Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2021 Aug 3;2021:9229485. doi: 10.1155/2021/9229485

Prevalence and Antimicrobial Resistance of Campylobacter Species in Diarrheal Patients in Mymensingh, Bangladesh

Md Ashikur Rahman 1, Priyanka Rani Paul 1, Nazmul Hoque 1, Sk Shaheenur Islam 1, A K M Ziaul Haque 1, Mahmudul Hasan Sikder 2, Aminul Matin 3, Shinji Yamasaki 4, S M Lutful Kabir 1,✉
PMCID: PMC8357465  PMID: 34395627

Abstract

Campylobacter enteritis is the leading cause of gastroenteritis in humans worldwide including Bangladesh. The objectives of this study were to estimate the prevalence and antimicrobial-resistance status of Campylobacter spp. in human diarrheal samples collected from Surya Kanta Hospital, Mymensingh, Bangladesh. In this study, we evaluated a total of 330 clinical samples for the presence Campylobacter spp. via cultural and biochemical tests and molecular assays. Furthermore, antimicrobial susceptibility testing for Campylobacter species was accomplished by the standard agar disc diffusion technique against eight commercially available antimicrobial agents. A pretested semistructured questionnaire was used to capture the data on socioanthropological factors from the diarrheal patients. Pearson's chi-square test was performed, and a p value of <0.05 was considered for the level of significance. Nearly one in three diarrheal patients admitted in this hospital were infected with Campylobacter spp. Overall prevalence of Campylobacter spp. was estimated to be 31.5% (104/330) that comprised the prevalence of C. jejuni, 21.8% (n = 72), and C. coli, 9.6% (n = 32). Among the positive cases, the prevalence of Campylobacter was higher in the age group 0-5 years (52%) followed by 6-18 years (42.7%), 19-40 years (34.0%), 41-60 years (25.4%), and >60 years (10.5%). Age, family level's personal hygiene, and involvement with animal husbandry were captured as potential determinants to be associated with the Campylobacter positive status. Among the isolates, 27.3% (n = 20) of C. jejuni and 31.2% (n = 10) of C. coli demonstrated as multidrug-resistant (MDR) to three or more antimicrobial agents. The present study shows that Campylobacter spp. is most prevalent among the hospital-admitted diarrheal patients, and proper measures should be taken to reduce the burden focusing on the potential determinants.

1. Introduction

Campylobacter spp. are considered to be zoonotic pathogens that cause foodborne infection throughout the world [1, 2]. These pathogens are the leading causative agents of sporadic bacterial diarrhea worldwide [3, 4]. It was estimated that more than 16 million people got sick with nearly 37 thousand deaths in 2010 worldwide that were connected with Campylobacter spp. as a single infection [3]. Campylobacters are the most frequently isolated bacterial enteric pathogens both in developed and low- and middle-income countries (LMICs) [5]. In developed countries, Campylobacter jejuni and Campylobacter coli are the predominately isolated species associated with human bacterial diarrheal disease [6, 7]. Primarily, most of the zoonotic Campylobacters are well adapted as a commensal in the gastrointestinal tract of poultry, cattle, sheep, and pigs [8] and can act as reservoirs [9]. Humans can be infected with Campylobacter via consumption of contaminated meat and poultry including dairy products [10, 11]. Additionally, Campylobacter can contaminate the soil or water bodies to facilitate human infection or even direct human-to-human transmission [12].

Campylobacter infections exhibit variable clinical signs from sudden diarrhea to vomition, and abdominal cramps with onset of fever could continue at least for a week [13]. Campylobacter jejuni could cause severe chronic symptoms called Guillain–Barré syndrome (GBS) following the infection as a consequence of autoimmune disease [14].

C. jejuni is an important etiological agent of childhood diarrhea (25.5%) in Bangladesh [15]. However, the Guillain–Barré syndrome (GBS) which is connected to Campylobacter infection causes acute flaccid paralysis (AFP) established in Bangladesh with an estimated incidence rate of 3.25 cases/100,000 children under 15 years of age [16, 17]. Many efforts have been made to minimize Campylobacter infection and its associated GBS risks without considering the source of introduction in the LMICs. Therefore, a significant burden of Campylobacter prevails in such counties [18], even in Bangladesh.

Earlier studies in Bangladesh reported a variable level of prevalence rate during the 1990s ranging from 17 to 26% with C. jejuni [19, 20] and 9.45% with C. jejuni and 2.68% with C. coli spanning from 2005 to 2008 [21]. A few separate studies confirmed 8.5% prevalence for Campylobacter jejuni and Campylobacter coli in fecal specimens [22] and 15.3% and 11.3% prevalence of Campylobacter jejuni and Campylobacter coli, respectively [23]. However, a most recent study confirmed the prevalence of C. jejuni/coli as 28.3% in 2019 [24]. Nowadays, the widespread use of antimicrobial agents both in human and veterinary practices is a global concern [25]. This practice appears to be increased quickly in LMICs where rampant use of antibiotics is more common [26]. As a result, the resistance of Campylobacter species to antimicrobials has been documented throughout the world [27]. The emergence of antimicrobial-resistant Campylobacter species due to the overuse of antimicrobial agents in food animal production enables the spreading of antimicrobial-resistant bacteria [28]. This phenomenon highlights a serious impact on both veterinary and human health regarding food safety and public health issues.

In Bangladesh, several studies have been conducted with very few explored socioanthropological determinants of the occurrence of Campylobacter spp. along with antimicrobial-resistant pattern of the isolates from human diarrheal patients. Therefore, the present study was designed to estimate the prevalence and antimicrobial resistance profile along with socioanthropological determinants of Campylobacter spp. infection in diarrheal patients from the Surya Kanta Hospital of Mymensingh district in Bangladesh.

2. Materials and Methods

2.1. Sample Collection and Shipment

Three hundred thirty (N = 330) stool specimens were collected randomly from patients suffering from different magnitudes of acute gastroenteritis symptoms including diarrhea admitted to the Surya Kanta Hospital, Mymensingh Medical College, Mymensingh, during the period from June 2019 to June 2020. A team composed of a physician and a lab technician were engaged in sampling and subsequent data collection. Aseptic measures were taken during the collection of samples. A single rectal swab sample was obtained from each patient, stored, and transported in Cary-Blair transport media. A unique identification number was given for each sample and transferred to the laboratory of the Department of Microbiology and Hygiene, Bangladesh Agricultural University (BAU), Mymensingh, maintaining with a cool chain (4–6°C).

2.2. Questionnaire Survey

A semistructured interview questionnaire was developed and used for data collection from diarrheal patients on socioanthropological factors: age, sex, educational status, family level personal hygiene, and animal (ruminant, pets, and poultry) husbandry status including food habits. The questionnaire was translated into the local Bengali dialect for the face-to-face interview so that the respondent could easily understand its content.

2.3. Isolation and Identification

Isolation and identification of Campylobacter spp. were accomplished through the filtration method [29]. In brief, each of the stool specimens was suspended in 500 μl of sterile saline. A portion of 100 μl of sample was spread onto the surface filters of blood agar base no. 2 including Skirrow supplements and permitted to stand for 30 min at room temperature. After 30 min, the filter was removed from the Skirrow blood agar and then the plates were incubated at 37°C for 48 h in microaerophilic condition (5% O2, 10% CO2, and 85% N2). The incubated media were inspected for bacteria growth after 48 h. In Skirrow blood agar media, grey, flat, and irregularly spreading colonies were observed. The colonies were evaluated via Gram's staining, and Gram-negative curves were observed under the light microscope. Gram's stain positive colonies were further utilized in biochemical tests, namely, catalase, hippurate hydrolysis, and oxidase tests. The selected colonies that were found to be positive in Gram's staining and biochemical tests were further subcultured through the same procedure to get a pure colony. Thus, pure isolates obtained were used for further evaluations. Discrimination of Campylobacter isolates was completed based on growth characteristics as well as biochemical tests as per the standard protocols [30–32].

2.4. Molecular Identification by PCR

Gram's staining and biochemical test positive isolates of the Campylobacter growth colony were validated by PCR assay as Campylobacter spp. The DNA materials were extracted from the pure colonies as per the procedure by Hoshino et al. [33]. Employing oligonucleotide primers, the genus of Campylobacter was confirmed through the amplification of the targeted 16S rRNA gene, as per the method labeled by Samosornsuk et al. [34] (Table 1).

Table 1.

Primers and conditions used for different PCR assays.

Primers Sequence (5′-3′) Target/purpose Amplicon size (bp) PCR condition (30 cycle) Reference
Denaturation Annealing Extension
16S9F
16S1540R
GAGTTTGATCCTGGCTC
AAGGAGGTGATCCAGCC
16S rRNA 1530 94°C, 30 s 47°C, 30 s 72°C, 90 s [34]
Cj-CdtAU2
Cj-CdtAR2
AGGACTTGAACCTACTTTTC
AGGTGGAGTAGTTAAAAACC
CjcdtA 631 94°C, 30 s 53°C, 30 s 72°C, 30 s [35]
Cc-CdtAU1
Cc-CdtAR1
ATTGCCAAGGCTAAAATCTC
GATAAAGTCTCCAAAACTGC
CccdtA 329
Cf-CdtCU2
Cf-CdtCR2
AACGACAAATGTAAGCACTC
TATTTATGCAAGTCGTGCGA
CfcdtA 489
HIP400F
HIP1134R
GAAGAGGGTTTGGGTGGTG
AGCTAGCTTCGCATAATAACTTG
hipO gene 735 94°C, 30 s 55°C, 30 s 72°C, 45 s [36]

After confirmation of Campylobacter spp. via 16S rRNA gene-based PCR assay, a cdtA gene-based multiplex PCR was done for the detection of different species of Campylobacter (i.e., C. jejuni, C. coli, and C. fetus) as per the protocol described by Linton et al. [36]. In these multiplex PCR assays, C. jejuni ATCC 33560, C. coli ATCC 33559, and C. fetus ATCC 27374 strains in DNA templates were utilized as a positive control. However, Escherichia coli ATCC 25922 was utilized as a negative control. In the multiplex PCR assay, for those isolates confirmed as C. jejuni, their identity was further substantiated by a marker-based (hipO gene) PCR assay [36]. The sequences of the primers and parallel amplicon sizes including annealing temperatures of PCR are shown in Table 1. The PCR products were pictured in gel electrophoresis (1.5% agarose, Invitrogen, Carlsbad, CA, USA), and after coloring with ethidium bromide (0.5 μg ml−1) and decoloring with distilled water for 10 min, gel pictures were captured via a UV transilluminator (Biometra, Göttingen, Germany).

2.5. Antimicrobial Sensitivity Testing

Isolates of Campylobacter spp. were tested via the disk diffusion method [37] using eight (8) commercially available antimicrobials in Bangladesh, viz., amoxicillin (30 μg), ciprofloxacin (5 μg), azithromycin (30 μg), erythromycin (30 μg), tetracycline (30 μg), streptomycin (10 μg), gentamicin (10 μg), and ceftriaxone (30 μg) (HiMedia, Mumbai, India). The zones of inhibition growth were evaluated as the diameter zone as per parameters specified by the Clinical and Laboratory Standard Institute (CLSI) [38], thus established as resistant (R), intermediate resistant (I) or susceptible (S) against the antimicrobial agents. In this testing, the E. coli ATCC 25922 strain was used as a quality control organism. All evaluations were validated by conducting at least two replications of the disk diffusion test. Multidrug resistance (MDR) was decided as the resistance to a minimum of three different classes of antimicrobial agents [39].

2.6. Data Management and Statistical Analysis

Data on socioanthropological factors and laboratory assessment were captured in Microsoft Excel 2010 (MS Excel) sheets, and data were cleaned and checked for consistency for analysis. The data were analyzed by the Epi Info 7 program [40] both for descriptive and inferential interpretations. Pearson's chi-square test was done to find out the association between determinates and Campylobacter infection status with a p value of <0.05 taken as statistical significance for all analyses.

2.7. Ethics Approval and Consent to Participate

The Ethical Committee of the Bangladesh Agricultural University (BAU) approved this study as a part of the larger project (AWEEC/BAU/2019 (45)). However, a separate permission was obtained from the Director of Mymensingh Medical College Hospital, Mymensingh, Bangladesh (No: 2313 on 8 April 2019) for human screening. Additionally, an oral consent was obtained from each participant as a substantial number of patients included under this study could not read and write.

3. Results

3.1. Prevalence of Campylobacter spp.

Of 330 samples, 104 were confirmed as Campylobacter spp. via culture, biochemical tests, and, finally, molecular assay (16S rRNA). All positive Campylobacter isolates (104) exhibited a particular amplicon size of 1530 bp through a 16S rRNA gene-specific polymerase chain reaction (PCR) (Supplementary Figure S1-a). Subsequently, a cdtA gene-based multiplex PCR was accomplished for the detection of different genus of Campylobacter, viz., C. jejuni, C. coli, and C. fetus. In this PCR assay, C. jejuni and C. coli produced an amplicon size of 631 bp and 329 bp, respectively, as a verifying test for species confirmation (Supplementary Figure S1-b). However, the isolates of C. jejuni were further confirmed via a robust marker hipO gene-based PCR assay that presented a 735 bp amplicon size (Supplementary Figure S1-c). Thus, the overall prevalence of Campylobacter was confirmed as 31.5% (104/330) that represented 21.8% (72/330) and 9.7% (32/330) prevalence for C. jejuni and C. coli, respectively (Table 2). In this study, amongst 104 isolates, 69.2% and 30.8% were confirmed as C. jejuni and C. coli, respectively.

Table 2.

Distribution of Campylobacter isolates in human diarrheal samples (N = 330) at Surya Kanta Hospital, Mymensingh, from June 2019 to June 2020.

Parameter/variable Positive sample (n)/number of sample tested (N) Prevalence (%) with 95% CI
Campylobacter spp. 104/330 31.5 (26.5-36.8)
Campylobacter jejuni (n = 72) 72/330 21.8 (17.5-26.7)
Campylobacter coli (n = 32) 32/330 9.7 (6.7-13.4)

N: total sample tested; n: number of positive isolates; CI: confidence interval.

3.2. Distribution of Prevalence among Different Determinants

A higher prevalence was observed in female (35.2%) patients than in male (29.3%) patients. However, there is no statistical significance among the sexes. Considering the age group, the higher prevalence (52%) was observed in the age group 0-5 years, followed by 6-18 years (42.7%), 19-40 years (34.0%), 41-60 years (25.4%), and >60 years (10.5%) (Figure 1 and Table 3).

Figure 1.

Figure 1

Distribution of prevalence with 95% confidence interval (CI) at different age groups in Surya Kanta Hospital, Mymensingh, from June 2019 to June 2020. The prevalence among the different age groups was found to be statistically significant from each other (∗p ≤ 0.001).

Table 3.

Distribution of Campylobacter spp. among different determinants of diarrheal patients (N = 330) at Surya Kanta Hospital, Mymensingh, from June 2019 to June 2020.

Determinants (n) Positive Prevalence (%) with 95% CI Pearson's chi-square p value
Sex
 Male (n = 208) 61 29.3 (23.2-26.0) 0.26
 Female (n = 122) 43 35.3 (26.8-44.4)
Age (years)
 0-5 (n = 25) 13 52.0 (31.3-72.2) ≤0.001
 6-18 (n = 75) 32 42.7 (31.3-54.7)
 19-40 (n = 106) 36 34.0 (25.0-43.8)
 41-60 (n = 67) 17 25.4 (15.5-37.5)
 >60 (n = 57) 6 10.5 (4.0-21.5)
Education status
 Illiterate/not applicable 56 37.7 (26.6-41.5) 0.38
 Literate 48 29.3 (22.4-36.9)
Family-level personal hygiene
 Good (n = 228) 49 21.5 (16.3-27.4) ≤0.001
 Bad (n = 102) 55 53.9 (43.8-63.8)
Involvement with household livestock rearing
 Yes (n = 132) 57 43.2 (34.6-52.1) 0.001
 No (n = 198) 47 23.7 (18.0-30.3)
Food habit
 Home prepared (n = 227) 77 33.9 (27.8-40.5) 0.16
 Other (fast food/food from restaurant) (n = 103) 27 26.2 (18.0-35.8)

CI: confidence interval.

A lower level of Campylobacter prevalence (21.5%) was documented in good hygienic practice patients and found to be statistically significant. Similarly, involvement of livestock (cattle, sheep, goat, and poultry) rearing was found to be risky practices as higher prevalence (43.2%) was recognized. Similarly, regarding food habits, Campylobacter was found to be more prevalent in those patients who ate home-prepared food than the patients who ate other sources of food. However, no statistical significance was found (Table 2).

3.3. Antibiogram

3.3.1. Antimicrobial Susceptibility Testing

In this study, of 72 isolates of C. jejuni, 54.2% (n = 39) were found to be susceptible to azithromycin, followed by streptomycin (51.4%, n = 37), gentamycin and/or ceftriaxone (47.2%, n = 34), ciprofloxacin (44.4%, n = 32), tetracycline (40.3%, n = 29), erythromycin (33.4%, n = 24), and amoxicillin (20.8%, n = 15). However, 34.7% (n = 25) isolates exhibited intermediate susceptibility to gentamycin and/or streptomycin and 30.6% (n = 22) isolates to azithromycin and/or ceftriaxone. On the contrary, 32 isolates of C. coli 62.5% (n = 20) were found susceptible to ceftriaxone and/or ciprofloxacin and streptomycin followed by gentamycin (37.5%, n = 12), azithromycin (28.1%, n = 9), tetracycline (21.9%, n = 7), and amoxicillin (18.8%, n = 6). Conversely, 40.6% (n = 13) isolates were shown intermediately susceptible to azithromycin followed by streptomycin (28.1%, n = 9) and tetracycline (18.8%, n = 6) (Table 4).

Table 4.

Antimicrobial susceptibility pattern of Campylobacter jejuni (n = 72) and Campylobacter coli (n = 32) identified by the disk diffusion method at Surya Kanta Hospital, Mymensingh, from June 2019 to June 2020.

Antimicrobial agents Susceptible (%, n) rate of isolates by species Intermediate (%, n) rate of isolates by species Resistant (%, n) rate of isolates by species
C. jejuni C. coli C. jejuni C. coli C. jejuni C. coli
Amoxicillin (AMX) 20.8 (15) 18.8 (6) 25 (18) 12.5 (4) 54.2 (39) 68.7 (22)
Tetracycline (TET) 40.3 (29) 21.9 (7) 16.7 (12) 18.8 (6) 43 (31) 59.3 (19)
Gentamicin (GEN) 47.2 (34) 37.5 (12) 34.7 (25) 12.5 (4) 18.1 (13) 50 (16)
Streptomycin (ST) 51.4 (37) 62.5 (20) 34.7 (25) 28.1 (9) 13.9 (10) 9.4 (3)
Erythromycin (ERY) 33.4 (24) 15.6 (5) 20.8 (15) 21.9 (7) 45.8 (33) 62.5 (20)
Azithromycin (AZM) 54.2 (39) 28.1 (9) 30.6 (22) 40.6 (13) 15.2 (11) 31.3 (10)
Ciprofloxacin (CIP) 44.4 (32) 62.5 (20) 22.3 (16) 6.3 (2) 33.3 (24) 31.2 (10)
Ceftriaxone (CRO) 47.2 (34) 62.5 (20) 30.6 (22) 6.3 (2) 22.2 (16) 31.2 (10)

n: number of isolates; %: percentage.

3.3.2. Antimicrobial-Resistant Status

Among the 72 isolates of C. jejuni, 72.3% (n = 52) were presented as resistant against 1-2 antimicrobial agents that comprised 33.4% (n = 24) isolates to single antimicrobial agents (AMX, ERY) and 38.9% (n = 28) to two antimicrobial agents (AMX-TET and AMX-STR). Similarly, of 32 isolates of C. coli, 68.7% (n = 22) were presented as resistant against 1-2 antimicrobial agents that comprised 50.0% (n = 16) isolates to single antimicrobial agents (AMX, ERY) and 18.7% (n = 6) to two antimicrobial agents (AMX-TET and AMX-STR).

In this study, among the isolates of C. jejuni (N = 72), 10 (13.9%), 2 (2.8%), and 4 (5.6%) were found to be multidrug-resistant against three antimicrobial agents, namely, AMX-STR-TET, ERY-STR-CIP, and AMX-TET-CRO, respectively. However, 4 (5.56%) isolates were documented to be resistant against 4 antimicrobial agents (AMX-TET-CRO-GEN) (Figure 2(a)).

Figure 2.

Figure 2

Multidrug-resistant (MDR) status of (a) C. jejuni isolates (n = 72) presented resistant to 3 agents (AMX-STR-TET) (n = 10, 13.9%), 3 agents (ERY-STR-CIP) (n = 2, 2.8%), 3 agents (AMX-TET-CRO) (n = 4, 5.6%), and 4 agents (AMX-TET-CRO-GEN) (n = 4, 5.6%); (b) C. coli isolates (n = 32) presented resistant to 3 agents (AMX-STR-TET) (n = 2, 6.2%), 3 agents (ERY-STR-CIP) (n = 4, 12.4%), 3 agent (AMX-TET-CRO) (n = 2, 6.2%), and 4 agents (AMX-TET-CRO-GEN) (n = 2, 6.2%) at Surya Kanta Hospital, Mymensingh, from June 2019 to June 2020.

Correspondingly, among the isolates of C. coli (N = 32), 2 (6.2%), 4 (12.4%), and 2 (6.2%) were found to be multidrug-resistant against three antimicrobial agents, viz., AMX-STR-TET, ERY-STR-CIP, and AMX-TET-ERY, respectively. Nevertheless, 2 (6.3%) isolates were shown resistant against 4 antimicrobial agents (AMX-TET-CRO-GEN) in this study (Figure 2(b)).

4. Discussion

We evaluated the prevalence, risk factors, and antimicrobial resistant status of Campylobacter spp. in diarrheal specimens collected from the patients admitted in Surya Kanta Hospital, Mymensingh, Bangladesh. The study confirmed that nearly one-third of the patients (31.5%) was found to be positive with Campylobacter spp., of which Campylobacter jejuni (21.8%) was captured as the key contributor of human bacterial diarrhea. The finding of this study is in accordance to similar studies conducted in Bangladesh [15, 19–23].

In this study, the prevalence of Campylobacter spp. was found higher in females than the males but not statistically significant. In Bangladesh, females are more likely to be at an increased risk of Campylobacter exposure as they are involved with household livestock rearing (cattle, sheep, goat, and poultry) than males. This finding conforms to the result of an earlier study conducted in Bangladesh [23]. However, improved personal hygiene practices would contribute towards the lower prevalence in males.

The distribution of prevalence of Campylobacter spp. was found to be significantly varied among the different age groups (p ≤ 0.001). In this study, the higher prevalence was observed in the youngest age group (0-5 years). Earlier studies also reported variable prevalence of Campylobacter as 25.5% [15] and 12.9% [41] but consistent with the most susceptible young patients. Campylobacter can cause infection in all age groups; however, the clinical presentation may differ by different age groups of patients established in previous studies [23, 42–44]. Children at a young age are not aware on hygiene and sanitation practices. Commonly, in the rural settings of Bangladesh, farmers keep the livestock close to their house which offers regular contact of young children with the animals which is likely to further the risk of exposure of infection.

Family-level personal hygiene and involvement with livestock rearing were found to be associated with a higher level of Campylobacter exposure. The main routes of transmission of Campylobacter are the consumption of poultry and involvement with poultry rearing activities [45] or exposures resulting from environmental contamination by cattle manure [46, 47] that facilitate potential introduction in humans through the food chain [48]. However, exposure to livestock was documented as a significant association with higher Campylobacter positivity status [49]. Therefore, family-level involvement with livestock rearing including poor personal hygiene was presented to be a higher level of Campylobacter occurrence in this study.

Our study found that 20.8 to 51.4% and 15.6 to 62.5% isolates of C. jejuni (n = 72) and C. coli (n = 30), respectively, were susceptible to all antimicrobial agents. The isolates C. jejuni and C. coli exhibited resistant to amoxicillin (54.2%), erythromycin (45.8%), tetracycline (43%), ciprofloxacin (33.3%), and azithromycin (22.2%) and amoxicillin (68.7%), erythromycin (62.5%), tetracycline (59.3%), and ciprofloxacin and/or azithromycin (31.5%), respectively. This finding is narrowly corroborated by Albert et al. [19] in Bangladesh as Campylobacter isolates show resistance to ciprofloxacin that varies from 65 to 88% during 2005 to 2008 [21]. However, the finding of this study is consistent with a similar study conducted in diarrheal patients in Finland [50]. However, antimicrobial resistance was documented as 46.7%, 35.6%, and 17.8% in C. jejuni, C. coli, and C. upsaliensis isolates, respectively, in beef cattle of South Africa [51]. Conversely, higher levels of resistance to ciprofloxacin and tetracycline as >80% and> 70%, respectively, were captured in the diarrheal sample in the Arabian Gulf region [52].

Our study demonstrated that 27.8% (n = 20) and 31.2% (n = 10) of C. jejuni and C. coli, respectively, showed as multidrug resistance to 3 or more antimicrobial drugs, consistent with similar studies [23, 50, 53–55]. The MDR noticed in this survey is likely to be a potential reflection of imprudent use of antimicrobials due to their easy accessibility at local drug stores throughout the country [21].

Based on the study findings, risk reduction measures to be taken to address health education for the household livestock keepers, personal hygiene, microbiological evaluation of the isolates through culture and molecular assessment, and prudent use antimicrobials are needed.

5. Conclusions

The present study shows occurrence of Campylobacter infection in diarrheal patients, of which Campylobacter jejuni was captured as an abundant species. The higher frequency was observed in 0-5 years age, family-level poor hygienic practices, and involvement of animal husbandry. Therefore, activities on awareness creating behavioral change relating to personal hygiene like hand washing and sanitization after using the toilet or animal contact are needed. Children 0-5 years of age should avoid contact with livestock. The treatment of diarrhea patients should be based on an updated database on the susceptibility status of Campylobacter spp. instead of clinical signs. A physician should consider that diagnosing diarrhea infection with Campylobacter spp. is crucial among the other enteric pathogens. Cognizing the burden of Campylobacter diarrheal disease is significant for framing effective control programs targeting the overall decline of diarrheal disease in all ages of people. Further investigations are required to substantiate the role of domestic animals in the spreading of Campylobacter spp. including species diversities/serotyping.

Acknowledgments

The authors are thankful to the Mymensingh Medical Collage authority for allowing the screening of diarrheal patients under this study. The authors would also like to extend their appreciation to all participants for their cooperation during the sampling and subsequent interview data collection. This research was funded by the Krishi Gobeshona Foundation (Project ID: TF-45-L/17), AIC Building (3rd Floor), BARC Campus, Farmgate, Dhaka-1215, Bangladesh.

Data Availability

The tables, figures and texts in this research article contain the data that support the study conclusions.

Conflicts of Interest

The authors declare that no conflict of interest exists.

Supplementary Materials

Supplementary Materials

Supplementary Figure S1: molecular detection: (a) confirmation of Campylobacter spp. by the 16S rRNA gene, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–9: representative positive isolates, lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922); (b) confirmation of C. jejuni and C. coli via cdtA gene-based multiplex PCR assay, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–4: representative positive isolates (C. coli), lanes 5–7: representative positive isolates (C. jejuni), lane 8: positive control (C. fetus ATCC 27374), lane 9: positive control (C. coli ATCC 33559), lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922); (c) validation of C. jejuni by hippuricase (hipO) gene-based PCR, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–9: representative positive isolates, lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922).

References

  • 1.Zhang L., Li Y., Shao Y., et al. Molecular characterization and antibiotic resistant profiles of Campylobacter species isolated from poultry and diarrheal patients in Southeastern China 2017-2019. Frontiers Microbiology. 2020;11(1244) doi: 10.3389/fmicb.2020.01244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hlashwayo D. F., Sigaúque B., Bila C. G. Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review. Heliyon. 2020;6(3):p. e03537. doi: 10.1016/j.heliyon.2020.e03537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kirk M. D., Pires S. M., Black R. E., et al. Correction: World Health Organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Medicine. 2015;12(12):p. e1001940. doi: 10.1371/journal.pmed.1001940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Li Y., Zhang S., He M., et al. Prevalence and molecular characterization of Campylobacter spp. isolated from patients with diarrhea in Shunyi, Beijing. Frontiers Microbiology. 2018;9 doi: 10.3389/fmicb.2018.00052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kabir S. M. L. Comparison of Molecular Methods for the Species Identification of Clinical Campylobacter Strains and Their Antimicrobial Resistance, [Ph.D. thesis] Osaka, Japan: Osaka Prefecture University; 2011. [Google Scholar]
  • 6.Friedman C. R., Neimann J., Wegener H. C., Tauxe R. V. Epidemiology of Campylobacter jejuni infections on the United States and other industrialized nations. In: Nachamkin I., Blaser M. J., editors. Campylobacter. 2nd. Washington DC, USA: ASM press; 2000. pp. 121–138. [Google Scholar]
  • 7.European Food Safety Authority. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2013. EFSA Journal. 2015;13(1) doi: 10.2903/j.efsa.2015.3991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sahin O., Yaeger M., Wu Z., Zhang Q. Campylobacter-associated diseases in animals. Annual Review of Animal Biosciences. 2017;5(1):21–42. doi: 10.1146/annurev-animal-022516-022826. [DOI] [PubMed] [Google Scholar]
  • 9.Mäesaar M., Tedersoo T., Meremäe K., Roasto M. The source attribution analysis revealed the prevalent role of poultry over cattle and wild birds in human campylobacteriosis cases in the Baltic States. PLoS One. 2020;15 doi: 10.1371/journal.pone.0235841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sheppard S. K., Dallas J. F., Strachan N. J., et al. Campylobacter genotyping to determine the source of human infection. Clinical Infectious Disease. 2009;48(8):1072–1078. doi: 10.1086/597402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Miller W. G., Mandrell R. E. Prevalence of Campylobacter in the food and water supply: incidence, outbreaks, isolation and detection. In: Ketley J., Konkel M. E., editors. Campylobacter jejuni: New Perspectives in Molecular and Cellular Biology. Norfolk, UK: Horizon Scientific Press; 2005. pp. 101–163. [Google Scholar]
  • 12.Blaser M. J. Epidemiologic and clinical features of Campylobacter jejuni Infections. Journal of Infectious Disease. 1997;176(s2):S103–S105. doi: 10.1086/513780. [DOI] [PubMed] [Google Scholar]
  • 13.Goossens H., Vlaes L., de Boeck M., et al. Is "Campylobacter upsaliensis" an unrecognised cause of human diarrhoea? Lancet. 1990;335(8689):584–586. doi: 10.1016/0140-6736(90)90359-D. [DOI] [PubMed] [Google Scholar]
  • 14.Nyati K. K., Nyati R. Role of Campylobacter jejuni infection in the pathogenesis of Guillain-Barré syndrome: an update. Biomedical Research International. 2013;2013, article 852195:13. doi: 10.1155/2013/852195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Haq J. A., Rahman K. M. Campylobacter jejuni as a cause of acute diarrhoea in children: a study at an urban hospital in Bangladesh. Journal of Tropical Medicine and Hygiene. 1991;94:50–54. [PubMed] [Google Scholar]
  • 16.Islam Z., Jacobs B. C., Islam M. B., Mohammad Q. D., Diorditsa S., Endtz H. P. High incidence of Guillain-Barre syndrome in children, Bangladesh. Emerging Infectious Disease. 2011;17(7):1317–1318. doi: 10.3201/eid1707.101999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Islam Z., Gilbert M., Mohammad Q. D., et al. Guillain-Barré syndrome-related Campylobacter jejuni in Bangladesh: ganglioside mimicry and cross-reactive antibodies. PLoS One. 2012;7(8):p. e43976. doi: 10.1371/journal.pone.0043976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Platts-Mills J. A., Kosek M. Update on the burden of Campylobacter in developing countries. Current Opinion in Infectious Diseases. 2014;27(5):444–450. doi: 10.1097/QCO.0000000000000091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Albert M. J., Faruque A., Faruque S., Sack R. B., Mahalanabis D. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. Journal of Clinical Microbiology. 1999;37(11):3458–3464. doi: 10.1128/JCM.37.11.3458-3464.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hoque S. S., Faruque A., Mahalanabis D., Hasnat A. Infectious agents causing acute watery diarrhoea in infants and young children in Bangladesh and their public health implications. Journal of Tropical Pediatrics. 1994;40(6):351–354. doi: 10.1093/tropej/40.6.351. [DOI] [PubMed] [Google Scholar]
  • 21.Ahmed D., Hoque A., Elahi M. S. B., Endtz H. P., Hossain M. A. Bacterial aetiology of diarrhoeal diseases and antimicrobial resistance in Dhaka, Bangladesh, 2005-2008. Epidemiology & Infection. 2012;140(9):1678–1684. doi: 10.1017/S0950268811002135. [DOI] [PubMed] [Google Scholar]
  • 22.Alam K., Lastovica A. J., Le Roux E., et al. Clinical characteristics and serotype distribution of Campylobacter jejuni and Campylobacter coli isolated from diarrhoeic patients in Dhaka, Bangladesh, and Cape Town, South Africa. Bangladesh Journal of Microbiology. 2008;23:121–124. doi: 10.3329/bjm.v23i2.875. [DOI] [Google Scholar]
  • 23.Karmaker S., Kabir S. M. L., Haque A. Z., Mohammad F. R. K., Yousuf A. S. Screening of human diarrhoeal samples in Mymensingh city of Bangladesh for the isolation, identification and antimicrobial resistance profiles of Campylobacter spp. African Journal of Microbiology Research. 2018;12(32):771–778. doi: 10.5897/ajmr2018.8946. [DOI] [Google Scholar]
  • 24.The PLOS Neglected Tropical Diseases Staff. Campylobacter infection and household factors are associated with childhood growth in urban Bangladesh: an analysis of the MAL-ED study. PLoS Neglected Tropical Diseases. 2021;15 doi: 10.1371/journal.pntd.0009364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hassan M. M., Amin K. B., Ahaduzzaman M., Alam M., Faruk M. S. A., Uddin I. Antimicrobial resistance pattern against E. coli and Salmonella in layer poultry. Research Journal for Veterinary Practitioners. 2014;2(2):30–35. doi: 10.14737/journal.rjvp/2014/2.2.30.35. [DOI] [Google Scholar]
  • 26.Englen M. D., Ladely S. R., Fedorka-Cray P. J. Isolation of Campylobacter and identification by PCR. Methods in Molecular Biology. 2003;216:109–221. doi: 10.1385/1-59259-344-5:109. [DOI] [PubMed] [Google Scholar]
  • 27.Isenbarger D. W., Hoge C. W., Srijan A., et al. Comparative antibiotic resistance of diarrheal pathogens from Vietnam and Thailand, 1996-1999. Emerging Infectious Disease. 2002;8(2):175–180. doi: 10.3201/eid0802.010145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Engberg J., Neimann J., Nielsen E. M., Aarestrup F. M., Fussing V. Quinolone-resistant Campylobacter infections: risk factors and clinical consequences. Emerging Infectious Disease. 2004;10(6):1056–1063. doi: 10.3201/eid1006.030669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shiramaru S., Asakura M., Inoue H., Nagita A., Matsuhisa A., Yamasaki S. A cytolethal distending toxin gene-based multiplex PCR assay for detection of Campylobacter spp. in stool specimens and comparison with culture method. Veterinary Medicine and Science. 2012;74(7):857–862. doi: 10.1292/jvms.11-0574. [DOI] [PubMed] [Google Scholar]
  • 30.Nachamkin I. Manual of Clinical Microbiology. 8th. Washington, DC, USA: ASM press; 2003. Campylobacter and Arcobacter; pp. 902–914. [Google Scholar]
  • 31.Foster G., Holmes B., Steigerwalt A. G., et al. Campylobacter insulaenigrae sp. nov., isolated from marine mammals. International Journal of Systematic and Evolutionary Microbiology. 2004;54(6):2369–2373. doi: 10.1099/ijs.0.63147-0. [DOI] [PubMed] [Google Scholar]
  • 32.Swai E., Hulsebosch J., van der Heijden W. Prevalence of genital campylobacteriosis and trichomonosis in crossbred breeding bulls kept on zero-grazed smallholder dairy farms in the Tanga region of Tanzania. Journal of the South African Veterinary Association. 2005;76(4):224–227. doi: 10.4102/jsava.v76i4.431. [DOI] [PubMed] [Google Scholar]
  • 33.Hoshino K., Yamasaki S., Mukhopadhyay A. K., et al. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunology Medical Microbiology. 1998;20(3):201–207. doi: 10.1111/j.1574-695X.1998.tb01128.x. [DOI] [PubMed] [Google Scholar]
  • 34.Samosornsuk W., Asakura M., Yoshida E., et al. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from poultry in Thailand. Microbiology & Immunology. 2007;51(9):909–917. doi: 10.1111/j.1348-0421.2007.tb03974.x. [DOI] [PubMed] [Google Scholar]
  • 35.Asakura M., Samosornsuk W., Hinenoya A., et al. Development of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, Campylobacter coli and Campylobacter fetus. FEMS Immunology and Medical Microbiology. 2008;52(2):260–266. doi: 10.1111/j.1574-695X.2007.00369.x. [DOI] [PubMed] [Google Scholar]
  • 36.Linton D., Lawson A., Owen R., Stanley J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. Journal of Clinical Microbiology. 1997;35(10):2568–2572. doi: 10.1128/jcm.35.10.2568-2572.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Luangtongkum T., Morishita T. Y., el-Tayeb A. B., Ison A. J., Zhang Q. Comparison of antimicrobial susceptibility testing of Campylobacter spp. by the agar dilution and the agar disk diffusion methods. Journal of Clinical Microbiology. 2007;45(2):590–594. doi: 10.1128/JCM.00986-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Clinical and Laboratory Standards Institute (CLSI) M100 – Performance standards for antimicrobial susceptibility testing. 26th. Wayne, PA, USA: CLSI supplement; 2016. [Google Scholar]
  • 39.Magiorakos A. P., Srinivasan A., Carey R. B., et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  • 40.Centers for Disease Control and Prevention (CDC) User Guide. CDC; 2016. Epi Info™ 7; pp. 1–645. [Google Scholar]
  • 41.Huda N., Andalib S., Yusuf M. A. Socio-demographic characteristics of Campylobacter jejuni infected diarrhoeal patients under 5 years. Bangladesh Journal of Infectious Diseases. 2017;2(2):33–36. doi: 10.3329/bjid.v2i2.32293. [DOI] [Google Scholar]
  • 42.Coker A. O., Isokpehi R. D., Thomas B. N., Amisu K. O., Obi C. L. Human campylobacteriosis in developing countries. Emerging Infectious Disease. 2007;8 doi: 10.3201/eid0803.010233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Oberhelman R. A., Taylor D. N. Campylobacter infections in developing countries. In: Nachamkin I., Blaser M. J., editors. Campylobacter. 2nd. Washington, DC, USA: American Society for Microbiology; 2000. pp. 139–153. [Google Scholar]
  • 44.Taylor D. Campylobacter infections in developing countries. In: Nachamkin I., Blaser M. J., Tompkins L. S., editors. Campylobacter jejuni: Current status and future trends. Washington, DC, USA: American Society for Microbiology; 1992. pp. 20–30. [Google Scholar]
  • 45.Arsenault J., Michel P., Berke O., Ravel A., Gosselin P. Environmental characteristics associated with campylobacteriosis: accounting for the effect of age and season. Epidemiology & Infection. 2012;140(2):311–322. doi: 10.1017/S0950268811000628. [DOI] [PubMed] [Google Scholar]
  • 46.Manyi-Loh C., Mamphweli S., Meyer E., Makaka G., Simon M., Okoh A. An overview of the control of bacterial pathogens in cattle manure. International Journal of Environmental Research and Public Health. 2016;13 doi: 10.3390/ijerph13090843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mourkas E., Florez-Cuadrado D., Pascoe B., et al. Gene pool transmission of multidrug resistance among Campylobacter from livestock, sewage and human disease. Environmental Microbiology. 2019;21(12):4597–4613. doi: 10.1111/1462-2920.14760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Mourkas E., Taylor A. J., Méric G., et al. Agricultural intensification and the evolution of host specialism in the enteric pathogen Campylobacter jejuni. Proceedings of the National Academy of Sciences of the United States of America. 2020;117(20):11018–11028. doi: 10.1073/pnas.1917168117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lengerh A., Moges F., Unakal C., Anagaw B. Prevalence, associated risk factors and antimicrobial susceptibility pattern of Campylobacter species among under five diarrheic children at Gondar University Hospital, Northwest Ethiopia. BMC Pediatric. 2013;13(82):1–9. doi: 10.1186/1471-2431-13-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Hakanen A. J., Lehtopolku M., Siitonen A., Huovinen P., Kotilainen P. Multidrug resistance in Campylobacter jejuni strains collected from Finnish patients during 1995–2000. Journal of Antimicrobial Chemotherapy. 2003;52(6):1035–1039. doi: 10.1093/jac/dkg489. [DOI] [PubMed] [Google Scholar]
  • 51.Karama M., Kambuyi K., Cenci-Goga B. T., et al. Occurrence and antimicrobial resistance profiles of Campylobacter jejuni, Campylobacter coli, and Campylobacter upsaliensis in beef cattle on cow-calf operations in South Africa. Foodborne Pathogens and Disease. 2020;17(7):440–446. doi: 10.1089/fpd.2019.2703. [DOI] [PubMed] [Google Scholar]
  • 52.Senok A., Yousif A., Mazi W., et al. Pattern of antibiotic susceptibility in campylobacter jejuni isolates of human and poultry origin. Japanese Journal of Infectious Diseases. 2007;60(1):1–4. [PubMed] [Google Scholar]
  • 53.McGill K., Cowley D., Moran L., et al. Antibiotic resistance of retail food and human Campylobacter isolates on the island of Ireland from 2001–2002. Epidemiology & Infection. 2006;134(6):1282–1291. doi: 10.1017/S0950268806006200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Moore J. E., Barton M. D., Blair I. S., et al. The epidemiology of antibiotic resistance in Campylobacter. Microbes Infection. 2006;8(7):1955–1966. doi: 10.1016/j.micinf.2005.12.030. [DOI] [PubMed] [Google Scholar]
  • 55.Luangtongkum T., Jeon B., Han J., Plummer P., Logue C. M., Zhang Q. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiology. 2009;4(2):189–200. doi: 10.2217/17460913.4.2.189. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Materials

Supplementary Figure S1: molecular detection: (a) confirmation of Campylobacter spp. by the 16S rRNA gene, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–9: representative positive isolates, lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922); (b) confirmation of C. jejuni and C. coli via cdtA gene-based multiplex PCR assay, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–4: representative positive isolates (C. coli), lanes 5–7: representative positive isolates (C. jejuni), lane 8: positive control (C. fetus ATCC 27374), lane 9: positive control (C. coli ATCC 33559), lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922); (c) validation of C. jejuni by hippuricase (hipO) gene-based PCR, lanes 1 and 12: 100 bp DNA ladder (Promega, USA), lanes 2–9: representative positive isolates, lane 10: positive control (C. jejuni ATCC 33560), and lane 11: negative control (Escherichia coli ATCC 25922).

Data Availability Statement

The tables, figures and texts in this research article contain the data that support the study conclusions.


Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES