Complete Circular Genome Sequence of a mecB- and mecD-Containing Strain of Macrococcus canis

ABSTRACT

The complete genome sequence of Macrococcus canis strain 19/EPI0118, isolated from a veterinary clinic environment in Switzerland, was determined using hybrid assembly of Oxford Nanopore and Illumina reads. 19/EPI0118 harbored the methicillin resistance genes mecB and mecD on a staphylococcal cassette chromosome mec element and a Macrococcus chromosomal resistance island, respectively.

ANNOUNCEMENT

Macrococcus canis is a Gram-positive bacterium which has been found on the skin of healthy dogs and in infection sites (1, 2). Some M. canis strains carry the methicillin resistance gene mecB on staphylococcal cassette chromosome mec (SCCmec) elements or on a plasmid (3, 4). The mecD gene has so far only been associated with chromosomal resistance islands McRI_mecD in Macrococcus caseolyticus and an SCCmec element in Macrococcus bohemicus (5–7). Recently, a methicillin-resistant M. canis strain (19/EPI0118) isolated from the environment of a companion animal clinic in Switzerland was found to contain both the mecB and mecD genes (8). The strain was also resistant to fusidic acid (8). We report here the complete genome sequence of 19/EPI0118 and the genetic elements containing mecB, mecD, and fusC.

Genomic DNA of 19/EPI0118 (cryopreserved in our collection) was extracted from culture grown overnight at 37°C on Trypticase soy agar containing 5% sheep blood, using the MasterPure complete DNA and RNA purification kit (Lucigen, Middleton, WI). DNA sequencing was performed using a NEBNext Ultra II directional DNA library with TruSeq adapters on an Illumina NovaSeq 6000 system (2 × 150-bp paired-end reads) at Eurofins Genomics (Germany) and in-house with a MinION system (Oxford Nanopore Technologies [ONT]; R9.4.1 SpotON flow cell, MinION MK1b device). The ONT library was prepared using the 1D ligation sequencing kit (SQK-LSK109) and the native barcoding expansion kit (EXP-NBD104) (Oxford Nanopore Technologies, UK). The ONT reads were base called and demultiplexed using Guppy software v4.4.1 and end trimmed and size filtered using Cutadapt v2.5. The Illumina reads were used without filtering after confirmation of high-quality and adaptor-free sequences by FastQC v0.11.7 analysis. The genome sequence of 19/EPI0118 was de novo assembled and circularized using Unicycler v0.4.8 run with default parameters, using paired-end Illumina reads (8,580,460 reads, 1,287,069,000 total bases, 543× coverage) and ONT reads larger than 10 kb (22,513 reads; mean, 20,422 bp; 460,021,332 total bases; 194× coverage) (9). All calculations were performed on the high-performance computing (HPC) cluster UBELIX at the University of Bern (http://www.id.unibe.ch/hpc). The genome was annotated using the NCBI Prokaryotic Genome Annotation Pipeline service (10).

The complete genome of 19/EPI0118 contained a circular chromosome of 2,359,135 bp and four small circular plasmids (3,561, 2,426, 1,888, and 1,436 bp) with a GC content of 36.5%. A total of 2,362 protein-coding sequences and 78 RNAs, including 58 tRNAs and 5 16S-23S rRNA clusters, were predicted. The mecB gene was found on a pseudo (Ψ) SCCmec (ΨSCCmecB_19/EPI0118) integrated at the 3′ end of the chromosomal rlmH gene, followed by a ΨSCC (Fig. 1A). Cassette chromosome recombinase (ccr) genes were not present, and the mecB operon lacked the β-lactamase blaZ_m gene. The fusidic acid resistance gene fusC was found at the 3′ end of ΨSCCmecB_19/EPI0118 (Fig. 1A). The mecD gene was part of an McRI_mecD-1 integrated at the 3′ end of the rpsI gene (Fig. 1B). This element was, except for three mismatches, identical to the McRI_mecD-1 of M. caseolyticus IMD0819 (5).

FIG 1.

The genetic structure of ΨSCCmecB_19/EPI0118 and McRI_mecD-1 elements in M. canis 19/EPI0118. (A) (Ψ)SCCmecB elements in M. canis. Chromosomal regions from the 23S rRNA (pseudouridine[1915]-N[3])-methyltransferase gene (rlmH) to the UvrABC system protein A gene (uvrA) were compared for M. canis strains KM45013^T (GenBank accession number CP021059), 19/EPI0118 (CP072837), and Epi0076A (CP047363). The rlmH gene (gray) contains at the 3′ end the integration site sequence (ISS) for SCC. Further copies of ISS that subdivide composite (Ψ)SCCmec elements are indicated. The ISS have the following sequences for 19/EPI0118: ISS1, 5′-GAAAGTTATCATAAATGA; ISS2, 5′-GAAAGTTATCATAAGTGA; ISS3, 5′-TGGGTATATCAAAAATAA; they flank the ΨSCCmecB_19/EPI0118 (CP072837, positions 32,310 to 45,199) and ΨSCC (CP072837, positions 45,200 to 69,684). (B) Comparison of McRI_mecD-1 of M. canis 19/EPI0118 (CP072837, positions 259,551 to 277,684) with McRI_mecD-1 of M. caseolyticus IMD0819 (CP021058). The chromosomal region downstream of the tRNA pseudouridine(38-40) synthase gene (truA) was compared. The attachment site (att) for McRI_mecD at the 3′ end of the 30S ribosomal protein S9 gene (rpsI) (gray) and copies of it that delimitate chromosomal islands are indicated. The core att sequence is 5′-GAACGTAA(A/G)AA(A/G)CCAGGTCTTAAAGGCGCTCGTCGTTCACCACAGTTCTCAAAACGTTAAT (positions containing an A or G base are given in parenthesis). Genes are represented by arrows and are color-coded as follows: red, mec operon genes and fusidic acid resistance gene; green, ccr genes; light green, integrase (int) and associated genes of McRI_mecD; yellow, other recombinase genes; blue, putative hemolysin genes (hlgBC). Figures were generated using Easyfig software (11). Gray connections indicate regions with between 72% and 100% nucleotide sequence identity.

These findings showed that a Macrococcus strain can carry two methicillin resistance genes in its chromosome and suggests exchange of McRI_mecD between M. canis and M. caseolyticus.

Data availability.

The complete genome sequence of M. canis strain 19/EPI0118 has been deposited in GenBank under accession numbers CP072837, CP072838, CP072839, CP072840, and CP072841. The associated BioProject and BioSample accession numbers are PRJNA720016 and SAMN18630837, respectively. The raw reads were deposited in the SRA database with accession numbers SRR14161194 (Illumina) and SRR14161193 (ONT).