is highlighted in yellow. Colored in red is the 40 nt core element of DAPALR harboring the Shep binding site. The blue box indicates the 10 bp of the sequece subjected to deletion of the Shep binding site for the in vitro and in vivo experiments.

(TIF)

Click here for additional data file.^{(1.3MB, tif)}

S1 Table. Full Mass Spectrometry Data.

(XLSX)

Click here for additional data file.^{(37.7KB, xlsx)}

S2 Table. Summary of mutagenesis experiment.

(DOCX)

Click here for additional data file.^{(38.3KB, docx)}

S3 Table. Primer sequences for RT-qPCR.

(DOCX)

Click here for additional data file.^{(16.4KB, docx)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by 17H05610, 20H04853 to S.A., 20H04923, 19H05423, 18H04884 and 17H05602 to K.Y. and 18H04619, 17K19236 and 17H01880 to H.W. from Japan Science Promotion Society (JSPS), Japan (https://www.jsps.go.jp/english/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Wang KC, Chang HY. Molecular Mechanisms of Long Noncoding RNAs. Molecular Cell. 2011. pp. 904–914. doi: 10.1016/j.molcel.2011.08.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Hentze MW, Castello A, Schwarzl T, Preiss T. A brave new world of RNA-binding proteins. Nat Rev Mol Cell Biol. 2018;19: 327–341. doi: 10.1038/nrm.2017.130 [DOI] [PubMed] [Google Scholar]
3.Kuo RI, Tseng E, Eory L, Paton IR, Archibald AL, Burt DW. Normalized long read RNA sequencing in chicken reveals transcriptome complexity similar to human. BMC Genomics. 2017;18: 1–19. doi: 10.1186/s12864-016-3406-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Kato Y, Perez CAG, Mohamad Ishak NS, Nong QD, Sudo Y, Matsuura T, et al. A 5′ UTR-Overlapping LncRNA Activates the Male-Determining Gene doublesex1 in the Crustacean Daphnia magna. Curr Biol. 2018;28: 1811–1817. doi: 10.1016/j.cub.2018.04.029 [DOI] [PubMed] [Google Scholar]
5.Kato Y, Kobayashi K, Watanabe H, Iguchi T. Environmental sex determination in the branchiopod crustacean Daphnia magna: Deep conservation of a Doublesex gene in the sex-determining pathway. PLoS Genet. 2011;7: e1001345. doi: 10.1371/journal.pgen.1001345 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Adachi S, Homoto M, Tanaka R, Hioki Y, Murakami H, Suga H, et al. ZFP36L1 and ZFP36L2 control LDLR mRNA stability via the ERK-RSK pathway. Nucleic Acids Res. 2014;42: 10037–10049. doi: 10.1093/nar/gku652 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Natsume T, Yamauchi Y, Nakayama H, Shinkawa T, Yanagida M, Takahashi N, et al. A direct nanoflow liquid chromatography—Tandem mass spectrometry system for interaction proteomics. Anal Chem. 2002;74: 4725–4733. doi: 10.1021/ac020018n [DOI] [PubMed] [Google Scholar]
8.Chen D, Brovkina M, Matzat LH, Lei EP. Shep RNA-binding capacity is required for antagonism of gypsy chromatin insulator activity. G3 Genes, Genomes, Genet. 2019;9: 749–754. doi: 10.1534/g3.118.200923 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Mapes J, Chen J-T, Yu J-S, Xue D. Somatic sex determination in Caenorhabditis elegans is modulated by SUP-26 repression of tra-2 translation. Proc Natl Acad Sci. 2010;107: 18022–18027. doi: 10.1073/pnas.1004513107 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Nong QD, Mohamad Ishak NS, Matsuura T, Kato Y, Watanabe H. Mapping the expression of the sex determining factor Doublesex1 in Daphnia magna using a knock-in reporter. Sci Rep. 2017;7: 13521. doi: 10.1038/s41598-017-13730-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Kærn M, Elston TC, Blake WJ, Collins JJ. Stochasticity in gene expression: From theories to phenotypes. Nat Rev Genet. 2005;6: 451–464. doi: 10.1038/nrg1615 [DOI] [PubMed] [Google Scholar]
12.Ozbudak EM, Thattai M, Kurtser I, Grossman AD, Van Oudenaarden A. Regulation of noise in the expression of a single gene. Nat Genet. 2002;31: 69–73. doi: 10.1038/ng869 [DOI] [PubMed] [Google Scholar]
13.Nong QD, Matsuura T, Kato Y, Watanabe H. Two Doublesex1 mutants revealed a tunable gene network underlying intersexuality in Daphnia magna. PLoS One. 2020;15: 1–19. doi: 10.1371/journal.pone.0238256 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kuwabara PE, Okkema PG, Kimble J. tra-2 encodes a membrane protein and may mediate cell communication in the Caenorhabditis elegans sex determination pathway. Mol Biol Cell. 1992;3: 461–473. doi: 10.1091/mbc.3.4.461 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Chen D, Qu C, Hewes RS. Neuronal remodeling during metamorphosis is regulated by the alan shepard (shep) gene in Drosophila melanogaster. Genetics. 2014. doi: 10.1534/genetics.114.166181 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Olesnicky EC, Antonacci S, Popitsch N, Lybecker MC, Titus MB, Valadez R, et al. Shep interacts with posttranscriptional regulators to control dendrite morphogenesis in sensory neurons. Dev Biol. 2018;444: 116–128. doi: 10.1016/j.ydbio.2018.09.022 [DOI] [PubMed] [Google Scholar]
17.Chen D, Dale RK, Lei EP. Shep regulates Drosophila neuronal remodeling by controlling transcription of its chromatin targets. Dev. 2018;145: dev154047. doi: 10.1242/dev.154047 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011;147: 358–369. doi: 10.1016/j.cell.2011.09.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: The rosetta stone of a hidden RNA language? Cell. 2011;146: 353–358. doi: 10.1016/j.cell.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Klüttgen B, Dülmer U, Engels M, Ratte HT. ADaM, an artificial freshwater for the culture of zooplankton. Water Res. 1994;28: 743–746. doi: 10.1016/0043-1354(94)90157-0 [DOI] [Google Scholar]
21.Tatarazako N, Oda S, Watanabe H, Morita M, Iguchi T. Juvenile hormone agonists affect the occurrence of male Daphnia. Chemosphere. 2003;53: 827–833. doi: 10.1016/S0045-6535(03)00761-6 [DOI] [PubMed] [Google Scholar]
22.Elendt BP, Bias WR. Trace nutrient deficiency in Daphnia magna cultured in standard medium for toxicity testing. Effects of the optimization of culture conditions on life history parameters of D. magna. Water Res. 1990;24: 1157–1167. doi: 10.1016/0043-1354(90)90180-E [DOI] [Google Scholar]
23.Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013;31: 233–239. doi: 10.1038/nbt.2508 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013;31: 822–826. doi: 10.1038/nbt.2623 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Gagnon JA, Valen E, Thyme SB, Huang P, Ahkmetova L, Pauli A, et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014;9: e106396. doi: 10.1371/journal.pone.0098186 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Asada M, Kato Y, Matsuura T, Watanabe H. Early embryonic expression of a putative ecdysteroid-phosphate phosphatase in the water flea, daphnia magna (Cladocera: Daphniidae). J Insect Sci. 2014;14: 1–6. doi: 10.1093/jis/14.1.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Törner K, Nakanishi T, Matsuura T, Kato Y, Watanabe H. Optimization of mRNA design for protein expression in the crustacean Daphnia magna. Mol Genet Genomics. 2014;289: 707–715. doi: 10.1007/s00438-014-0830-8 [DOI] [PubMed] [Google Scholar]
28.Mohamad Ishak NS, Kato Y, Matsuura T, Watanabe H. Sequence conservation and sexually dimorphic expression of the Ftz-F1 gene in the crustacean Daphnia magna. PLoS One. 2016;11: e0154636. doi: 10.1371/journal.pone.0154636 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Sumiya E, Ogino Y, Toyota K, Miyakawa H, Miyagawa S, Iguchi T. Neverland regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea Daphnia magna, and may thus act as a target for chemical disruption of molting. J Appl Toxicol. 2016;36: 1476–1485. doi: 10.1002/jat.3306 [DOI] [PubMed] [Google Scholar]
30.Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3: research0034.1. doi: 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Asada M, Kato Y, Matsuura T, Watanabe H. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia. Mar Environ Res. 2014;93: 118–122. doi: 10.1016/j.marenvres.2013.11.005 [DOI] [PubMed] [Google Scholar]
32.Huppertz I, Attig J, D’Ambrogio A, Easton LE, Sibley CR, Sugimoto Y, et al. iCLIP: Protein-RNA interactions at nucleotide resolution. Methods. 2014;65: 274–287. doi: 10.1016/j.ymeth.2013.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Genet. doi: 10.1371/journal.pgen.1009683.r001

Decision Letter 0

John M Greally, Daniela Delneri

5 Mar 2021

Dear Dr Watanabe,

Thank you very much for submitting your Research Article entitled 'Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression.' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Daniela Delneri

Guest Editor

PLOS Genetics

John Greally

Section Editor: Epigenetics

PLOS Genetics

Editor's comment: The primary issue seem to be the lack of strong biochemical data to infer that shep interacts directly with Dsx or DAPALR. In the revised version, additional experimental evidence that support translational repression is encouraged.

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The manuscript by Perez et al presents a potentially interesting mode of translational regulation via a long non-coding RNA (lncRNA). The authors present data that suggest that the protein shep inhibits Dsx1 alpha isoform translation by the binding to a specific RNA element in the 5’ UTR called the TGE. Interestingly, there is a sense lncRNA called DAPALR, produced from the same region and containing a TGE, which is proposed to sequester shep and would therefore regulate Dsx1 translation. While this represents an interesting role for lncRNA regulation of gene expression, unfortunately the current manuscript is not well presented, the methods are inadequately described and direct evidence of shep binding to the DAPALR and Dsx1 RNA is lacking.

Major comments

1) It would be very useful if Figure 1 had a simple diagram displaying the orientation of the DAPALR lncRNA with the Dsx1 alpha mRNA and an overall layout of the Dsx1 genomic region including the different isoforms.

2) Lines 51-53 – The statement “DAPALR is transcribed from upstream of the transcription start site and overlaps with the 5´ UTR of the Dsx1 alpha isoform, both of which are exclusively expressed in males (Kato et al, 2018, 2011).” needs clarification. Is only the Dsx1 alpha isoform expressed in males and other Dsx1 isoforms exist and are expressed in both males and females? How many Dsx1 isoforms are there and what is their expression in males and females. Does DAPALR only overlap the 5’ UTR of the Dsx1 alpha isoform and not the other isoforms?

3) The description of the RNA pulldown and mass spectrometry methods lack detail (Lines 249-258). The Adachi & Natsume, 2015 reference the authors cite is not open access so it would be difficult for people to see the methods this work is based on. In any case, even with access to this reference key specific details used here are missing. What is the exact 205bp sequence used to make the RNA? How were cell lysates made from female larvae? What were the buffers used for the pulldown, washing and elution? Finally, how was the mass spectrometry carried out? For example, how were pulldown samples prepared for mass spectrometry, what type of mass spectrometry was used, how was the mass spectrometry data analysed and what were the criteria for identifying the three candidate proteins with a higher probability for binding to the overlapping sequence of DAPALR? Also the full mass spectrometry data should be presented as a supplementary file or a link to the data should be given.

4) What is the justification for using female larvae for cell lysates (line 254) when in lines 51-53 it is stated that DAPALR and Dsx1 alpha are exclusively expressed in males? Even though Shep is expressed in both males and females how could you be sure you are not missing a male specific factor that binds to DAPALR and Dsx1?

5) No direct evidence is given for the binding of shep to the TGE like element. Can shep pulldown a DAPALR and Dsx1 RNA with the TGE and when the TGE is mutated is this interaction inhibited? Can shep interact with a TGE RNA in vitro as determined by a technique like EMSA?

6) Additionally, overexpression of the TGE does not directly support the conclusion that the “TGE like motif is essential for Shep and for DAPALR’s function in regulating Dsx1.” How do you know that the TGE is not sequestering another RNA binding protein required for regulating Dsx1 translation?

7) As there is no direct evidence presented for shep binding to a TGE the authors can not call the TGE a “shep binding site”. The experiments presented in Figure 5C and 5D are therefore over interpreted when it is stated that “Shep suppresses the translation by binding to the Dsx1α 5´ UTR”. Can you show that shep does not bind or has reduced binding to an RNA without a TGE?

8) The in vitro luciferase assays presented in Figure 5E require a negative control mRNA in place of the shep mRNA. How do you know that having two mRNAs in the reaction (reporter mRNA and shep mRNA) does not compete for the available ribosomes in the reticulocyte lysate and that is why you have reduced luciferase activity from the reporter mRNA?

9) Mapes et al 2010 showed that the shep C. elegans ortholog, SUP-26, associates with poly(A)-binding protein 1 (PAB-1) in vivo and may repress tra-2 expression by inhibiting the translation-stimulating activity of PAB-1. Does shep interact with the Daphnia PAB-1?

10) A CLIP type technique should be used to determine the range of RNAs that shep binds to and determine whether the shep interacting RNAs are mostly mRNAs or are there other ncRNAs that shep can bind to. It would be interesting to see if all these RNAs contained a TGE. This type of analysis would greatly improve the impact of this manuscript. Is DAPALR the sole example of this mechanism of translational regulation or does this regulation occur more commonly?

Minor comments

The manuscript requires improved English language throughout.

Line 27 – missing word? - determining gene “in” Daphnia magna

Lines 32-34 – sentence is confusing/not clear - “These results suggest that the presence of Shep suppresses the unintentional translation of Dsx1 by setting a threshold and expression of the sense lncRNA, DAPALR cancels the suppression.”

Line 51 – the statement “DAPALR is transcribed from upstream of the transcription start site..” is not clear. Please state what transcription start site you are referring to. I assume it is the Dsx1 alpha transcription start site?

Lines 56-57 – the statement “A series of results showed that Shep functions as a suppressor by binding Dsx1 mRNA 57 and DAPALR sequesters the Shep to activate the dsx1 translation.” is vague. Please specifically state what the “series of results” are.

Lines 106-107 – How can you say DAPALR overexpression causes increased Dsx1 mRNA when you have not specifically measured Dsx1 mRNA by RT-qPCR and have only observed increased mCherry signal in Extended Data Figure 3?

Lines 113-114 – The statement “We used two types of gRNAs targeting each RRM on the Dsx1 reporter strain and obtained a line that has frameshift mutation by 15 nt insertion just before the RRM1 domain” is confusing. This is not a “frameshift” mutation as the correct reading frame is still maintained, it is just an insertion mutation.

Reference needed for the information given in lines 149-151 – Mapes et al 2010

Line 181 – this section and Figure 5E describes an in vitro assay so it is confusing when the authors state that “the Shep suppresses the translation of the injected mRNA (Fig. 5e).” This statement needs to be explained better as I believe the authors are referring back to a previous result.

Line 201 – “is caused by” should be replaced with “causing”

Lines 308-309, line 324 – what were the specific primers used for RT-qPCR of shep, dsx1 and mCherry? Do the dsx1 primers detect all the isoforms?

The Materials and Methods section needs to include the detailed methods of how relative fluorescent intensity differences were obtained and calculated for Figures 2B, 4B and 5D.

Figure 5, panels 5D and E – what do the letters “a” “b” “c” represent above each of the bars in the graphs? This information should be provided in the Figure 5 legend.

Please define somewhere in the methods what the exact sequences of the DAPALR full and DAPALR partial that are used in Figure 5E.

Many of the references are missing their Journal, Volume and/or Pages.

Reviewer #2: In the manuscript Perez et al., the authors identify Shep as an RNA-binding protein of the Daphnia lncRNA DAPALR. Previous work has shown that expression of DAPALR induces the expression of Dsx1, a gene with which it overlaps on the same strand. Both DAPALR and Dsx1 are expressed only in males and are required for male determination. Shep on the other hand is expressed in both males and females. The authors perform a series of experiments using reporter constructs showing that manipulation of Shep levels affect Dsx1 expression but not mRNA levels and conclude that Shep must repress translation of Dsx1 similarly to what has been suggested for the C. elegans Shep homolog Sup-26 translational repression of tra-2. The authors identify a TGE sequence in Dsx1 and DAPALR similar to that identified in tra-2 and perform a series of experiments to suggest that the TGE sequence alone is necessary and sufficient for these effects. Aside from reporter constructs, one in vitro translation experiment is performed in reticulocyte lysate to show that translation of Dsx1 5’ UTR fused to a reporter is sensitive to the presence of Shep and additional DAPALR ncRNA. Overall the results are consistent with the possibility that Shep contributes to translational repression of Dsx1, but no direct biochemical evidence is provided, such as interaction of Shep with translational machinery or changes in Dsx1 mRNA association with translating ribosomes. The results are also consistent with the possibility that DAPALR acts a decoy. The results may be of interest to those studying lncRNA or translation.

Specific points:

1. The authors claim that Shep knockdown results in a pattern that resembles overexpression of DAPALR in females. Do the authors mean males, which is what is shown in Extended Fig. 3?

2. Why is 2x greater Dsx1 transcript observed in females after Shep knockdown in Fig. 2? The explanation of the yolk doesn’t make any sense to me. Are the authors suggesting that Shep regulates Dsx1 expression through a different mechanism specifically in female yolk?

3. Lack of changes of Dsx1 mRNA expression is used throughout the manuscript to argue that the observed effects on reporter expression are due to changes in translation efficiency. The authors should use a second reference transcript other than ribosomal protein L32 to ensure that their results are correctly calibrated.

4. Why do the authors think that the Shep mutant that they generated in Fig. 3 does not increase Dsx1 mRNA levels in females in the same fashion as the Shep knockdown? Is this related to the differences in developmental stage observed? Why aren’t embryos examined for these mutants as in other figures?

5. In Fig. 5, it would be better to use a scrambled sequence for the TGE rather than a full deletion. “Mutated” is a misleading term.

6. In Fig. 5E, the authors should do controls of addition of DAPALR full or partial in the absence of Shep mRNA to ensure that these are Shep-dependent effects.

7. The authors should also consider doing more quantitative experiments to test the decoy model.

Reviewer #3: Comments

In the previous study, the authors' group identified a lncRNA called DAPALR overlapping with the 5'-UTR of the Doublesex1 (Dsx1), which is the male determining gene in Daphnia magna. In the present study, the authors identified the Shep protein as a DAPLAR binding protein and provided a several lines of evidence that Shep functions as a supressor by binding Dsx1 mRNA and DAPLAR sequesters the Shep to activate the dsx1 translation.

Overall, this is a nicely done, and several interesting observations are represented and discussed. However, it remains obscure that the importance of the Shep-DAPALR interaction for governing sexual dimorphic expression of Dsx1. This is because the authors did not mention any about whether functional depletion of Shep by RNAi or CRISPR affects sexual dimorphic trait in the text. Such data was given as supplementary figures but I think these figures should move to the main body of the manuscript and the authors should give some explanations and discussions about the phenotype observed in individuals treated with Shep RNAi and individuals with Shep mutations. Thus, I think major revisions as described below are required prior to the publication.

Major comments for revision

1. Fig. 2A. Did the siRNA mediated knockdown of Shep expression affect sexual development? The author should give some explanations about the phenotype observed in the siShep animals by referring extended figure 3B.

2. Fig. 2C. The expression level of Dsx1 in the siShep females was more than twice as high as that in control females. Was the level comparable to that in normal males? If so, did the siShep females exhibit partial or complete female-to-male sex reversal? I think the authors should describe about such information to help readers to understand the importance of Shep in sexual differentiation. If the siShep females did not show such sex reversal phenotype, then the authors should give some discussions about why knockdwon of Shep expression did not affect sexual development.

3. Fig. 2B~2E. The authors described that RT-qPCR results were normalized with L32 expression levels. However, the values shown in the graph are obviously indicated as relative to the gene expression level in siControl animals. The authors should explain this discrepancy.

4. Lines 106-109. Shep RNAi and DAPALR overexpression in embryos caused increased level in Dsx1 expression in yolk cells. The authors proposed that this may be due to the unique system specialized for energy metabolism in yolk cells. But I don't think this explanation is reasonable for the increased level of Dsx1 expression in yolk cells. The authors should propose more detailed and reasonable mechanisms for how Dsx1 expression was increased by Shep RNAi and DAPALR overexpression in yolk cells.

5. Lines 113-114. In the present study, several lines with mutations in Shep gene were establiShep by CRISPR/Cas9 system. How did the authors rule out the possibility of off-targeting effect. They should provide evidence to prove that the phenotype observed in the Shep mutants were not due to the off-targeting effect.

6. Fig. 3C. The Shep mutation caused increased level of Dsx1 expression in females. Did the Shep mutant females show partial or complete female-to-male sex reversal? The author should clarify this point by referring Extended Data Figure 4 that shows phenotype of the Shep mutants. If the the Shep mutant females did not exhibit any abnormalities in sexual development, then the authors should give some reasons.

7. Fig. 3C, dotted lines. The authors said that the red signal from the guts surrounded by the dotted lines represents the autofluorescence of the food used in daphnia rearing. Then, similar red signal should be observed in males. Why was the red signal only observed in females?

8. Fig. 3D. As shown in Fig. 2C, Shep knockdown caused increased level of Dsx1 expression in female embryos. On the other hand, Shep mutation did not cause such increment in Dsx1 expression level in females. The authors should explain this discrepancy.

9. Lines 128-129. The authors conclude that Shep controls Dsx1 expression at post-transcriptional levels. However, their previous study reported that Dsx1 mRNA level in females was much lower than that in males. If so, the protein level of Dsx1 should be still lower in females than in males even though post-transcriptional suppression by Shep is disrupted by the Shep mutation. The authors should give some explanations about this discrepancy.

10. Extended data Figure 4A. The sex of each individual in the photo should be clearly stated. Also, the authors should make clear whether these individuals show abnormalities in the sexual dimorphic traits. Was the sexual difference in the expression pattern of Dsx1 in these mutants disrupted? The authors should also give some explanations about this to verify whether Shep is indeed responsible for sexual dimorphic expression of Dsx1 protein.

11. Extended data Figure 4B. The images described in this figure are uncomfortable. The authors should load the PCR products on the same gel to precisely compare the size of each band and show a full-picture of the gel to show that each band representing deletion or insertion mutation was specifically observed in the mutant animals. Also the position of the asterisk should be modified to exactly next to the band (in the present version, several asterisks are positioned at where there is no band). The authors should also show the nucleotide sequences of the deletion and insertion mutations as shown in Fig. 3A and clarify whether these mutations cause a frame-shift mutation or not.

Minor comments for revision

1. The entire text and all figures. Regarding the notation of "Shep", the gene symbol should be written as "Shep" in italic notation. The "Shep" notation is only acceptable when it means Shep protein. The same applies to Dsx1.

2. Fig. 2A, 3C, 4A, 5B, and Extended data Figure 5A and 5B. Adding a bright field image will help the reader understand the results.

3. Fig. 3A. Not only show the amino acid sequence encoded by the insertion mutation, but also show the amino acid sequence encoded by the wild-type Shep gene.

4. Line 153. Remove "we overexpressed" because it's redundant in the sentence.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: No: Mass spectrometry methods and data were not provided. How fluorescent intensity differences were obtained and calculated for Figures 2B, 4B and 5D was not presented.

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Raymond O'Keefe

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2021 Jul 28;17(7):e1009683. doi: 10.1371/journal.pgen.1009683.r002

Author response to Decision Letter 0

1 May 2021

Attachment

Submitted filename: renamed_43918.docx

Click here for additional data file.^{(55KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1009683.r003

Decision Letter 1

John M Greally, Daniela Delneri

26 May 2021

Dear Dr Watanabe,

Thank you very much for submitting the revised version of your Research Article entitled 'Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression.' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the improvements, but still raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a revised version. We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. In particular, Reviewer 1 has raised concerns about drawing conclusions in the absence of an experiment that they are recommending, we would encourage you to pay particular attention to this issue.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Daniela Delneri

Guest Editor

PLOS Genetics

John Greally

Section Editor: Epigenetics

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors have provided an improved manuscript and have addressed almost all my concerns sufficiently with revised text and additional experiments and controls. However, a "direct" interaction between shep and the DAPALR or Dsx1 RNA has still not been proven. The new in vitro pulldown assays (Figure 6B), used to prove a direct interaction, contain rabbit reticulocyte lysate so there is still the possibility that the interaction between shep and the TGE containing RNA is not direct. As such, the authors still cannot convincingly say that there is not another protein from the reticulocyte lysate that may be bridging the interaction between shep and the RNA. There are two experiments the authors could include that would prove a direct interaction between shep and a TGE containing RNA. The first experiment, which was suggested in my previous review, would be to take only purified shep and only a TGE containing RNA and see if they interact in vitro using a technique like EMSA. Alternatively, the authors can repeat the pull down assays they have included here in Figure 6B but include a UV crosslinking step (to capture any direct RNA-protein interactions) and then pull down under conditions that disrupt any indirect interactions (ie with detergent and high salt).

Reviewer #2: The authors addressed the majority of my previous concerns, but the authors still do not show evidence that Shep directly binds endogenous Dsxl transcripts. The new in vitro binding results do support their hypothesis.

I found that their responses to several of Reviewer #3’s comments were not adequately addressed:

5. Lines 113-114. In the present study, several lines with mutations in Shep gene were establiShep by CRISPR/Cas9 system. How did the authors rule out the possibility of offtargeting effect. They should provide evidence to prove that the phenotype observed in the Shep mutants were not due to the off-targeting effect.

Response (Lines 438-446): Only one mutant line was generated in the experiment (Fig 3A, 2B, 2C). The gRNAs targeting the two RRMs were carefully designed and their specificity to Shep could avoid off-target effects because the DNA region with up to five base pair mismatches with the gRNA is susceptible to editing by the Cas9/gRNA complex (Fu et al, 2013; Jiang et al, 2013). This was mentioned in the methods in Lines 438-446.

More than one mutant line should be examined to ensure that off target effects are not an issue.

Response: The feeding activity and time of taking the photos were different between the female and male samples hence the difference in the red signal caused by the autofluorescence of the chlorella could be observed.

Compared photos should be taken with the same exposures. Alternatively, the relative exposure times could be indicated.

Additional minor comments:

C) Authors claimed multiple times that Dsxl transcripts are exclusively expressed in males but in fact there are transcripts and translated RFP in females.

D) There is no evidence Shep expression peaks at 30hpo, line 111 and there is a mis-callout of figure 1D, line 110.

E) The Shep mutant has additional 5 amino acids, which lead to a 1% increase of the protein size. In figure 3B, it is way more than 1%.

F) Do any Shep antibodies exist that can be used to validate the manipulation of Shep expression?

G) The authors need better discussion of their decoy model – if the lncRNA is expressed at only 10% of Dsxl transcripts and sufficient to function as a decoy, how would Shep be able to inhibit all remaining Dsxl?

H) If the lncRNA indeed works as a decoy, does its expression fluctuate with Shep and/or Dsxl expression in order to properly decoy?

I) Authors should explain briefly why they chose Shep and CUGBP1 while there are a lot of other factors pulled downed as enriched.

J) In figure 4A, why isn’t the RFP expression symmetrical?

K) What are the RNAs used on line 300? Are they Dsxl-related?

L) Why do the authors use images from different angles/stages for almost all figures?

M) Figure 5 still shows the term “mutated”.

Reviewer #3: I think the revised manuscript is now suitable for publication. I am satisfied with the author's responses and plausible explanations.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Editor's Comments:

Experimental proof of the direct interaction between Shep and Dsx1 RNA should be included in the revised version.

PLoS Genet. 2021 Jul 28;17(7):e1009683. doi: 10.1371/journal.pgen.1009683.r004

Author response to Decision Letter 1

7 Jun 2021

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(28.3KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1009683.r005

Decision Letter 2

John M Greally, Daniela Delneri

21 Jun 2021

Dear Dr Watanabe,

Thank you very much for submitting your Research Article entitled 'Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression.' to PLOS Genetics.

The reviewers appreciated the revised manuscript that show the direct interaction between Shep and a TGE site. Reviewer 2 identified some minor concerns that we ask you address in a revised manuscript.

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Daniela Delneri

Guest Editor

PLOS Genetics

John Greally

Section Editor: Epigenetics

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The addition of a crosslinking step and stringent washing conditions has now convincingly shown a direct interaction between shep and a TGE containing RNA by pulldown. This experiment addresses my last concern.

Reviewer #2: The authors have satisfied the majority of reviewer concerns. Minor comments are indicated below:

E) The authors need to label ladders.

G) The authors need to include something like their response to reviewers in the Discussion.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #2: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

PLoS Genet. 2021 Jul 28;17(7):e1009683. doi: 10.1371/journal.pgen.1009683.r006

Author response to Decision Letter 2

22 Jun 2021

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(15.4KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1009683.r007

Decision Letter 3

John M Greally, Daniela Delneri

25 Jun 2021

Dear Dr Watanabe,

We are pleased to inform you that your manuscript entitled "Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression." has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Daniela Delneri

Guest Editor

PLOS Genetics

John Greally

Section Editor: Epigenetics

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00054R3

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

PLoS Genet. doi: 10.1371/journal.pgen.1009683.r008

Acceptance letter

John M Greally, Daniela Delneri

21 Jul 2021

PGENETICS-D-21-00054R3

Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression.

Dear Dr Watanabe,

We are pleased to inform you that your manuscript entitled "Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression." has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Zsofi Zombor

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Phylogenetic tree of the RRM domains of the Shep orthologs.

(TIF)

Click here for additional data file.^{(589.7KB, tif)}

S2 Fig. Multiple sequence alignment of the evolutionarily conserved RRM domains of Shep.

(TIF)

Click here for additional data file.^{(1.7MB, tif)}

S3 Fig. Similarity of DAPALR overexpression and Shep knockdown phenotype.

(TIF)

Click here for additional data file.^{(1.4MB, tif)}

S4 Fig. Embryonic stage of generated Shep mutant line.

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

S5 Fig. Diverse phenotype of Shep mutants and their genomic mutations.

(TIF)

Click here for additional data file.^{(2MB, tif)}

S6 Fig. The nucleotide sequence of DAPALR and its core element.

(TIF)

Click here for additional data file.^{(1.3MB, tif)}

S1 Table. Full Mass Spectrometry Data.

(XLSX)

Click here for additional data file.^{(37.7KB, xlsx)}

S2 Table. Summary of mutagenesis experiment.

(DOCX)

Click here for additional data file.^{(38.3KB, docx)}

S3 Table. Primer sequences for RT-qPCR.

(DOCX)

Click here for additional data file.^{(16.4KB, docx)}

Attachment

Submitted filename: renamed_43918.docx

Click here for additional data file.^{(55KB, docx)}

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(28.3KB, docx)}

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(15.4KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pgen.1009683.ref001] 1.Wang KC, Chang HY. Molecular Mechanisms of Long Noncoding RNAs. Molecular Cell. 2011. pp. 904–914. doi: 10.1016/j.molcel.2011.08.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref002] 2.Hentze MW, Castello A, Schwarzl T, Preiss T. A brave new world of RNA-binding proteins. Nat Rev Mol Cell Biol. 2018;19: 327–341. doi: 10.1038/nrm.2017.130 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref003] 3.Kuo RI, Tseng E, Eory L, Paton IR, Archibald AL, Burt DW. Normalized long read RNA sequencing in chicken reveals transcriptome complexity similar to human. BMC Genomics. 2017;18: 1–19. doi: 10.1186/s12864-016-3406-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref004] 4.Kato Y, Perez CAG, Mohamad Ishak NS, Nong QD, Sudo Y, Matsuura T, et al. A 5′ UTR-Overlapping LncRNA Activates the Male-Determining Gene doublesex1 in the Crustacean Daphnia magna. Curr Biol. 2018;28: 1811–1817. doi: 10.1016/j.cub.2018.04.029 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref005] 5.Kato Y, Kobayashi K, Watanabe H, Iguchi T. Environmental sex determination in the branchiopod crustacean Daphnia magna: Deep conservation of a Doublesex gene in the sex-determining pathway. PLoS Genet. 2011;7: e1001345. doi: 10.1371/journal.pgen.1001345 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref006] 6.Adachi S, Homoto M, Tanaka R, Hioki Y, Murakami H, Suga H, et al. ZFP36L1 and ZFP36L2 control LDLR mRNA stability via the ERK-RSK pathway. Nucleic Acids Res. 2014;42: 10037–10049. doi: 10.1093/nar/gku652 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref007] 7.Natsume T, Yamauchi Y, Nakayama H, Shinkawa T, Yanagida M, Takahashi N, et al. A direct nanoflow liquid chromatography—Tandem mass spectrometry system for interaction proteomics. Anal Chem. 2002;74: 4725–4733. doi: 10.1021/ac020018n [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref008] 8.Chen D, Brovkina M, Matzat LH, Lei EP. Shep RNA-binding capacity is required for antagonism of gypsy chromatin insulator activity. G3 Genes, Genomes, Genet. 2019;9: 749–754. doi: 10.1534/g3.118.200923 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref009] 9.Mapes J, Chen J-T, Yu J-S, Xue D. Somatic sex determination in Caenorhabditis elegans is modulated by SUP-26 repression of tra-2 translation. Proc Natl Acad Sci. 2010;107: 18022–18027. doi: 10.1073/pnas.1004513107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref010] 10.Nong QD, Mohamad Ishak NS, Matsuura T, Kato Y, Watanabe H. Mapping the expression of the sex determining factor Doublesex1 in Daphnia magna using a knock-in reporter. Sci Rep. 2017;7: 13521. doi: 10.1038/s41598-017-13730-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref011] 11.Kærn M, Elston TC, Blake WJ, Collins JJ. Stochasticity in gene expression: From theories to phenotypes. Nat Rev Genet. 2005;6: 451–464. doi: 10.1038/nrg1615 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref012] 12.Ozbudak EM, Thattai M, Kurtser I, Grossman AD, Van Oudenaarden A. Regulation of noise in the expression of a single gene. Nat Genet. 2002;31: 69–73. doi: 10.1038/ng869 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref013] 13.Nong QD, Matsuura T, Kato Y, Watanabe H. Two Doublesex1 mutants revealed a tunable gene network underlying intersexuality in Daphnia magna. PLoS One. 2020;15: 1–19. doi: 10.1371/journal.pone.0238256 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref014] 14.Kuwabara PE, Okkema PG, Kimble J. tra-2 encodes a membrane protein and may mediate cell communication in the Caenorhabditis elegans sex determination pathway. Mol Biol Cell. 1992;3: 461–473. doi: 10.1091/mbc.3.4.461 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref015] 15.Chen D, Qu C, Hewes RS. Neuronal remodeling during metamorphosis is regulated by the alan shepard (shep) gene in Drosophila melanogaster. Genetics. 2014. doi: 10.1534/genetics.114.166181 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref016] 16.Olesnicky EC, Antonacci S, Popitsch N, Lybecker MC, Titus MB, Valadez R, et al. Shep interacts with posttranscriptional regulators to control dendrite morphogenesis in sensory neurons. Dev Biol. 2018;444: 116–128. doi: 10.1016/j.ydbio.2018.09.022 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref017] 17.Chen D, Dale RK, Lei EP. Shep regulates Drosophila neuronal remodeling by controlling transcription of its chromatin targets. Dev. 2018;145: dev154047. doi: 10.1242/dev.154047 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref018] 18.Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011;147: 358–369. doi: 10.1016/j.cell.2011.09.028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref019] 19.Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: The rosetta stone of a hidden RNA language? Cell. 2011;146: 353–358. doi: 10.1016/j.cell.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref020] 20.Klüttgen B, Dülmer U, Engels M, Ratte HT. ADaM, an artificial freshwater for the culture of zooplankton. Water Res. 1994;28: 743–746. doi: 10.1016/0043-1354(94)90157-0 [DOI] [Google Scholar]

[pgen.1009683.ref021] 21.Tatarazako N, Oda S, Watanabe H, Morita M, Iguchi T. Juvenile hormone agonists affect the occurrence of male Daphnia. Chemosphere. 2003;53: 827–833. doi: 10.1016/S0045-6535(03)00761-6 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref022] 22.Elendt BP, Bias WR. Trace nutrient deficiency in Daphnia magna cultured in standard medium for toxicity testing. Effects of the optimization of culture conditions on life history parameters of D. magna. Water Res. 1990;24: 1157–1167. doi: 10.1016/0043-1354(90)90180-E [DOI] [Google Scholar]

[pgen.1009683.ref023] 23.Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013;31: 233–239. doi: 10.1038/nbt.2508 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref024] 24.Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013;31: 822–826. doi: 10.1038/nbt.2623 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref025] 25.Gagnon JA, Valen E, Thyme SB, Huang P, Ahkmetova L, Pauli A, et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014;9: e106396. doi: 10.1371/journal.pone.0098186 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref026] 26.Asada M, Kato Y, Matsuura T, Watanabe H. Early embryonic expression of a putative ecdysteroid-phosphate phosphatase in the water flea, daphnia magna (Cladocera: Daphniidae). J Insect Sci. 2014;14: 1–6. doi: 10.1093/jis/14.1.1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref027] 27.Törner K, Nakanishi T, Matsuura T, Kato Y, Watanabe H. Optimization of mRNA design for protein expression in the crustacean Daphnia magna. Mol Genet Genomics. 2014;289: 707–715. doi: 10.1007/s00438-014-0830-8 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref028] 28.Mohamad Ishak NS, Kato Y, Matsuura T, Watanabe H. Sequence conservation and sexually dimorphic expression of the Ftz-F1 gene in the crustacean Daphnia magna. PLoS One. 2016;11: e0154636. doi: 10.1371/journal.pone.0154636 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref029] 29.Sumiya E, Ogino Y, Toyota K, Miyakawa H, Miyagawa S, Iguchi T. Neverland regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea Daphnia magna, and may thus act as a target for chemical disruption of molting. J Appl Toxicol. 2016;36: 1476–1485. doi: 10.1002/jat.3306 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref030] 30.Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3: research0034.1. doi: 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1009683.ref031] 31.Asada M, Kato Y, Matsuura T, Watanabe H. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia. Mar Environ Res. 2014;93: 118–122. doi: 10.1016/j.marenvres.2013.11.005 [DOI] [PubMed] [Google Scholar]

[pgen.1009683.ref032] 32.Huppertz I, Attig J, D’Ambrogio A, Easton LE, Sibley CR, Sugimoto Y, et al. iCLIP: Protein-RNA interactions at nucleotide resolution. Methods. 2014;65: 274–287. doi: 10.1016/j.ymeth.2013.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Sense-overlapping lncRNA as a decoy of translational repressor protein for dimorphic gene expression

Christelle Alexa Garcia Perez

Shungo Adachi

Quang Dang Nong

Nikko Adhitama

Tomoaki Matsuura

Toru Natsume

Tadashi Wada

Yasuhiko Kato

Hajime Watanabe

Roles

Abstract

Author summary

Introduction

Results

Identification of Shep as a sense lncRNA binding protein

Fig 1. Identification of Alan Shepard (Shep) as an RNA binding protein of DAPALR.

Knockdown of Shep mRNA enhances the Dsx1 expression

Fig 2. Shep loss of function analysis.

Shep mutant enhances the Dsx1 expression

Fig 3. Generated Shep mutant line.

Shep overexpression suppresses Dsx1 expression

Fig 4. Overexpression of Shep.

TGE element is responsible for the post-transcriptional regulation or DAPALR function

Fig 5. Dsx1 post-transcription regulation by DAPALR and Shep in vivo.

Shep binding site (TGE) is a target sequence of translational regulation

Shep binds the TGE for translational repression of Dsx1

Fig 6. Dsx1 post-transcription regulation by DAPALR and Shep in vitro.

DAPALR regulates translation efficiency

Discussion

Materials and methods

Daphnia magna strains and transgenic lines culture

Preparation of bait RNAs and RNA pulldown assay

Microinjection

CRISPR/Cas-mediated mutagenesis

RNAi

Quantitation of the fluorescence

Quantitative RT-PCR

Ectopic expression of intact and deleted Shep binding site

RNA synthesis

Luciferase-based in vitro translation assay

UV crosslinking and FLAG pulldown assay

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

John M Greally

Daniela Delneri

Roles

Author response to Decision Letter 0

Decision Letter 1

John M Greally

Daniela Delneri

Roles

Author response to Decision Letter 1

Decision Letter 2

John M Greally

Daniela Delneri

Roles

Author response to Decision Letter 2

Decision Letter 3

John M Greally

Daniela Delneri

Roles

Acceptance letter

John M Greally

Daniela Delneri

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases