Skip to main content
NCBI home page
EPA Author Manuscripts logoLink to EPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jun 20.
Published in final edited form as: Sci Total Environ. 2021 Feb 6;774:145142. doi: 10.1016/j.scitotenv.2021.145142

Quantification of Legionella pneumophila by qPCR and culture in tap water with different concentrations of residual disinfectants and heterotrophic bacteria

Maura J Donohue 1
PMCID: PMC8358786  NIHMSID: NIHMS1689279  PMID: 33610980

Abstract

Legionellosis prevalence is increasing in the United States. This disease is caused primarily by the bacterium Legionella pneumophila found in water and transmitted by aerosol inhalation. This pathogen has a slow growth rate and can “hide” in amoeba, making it difficult to monitor by the traditional culture method on selective media. Tap water samples (n = 358) collected across the United States were tested for L. pneumophila by both culture and quantitative Polymerase Chain Reaction (qPCR). The presence of other bacteria was quantified by heterotrophic plate counts (HPC). Residual disinfectant concentrations (free chlorine or monochloramine) were measured in all samples. Legionella pneumophila had the highest prevalence and concentration in the chlorinated water samples that had a free-chlorine value of less than 0.2 mg Cl2/L. In total, 24% (87/358) of the samples were positive for L. pneumophila either by qPCR or 3% (11/358) were positive by culture. In chloramine-treated samples, L. pneumophila was detected by qPCR in 21% (31/148) and 1% (2/148) by culture, despite a high monochloramine residual >1 mg Cl2/L. Despite the presence of a high disinfectant residual (>1 mg Cl2/L), HPC counts were substantial. This study indicates that both culture and qPCR methods have limitations when predicting a potential risk for disease associated with L. pneumophila in tap water. Measuring disinfectant residuals and quantifying HPC in water samples may be useful adjunct parameters for reducing Legionellosis’ risk from public water supplies at high-risk locations.

Keywords: Legionella pneumophila, Culture, Heterotrophic bacteria, qPCR, Monitoring, Residual

Graphical abstract

graphic file with name nihms-1689279-f0001.jpg

1. Introduction

Over 37,000 legionellosis cases were reported to the Centers for Disease Control and Prevention’s (CDC) National Notifiable Disease and Condition List between 2011 and 2017. Legionnaires Disease and Pontiac Fever are two manifestations of a L. pneumophila infection. Legionnaires Disease is the most commonly reported form of legionellosis, usually caused by Legionella pneumophila (Hicks et al., 2012). Transmission of the Legionella bacterium primarily occurs through the inhalation of aerosols (Fraser et al., 1977). Although L. pneumophila is an environmental, water-borne bacterium (Bergey, 2012), it can survive drinking water treatment and be present in public water supplies (Stout et al., 1992). Therefore, it is critical to accurately and efficiently monitor these bacteria in water.

Traditionally, monitoring of Legionella populations in water samples relied on colony growth on selective media (APHA, 2012; ISO, 2017). The limitations of the culture methods to detect and quantify Legionella are well documented (Bonetta et al., 2010; Bopp et al., 1981; Whiley and Taylor, 2016). For example, the culture method was reported to recover only 10 to 40% of the Legionella population in a study reported by Lee et al. (2002). The culture method’s limitations are due to Legionella’s slow growth rate (Bergey, 2012) and the fact that it can harbor inside amoeba, a single cell eukaryotic organism (Rowbotham, 1980) commonly found in water. Therefore, Legionella is difficult to monitor in water or other environmental media (Donohue et al., 2019a; Maze et al., 2014; Murdoch et al., 2013). Legionellosis can be a serious and expensive illness (Collier et al., 2012); thus, improved methods for monitoring Legionella in water are of high interest. Some molecular (Buse et al., 2019; Collins et al., 2015; Donohue et al., 2014; Joly et al., 2006; Wellinghausen et al., 2001) and immunological (Berdal et al., 1979; Tilton, 1979) techniques have potential value as monitoring tools but need improvement.

Quantitative polymerase chain reaction (qPCR) is a DNA-based method that is widely used to demonstrate food safety (Allwood et al., 2020) for medical diagnostics (Kwok et al., 2018; Siracusano et al., 2020) and by forensic scientists. However, linking qPCR results to other measures of water quality is a new endeavor.

Heterotrophic plate counts (HPC) testing and measuring the disinfectant residuals are two tests traditionally applied to evaluate the microbiological quality of water. For example, a chlorine residual greater than 0.2 mg Cl2/L, but not exceeding 4 mg Cl2/L water (USEPA, 1994), signifies that microbial growth on an HPC plate will be low. On the other hand, water with a free-chlorine residual of less than 0.2 mg Cl2/L is likely to have many colonies on an HPC plate (McCabe et al., 1970).

This study was conducted to evaluate the relationship between the results from qPCR measurements of L. pneumophila in water samples compared to culture-based results, and HPC colony counts as they relate to disinfectant residuals. The results of this study should help inform the three separate monitoring approaches and identify their efficacy as monitoring tools for predicting the risk that a given sample could be carrying L. pneumophila.

2. Materials and methods

2.1. Study design

Between 2011 and 2017, potable water samples were collected from taps within forty-six states across the United States. Three hundred and fifty eight water samples were analyzed; 210 samples came from taps where the water was chlorinated, and 148 water samples came from taps where the water was chloraminated. The sample collection volunteers were sent all sampling supplies with instructions. They collected water at each tap in two-500 mL high-density polypropylene (HDPP) Nalgene bottles (Thermo Scientific, Waltham, MA) following 15 s flush time. One of the 500 mL HDPP bottle contained 0.015 g/500 mL sodium thiosulfate to preserve the sample for culture work. On the day the sample was collected, the bottles were packed in ice and sent by next day air to the US EPA; Cincinnati, Ohio.

2.2. Heterotrophic plate counts

Immediately upon a sample arrival, Standard Methods 9215B was used to enumerate the heterotrophic bacteria (APHA, 2012). The bottle containing sodium thiosulfate was briefly shaken. A 100 μL aliquot of water was spread-plated onto an R2A agar plate in duplicate (Becton, Dickinson and Company; Sparks, MD) and incubated at 25 °C for seven days. Colony forming units (CFU) were counted and recorded on day seven.

2.3. Legionella culture

Upon a sample arrival, the Legionella spp. was recovered from the sample following Standard Methods 9260Ja (APHA, 2012). Briefly, from the bottle containing sodium thiosulfate, a 100 mL aliquot was vacuum-filtered through a 0.2 μm Supor membrane (Pall Life Sciences; Port Washington, NY). Once completed, using forceps, the membrane was aseptically transferred to a 5 mL macrocentrifuge tube (Celltreat Scientific Products, Pepperell, MA) containing 5 mL sterile water and vortexed with 3 × 30 s pulses. Two Buffer Charcoal Yeast Extract (BCYE) (Becton, Dickinson and Company; Sparks, MD) plates were spread plated with 100 μL of suspension. Plates were incubated at 35 °C for seven days. The theoretical limit of detection for culture is one CFU/2 mL. Presumptive Legionella colonies were identified to the species level using the MALDI Biotyper (Bruker Daltronics, Bellrinca, MA) (Dilger et al., 2016). Briefly, cells representing a single colony on a culture plate were spread into individual wells on the MALDI target plate. A microliter of Bacterial Test Mix Solution (Bruker Daltronics, Bellrinca, MA) was also plated and used to calibrate the instrument. Next, 1 μL of α-Cyano-4-hydroxycinnamic acid (CHCA) matrix was overlaid on top of the cells and bacterial text mix and left to air dry. Once the target plate was dry, it was inserted into the mass spectrometer for calibration and protein fingerprint analysis using Bruker’s Real-time bacterial identification software.

2.4. Quantitative PCR

The qPCR method and data were previously reported by Donohue et al. (2019b). Below is a brief description of the process. The 500 mL of water was vacuum-filtered through a 47 mm, 0.4 μm Whatman® Nucleopore™ Track-Etched Membrane (Whatman Inc., Piscataway, NJ). The membrane was transferred aseptically with forceps to a sterile, 2 mL O-ring screw cap microcentrifuge tube (Sarstedt, Newton, NC) containing 0.30 ± 0.05 g 0.1 mm of sterile glass beads (BioSpec Products, Bartlesville, OK). Next, DNA was extracted by adding 500 μL of Tissue and Cell Lysis Solution (Lucigen Corporation, Middleton, WI) to the bead-beaded tube (2 mL O-ring screw cap microcentrifuge tube) and bead-beaten for 3 min. After a 5 min cooldown in ice, the tube’s bottom was punctured with a 1/18 gage needle. The bead-beating tube was inserted into a 1.5 mL microcentrifuge tube (Eppendorf, Hauppauge, NY), and the lysate was collected into the 1.5 mL microcentrifuge tube by centrifugation for 5 min at 3500 rpm. Next, 2 μL of Proteinase K (50 μg/μL) (Lucigen Corporation, Middleton, WI) was added to the lysate and incubated at 65 °C in a water bath for 15 min. Then, 2 μL of RNase A (5 μg/μL) (Lucigen Corporation, Middleton, WI) was added to the lysate and incubated at 37 °C for 30 min. Subsequently, 350 μL of MPC Protein Precipitation Reagent (Lucigen Corporation, Middleton, WI) was added to precipitate the cellular proteins. The resulting supernatant was transferred to a microcentrifuge tube with an equal volume of ice-cold isopropanol (~−4 °C) and centrifuged at 10,000 ×g for 10 min. The isopropanol was poured off, and the resulting DNA pellet washed with 500 μL of ice cold (~−4 °C) 70% ethanol. Samples were centrifuged, and the ethanol was removed by pipet. The DNA pellet was air dry for 15 min to remove any remaining ethanol residual. Then, the DNA pellet was re-suspended in 25 μL of TE buffer (Integrated DNA Technologies, Coralville, IA) and stored at −80 °C until analyzed.

The preparation of standards (positive control) and other controls (method control and non-template control) for the qPCR analysis are previously published (Donohue et al., 2019b). The primer-probe set used to detect and quantify L. pneumophila (Donohue et al., 2014) in water was published previously. The primer-probe set used to detect L. pneumophila, targets the 16S rRNA gene; it includes the forward primers (L pneum F1): GGAATTACTGGGCGTAAAGG, reverse primer (Lpneum R1): GAGTCAACCAGTATTATCTGACCG, and probe (Lpneum P1): 6FAM-AAGCCCAGGAATTTCACAGAT–BHQ. Quantitative PCR conditions and instrument used for the L. pneumophila assay is as follows. The qPCR total reaction volume was 25 μL and consisted of 17 μL of TaqMan® Universal PCR Master Mix plus 2 μL of a mixture of forward and reverse primers (500 nM), a 100 nM IDT Probe, 1 μL of 0.1% Bovine Serum Albumin (BSA), and 5 μL of DNA purified. Five microliters of DNA extract were analyzed per qPCR reaction equating to 100 mL of the original sample volume. Reactions were performed in triplicate for the L. pneumophila assay using a Roche LightCycler® 480 II Real-time PCR system (Roche Applied Science, Indianapolis, IN). The LightCycler® setting included monocolor-hydrolysis detection with a pre-incubation step of 10 min at 95 °C, with 40 cycles of the following thermocycling conditions 15 s at 95 °C, 60 s at 60 °C, and a cooling step of 5 min at 30 °C.

The qPCR results were interpreted as follows: a sample was considered positive for L. pneumophila if two or more of the triplicates had a quantification cycle (Cq) value <39. Quantitative PCR Cq values were transformed to cell equivalence per mL (CE/mL) using a master standard curve linear equation. Quantitative PCR limit of detection can theoretically detect one genomic target per 100 mL. However, the limit of detection definition applied in this study is the lowest number of gene targets detected 100% of the time. For the Lp16S assay, this was 10 cell equivalence (CE)/100 mL or 10 genomic target/100 mL (Donohue et al., 2014).

2.5. Chlorine residual

These analyses were performed in the first 24 h after sample collection. The chlorine residual and monochloramine (chloramine) levels were measured colorimetrically using Hach’s DPD-Free Chlorine and Monochlor F reagents (Loveland, CO). The manufacturer’s instructions were followed.

2.6. Statistical analysis

Percentage calculations were performed in Excel (Microsoft Corporation, Redmond, WA). Statistical significance was determined using Mann-Whitney Rank Sum t-test Sigma Plot 14.0 (Systat, San Jose, CA) a significance level of 0.05.

3. Results

Legionella pneumophila was detected in 25% of the water samples (88/358) by either qPCR or culture. By qPCR, L. pneumophila was detected in 24% of the samples (87/356): i.e., 27% (56/210) from chlorinated water sources and 21% (31/148) from chloraminated water sources. By culture, L. pneumophila was recovered from far fewer samples 3% (11/358) of all samples, 4% (9/210) from chlorinated water, and 2% (2/148) from chloraminated water sources. Four colonies of L. anisa were the only other Legionella spp. recovered. The L. anisa colonies were all recovered from one water sample. There was one chloramine sample (1/2) that was culture positive but qPCR negative. Overall, L. pneumophila concentrations measured by qPCR were about one to three logs greater than those estimated by culture (Fig. 1A and B).

Fig. 1.

Fig. 1.

Open in a new tab

Legionella pneumophila positive samples by culture and qPCR results. A. Chlorine-treated water, B. Chloramine-treated water.

Fig. 2 shows L. pneumophila prevalence and concentrations from the culture and qPCR analyses, as modulated by residual disinfectant concentrations. Culture detection of L. pneumophila (Fig. 2A) occurred in cases where there was no measurable free chlorine or when monochloramine concentrations were >1.0 mg Cl2/L (see two samples designated with blue open diamond). Samples with different disinfectant residuals, L. pneumophila detections by qPCR (orange circles) are shown in Fig. 2B and C. Legionella pneumophila was detected in 73% of samples (41/56) that had no measurable free-chlorine residual, i.e., less than 0.1 mg Cl2/L (Fig. 2B). Ninety percent (28/31) of the L. pneumophila detections in chloraminated waters had a monochloramine residual >1 mg Cl2/L (Fig. 2C). Samples positive by both culture and qPCR are also shown in Fig. 2B and C (blue diamond, culture positive). In chloraminated water samples, L. pneumophila was detected by qPCR and by culture in water that had a wide range of monochloramine concentrations, 0.1 to 8 mg Cl2/L water.

Fig. 2.

Fig. 2.

Open in a new tab

L. pneumophila concentration by disinfectant residual. A. L. pneumophila culture recovery, B. Chlorine treated water, L. pneumophila detection by qPCR C. Chloramine treated water, L. pneumophila positive qPCR samples.

Sample’s HPC results and residuals (free-chlorine or monochloramine) are graphed in Fig. 3. Additional designations were added to a sample’s HPC result; if that sample was positive for L. pneumophila by both culture and qPCR (blue diamond) or qPCR (only) (red circle). The majority of L. pneumophila positive water samples had an HPC count exceeding 101 CFU/mL. The HPC data demonstrated a quarter log reduction in the bacterial count for every mg of free-chlorine present in the water (Fig. 3A). For chloraminated samples, the HPC data (Fig. 3B) demonstrated that the monochloramine residual did not impact the heterotrophic bacterial counts. A slight bacterial increase was observed for every mg of monochloramine present.

Fig. 3.

Fig. 3.

Open in a new tab

Heterotrophic plate count (CFU/mL) by disinfectant residual in (A) Chlorine treated water and (B) Chloramine treated water. L. pneumophila positive samples by culture (blue triangle) and qPCR (red dot), and L. pneumophila negative samples (grey x). The linear regression line is the dotted pink.

Fig. 4 shows L. pneumophila detection frequency and depicts concentration (box and whisker plot) in relationship to the heterotrophic bacterial count (shaded square). For each HPC segmentation, L. pneumophila detection frequency ranged from 18 to 34% by qPCR or 3–6% by culture.

Fig. 4.

Fig. 4.

Open in a new tab

Legionella pneumophila qPCR and culture detection frequency and concentration relationship with heterotrophic bacteria counts.

Results indicate that heterotrophic bacteria at the 1–10 CFU/mL were not suppressing L. pneumophila regrowth. As the HPC concentrations increase, L. pneumophila concentrations (box and whisker plot) start shifting to the left of the HPC zone, signifying that heterotrophic bacteria are suppressing L. pneumophila regrowth. The farther the box and whisker plots are from the HPC zone could indicate that the impact of HPC bacterial utilization of nutrients acts to suppress the replication of the L. pneumophila microbes. The area (from the top of the HPC zone to the box and whisker plot 75th percentile) increases as the heterotrophic bacterial counts increase. The culture results showed a 2 to 3 log suppression and the qPCR results indicate a 1.5 to 4 log suppression of L. pneumophila.

In Fig. 4A and C, the qPCR data provides a finer resolution, revealing other trends. In Fig. 4A, the median concentrations of L. pneumophila decreased as the HPC counts increased (the differences between HPC >10 CFU/mL and >1000+ CFU/mL are statistically significant, P = 0.015). The box and whisker plot area that overlaps with the HPC zone indicates that these samples were also culture positive. Further investigation into samples that were both culture and qPCR positive is illustrated in Fig. 5. Another apparent trend is the fact that the L. pneumophila box whisker plots are right-skewed. This distribution type suggest that several water quality factors could be impacting L. pneumophila survival and replication relative to those influencing the heterotrophic bacteria population. However, the occurrence of these circumstances is not frequent, as indicated by the long tailing of the distribution curve.

Fig. 5.

Fig. 5.

Open in a new tab

Legionella pneumophila positive samples: comparison of L. pneumophila culture and qPCR concentration to heterotrophic plate count (CFU/100 mL) values for each of the qPCR positive findings. A. L. pneumophila culture positive samples in either chlorine or chloramine treated water (as indicated). B. L. pneumophila qPCR positive samples in chlorine treated water C. L. pneumophila qPCR positive samples in chloramine treated water. The green star represents samples that were also culture positive. The dotted line (Panel B) represents the threshold of higher culture likelihood.

Fig. 5A compares the eleven L. pneumophila culture-positive samples, from both chlorine- and chloramine-treated water, to the samples’ heterotrophic bacteria counts. It is clear from this figure that the culture confirmed L. pneumophila concentrations are small relative to the heterotrophic bacteria count from those same samples. The L. pneumophila concentration was higher than the heterotrophic bacteria count for only 1 of the 11 samples. The heterotrophic bacteria were one to three log units higher than the L. pneumophila concentrations for the other ten samples. There is no consistent relationship between the total HPC value and the probability that any given sample will harbor viable L. pneumophila as identified by culture (see samples 2, 5, 7, and 11).

Fig. 5B and C respectively reflect the findings from the chlorine and chloramine treated water samples. The individual sample numbers are identified on the X-axis. The black Y-axis background identifies the HPC counts for the individual samples arrayed from the lowest to highest HPC concentration for the chlorine (Fig. 5B) systems and chloramine (Fig. 5C). The red portion of the figure provides the qPCR results for each sample. The green stars are the culture positive samples aligned in accordance with the sample number for those that were both qPCR and culture positive. In chlorine-treated water (Fig. 5B), 17% (10/56) of samples had L. pneumophila concentration (CE/mL) that neared or exceeded the heterotrophic bacteria counts. Interestingly, these samples also had the highest likelihood of being culture positive. In chloramine-treated water, the HPC counts were 4 to 6 logs greater in concentration compared to the L. pneumophila concentrations in many water samples, 73% (24/33).

4. Discussion

Legionella pneumophila contamination in tap water can be determined by both culture and qPCR methods. However, each approach has its own limitations in estimating risk. The culture method lacked the ability to detect all live L. pneumophila microorganisms, including those that were viable but nonculturable cells (VBNC) or amoeba encysted. The culture method often underestimates the levels of L. pneumophila in a water sample. On the other hand, the qPCR method can detect both alive and damaged/dead cells by detecting decaying DNA. Therefore, the method can overestimate the L. pneumophila concentrations (Joly et al., 2006). These limitation are clearly recognized in the published literature (Behets et al., 2007; Collins et al., 2017; Joly et al., 2006; Merault et al., 2011; Wullings and van der Kooij, 2006; Yanez et al., 2005). Thus, additional research is needed to further refine monitoring approaches (culture, qPCR, or some combination of the two) to provide a stronger link between the presence of L. pneumophila and the risk for disease.

In tap water, disinfectant residuals and heterotrophic bacteria counts are water quality parameters that provide important context relative to L. pneumophila occurrence risk. As expected, in free-chlorine treated water, most of the L. pneumophila detections (culture and qPCR) were in water with free chlorine residuals below 0.2 mg Cl2/L water, suggesting that the distribution system’s guidelines require residuals to be greater than 0.2 mg Cl2/L are health protective (USEPA, 2006). However, in cases where the water was treated with chloramine, this was not the case. L. pneumophila detections occurred across the monochloramine concentration span. The lack of a correlation between monochloramine residual and the detection of L. pneumophila by both qPCR and culture is apparent. When viable bacteria counts were examined, 75% (24/32) of the L. pneumophila qPCR detections were from samples that had high HPC (>101 CFU/mL water) viable bacterial counts; despite a high monochloramine residual concentration (Fig. 3B). These results suggest that the free-chlorine residual has a stronger antimicrobial potency than monochloramine.

Independent of a sample’s heterotrophic bacterial count, the culture method only achieved a 3–6% recovery of L. pneumophila (Fig. 4). Compared to the qPCR quantification, the culture detection threshold for Legionella indicates that it has fundamental limitations. Either not enough water was analyzed, or the L. pneumophila concentration was well below the culture method’s recovery limit (APHA, 2012). Another possible explanation for the poor performance of the culture method is low method robustness, due to other water quality characteristics (e.g., hardness, total organic carbon, pH) that affect Legionella’s recovery (Kuchta et al., 1983). Method selectivity may also be limiting culture performance. Although most Legionella spp. can grow on the selective BCYE media, a heavy inoculum is needed (Joly et al., 2006; Lee et al., 1993; Wang et al., 2012; Wullings and van der Kooij, 2006).

The culture recovery rates of the other Legionella spp. are even lower than L. pneumophila recovery rates. In this study, 0.3% (1/358) samples yielded a Legionella non-pneumophila species compared to the 3% of L. pneumophila positive samples. The Kyritsi et al. (2018) study had similar results. In this case, 9% (46/505) of samples were Legionella non-pneumophila positive, and 38% (192/505) were L. pneumophila positive (Kyritsi et al., 2018). However, studies that used a Legionella spp. (genus) qPCR methods reveal that ~83% of samples were Legionella spp. positive (genus), and about 28% of the samples were L. pneumophila positive (Schwake et al., 2016; Wang et al., 2012). With the use of molecular tools, it becomes evident that Legionella spp. are more prevalent in the water than what culture methods are indicating. Therefore, it cannot be assumed that the culture method is suitable for recovering all environmental Legionella spp., and perhaps not suited for all environmental L. pneumophila strains.

HPC testing is a good measure of microbial control. For in the presence or absence of treatment, it does quantify the number of heterotrophic microbes present in the water. However, HPC results are only a fair predictor of L. pneumophila occurrence in drinking water (Bargellini et al., 2011; Duda et al., 2015). This is due to L. pneumophila not being able to compete with the heterotrophic bacteria for nutrients. Evidence of this is observed in Fig. 4A and C. The L. pneumophila highest detection frequencies of 33 and 36% were in the 101–1000 CFU/mL range. As the heterotrophic bacteria exceeded 1001 CFU/mL the L. pneumophila detection frequency dropped to 20 to 23% of samples being positive. It is only under the strict conditions of temperature, nutrients, and pH that L. pneumophila can grow under laboratory conditions, requiring 3 to 10 days for a visible colony to appear (Warren and Miller, 1979). L. pneumophila has a generation time (the amount of time needed to duplicate) of 4 to 6 h (Ristroph et al., 1981; Warren and Miller, 1979). The heterotrophic bacteria generation time is minutes (LaBauve and Wargo, 2012; Mahdi et al., 2014). This evolutionary strategy of a longer generation time allows L. pneumophila to persist, not overpopulate in most water conditions. This persistence strategy was observed in the qPCR data (Fig. 4A and C). Regardless of the heterotrophic bacteria concentrations, approximately 30% of the samples were positive for L. pneumophila in both chlorine and chloramine treated water (Fig. 4). Additionally, in King et al. source and drinking water study demonstrates that even in ambient waters L. pneumophila median concentration is low (2.4 CE/mL) relative to HPC results of 3 to 4 logs (CFU/mL) and comparable to the results observed in treated water (unpublished HPC results) (King et al., 2016). This paper emphasizes L. pneumophila persistence strategy in untreated water.

In chloramine treated water, the monochloramine residual was unexpectantly not a reliable indicator of microbial control. Without performing the HPC test, the loss of microbial control would not be detected. Therefore, the positive qPCR results from the chloramine treated water samples could not be fully explained without realizing that a large viable heterotrophic bacterial population thrived.

Quantitative PCR assays can detect DNA from damaged and dead cells. The positive samples do not necessarily pose a risk to human health. If residuals were greater than 0.1 mg Cl2/L water and the heterotrophic plate counts were less than 101 CFU/mL, then qPCR only detected L. pneumophila in 16% (14/88) of the water samples. This microbial subpopulation is unlikely to be of risk to human health. Most qPCR positive water samples (84%) were in water that had no chlorine residual. Nevertheless, the thresholds of 0.1 mg Cl2/L free-chlorine and >101 CFU/mL in water were arbitrary in this analysis and need to be validated or modified based on water samples associated with actual legionellosis cases or outbreaks.

Measurement of disinfectant residuals and HPC testing in water samples are parameters that can support the risk analysis when paired with results from culture or qPCR applications. Chloramine-treated water demonstrated a lack of microbial control despite a high residual. Therefore, the positive L. pneumophila detection in chloramine-treated water cannot be dismissed without further assessment. The results indicate that bacterial control measures were not performing at the point-of-use locations. Therefore, the frameworks for monitoring L. pneumophila at public water systems may need refinement. Similar monitoring adjustments may also be needed for cooling towers and HVAC systems because these sources are prone to Legionella spp. and L. pneumophila contamination (WHO, 2007).

Highlights.

  • Culture underestimates L. pneumophila detection frequency and concentration.

  • Quantitative PCR is more sensitive than culture for L. pneumophila detection.

  • Free-chlorine residual is a good indicator of microbiological quality control.

  • Monochloramine residual is not a good indicator of microbiological quality control.

  • For chloramine water, HPC analysis is the better indicator of microbial control.

Acknowledgments

Disclaimer

The United States Environmental Protection Agency through its Office of Research and Development funded and managed the research described here. It has been subjected to the Agency’s administrative review and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use.

Abbreviations

qPCR

quantitative Polymerase Chain Reaction

HPC

heterotrophic plate counts

CFU

colony forming units

US EPA

United States Environmental Protection Agency

CDC

Centre for Disease Control and Prevention

CE

cell equivalence

Footnotes

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Allwood et al. , 2020Allwood JS, Fierer N, Dunn RR The future of environmental DNA in forensic science Appl. Environ. Microbiol, 86 (2020), 10.1128/AEM.01504-19, APHA 2012 APHA [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Standard Methods for the Examination of Water and Wastewater: American Public Health Association (APHA), American Water Works Association (AWWA), Water Environment Federation (WEF), Legionella Method; 9215b (2012) [Google Scholar]
  3. Bargellini et al., 2011Bargellini A, Marchesi I, Righi E, Ferrari A, Cencetti S, Borella P, et al. Parameters predictive of Legionella contamination in hot water systems: association with trace elements and heterotrophic plate counts Water Res., 45 (2011), pp. 2315–2321 [DOI] [PubMed] [Google Scholar]
  4. Behets et al. , 2007Behets J, Declerck P, Delaedt Y, Creemers B, Ollevier F Development and evaluation of a Taqman duplex real-time PCR quantification method for reliable enumeration of Legionella pneumophila in water samples J. Microbiol. Methods, 68 (2007), pp. 137–144, 10.1016/j.mimet.2006.07.002 [DOI] [PubMed] [Google Scholar]
  5. Berdal et al. , 1979Berdal BP, Farshy CE, Feeley JC Detection of Legionella pneumophila antigen in urine by enzyme-linked immunospecific assay J. Clin. Microbiol, 9 (1979), pp. 575–578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bergey, 2012Bergey DH Bergey’s Manual of Systematic Bacteriology (2nd ed.), vol. 5, Springer-Verlag, New York, NY: (2012) [Google Scholar]
  7. Bonetta et al. , 2010Bonetta S, Bonetta S, Ferretti E, Balocco F, Carraro E Evaluation of Legionella pneumophila contamination in Italian hotel water systems by quantitative real-time PCR and culture methods J. Appl. Microbiol, 108 (2010), pp. 1576–1583, 10.1111/j.1365-2672.2009.04553.x [DOI] [PubMed] [Google Scholar]
  8. Bopp et al. , 1981Bopp CA, Sumner JW, Morris GK, Wells JG Isolation of Legionella spp. from environmental water samples by low-pH treatment and use of a selective medium J. Clin. Microbiol, 13 (1981), pp. 714–719 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Buse et al. , 2019Buse HY, JM B, Struewing IT, Szabo JG Chlorine and monochloramine disinfection of Legionella pneumophila colonizing copper and polyvinyl chloride drinking water biofilms Appl. Environ. Microbiol, 85 (2019), 10.1128/AEM.02956-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Collier, 2012Collier SA, Stockman LJ, Hicks LA, Garrison LE, Zhou FJ, Beach MJ Direct healthcare costs of selected diseases primarily or partially transmitted by water Epidemiol. Infect, 140 (2012), pp. 2003–20013, 10.1017/S0950268811002858 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Collins et al. , 2015Collins S, Jorgensen F, Willis C, Walker J Real-time PCR to supplement gold-standard culture-based detection of Legionella in environmental samples J. Appl. Microbiol, 119 (2015), pp. 1158–1169, 10.1111/jam.12911 [DOI] [PubMed] [Google Scholar]
  12. Collins et al. , 2017Collins S, Stevenson D, Walker J, Bennett A Evaluation of Legionella real-time PCR against traditional culture for routine and public health testing of water samples J. Appl. Microbiol, 122 (2017), pp. 1692–1703, 10.1111/jam.13461 [DOI] [PubMed] [Google Scholar]
  13. Dilger et al. , 2016Dilger T, Melzl H, Gessner A Rapid and reliable identification of waterborne Legionella species by MALDI-TOF mass spectrometry J. Microbiol. Methods, 127 (2016), pp. 154–159, 10.1016/j.mimet.2016.05.028 [DOI] [PubMed] [Google Scholar]
  14. Donohue et al. , 2014Donohue MJ, O’Connell K, Vesper SJ, Mistry JH, King D, Kostich M, et al. Widespread molecular detection of Legionella pneumophila Serogroup 1 in cold water taps across the United States Environ. Sci. Technol, 48 (2014), pp. 3145–3152, 10.1021/es4055115 [DOI] [PubMed] [Google Scholar]
  15. Donohue et al. , 2019aDonohue MJ, King D, Pfaller S, Mistry JH The sporadic nature of Legionella pneumophila, Legionella pneumophila Sg1 and Mycobacterium avium occurrence within residences and office buildings across 36 states in the United States J. Appl. Microbiol, 126 (2019), pp. 1568–1579, 10.1111/jam.14196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Donohue et al. , 2019bDonohue MJ, Vesper S, Mistry J, Donohue JM Impact of chlorine and chloramine on the detection and quantification of Legionella pneumophila and Mycobacterium species Appl. Environ. Microbiol, 85 (2019), 10.1128/AEM.01942-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Duda et al. , 2015Duda S, Baron JL, Wagener MM, Vidic RD, Stout JE Lack of correlation between Legionella colonization and microbial population quantification using heterotrophic plate count and adenosine triphosphate bioluminescence measurement Environ. Monit. Assess, 187 (2015), p. 393, 10.1007/s10661-015-4612-5 [DOI] [PubMed] [Google Scholar]
  18. Fraser et al. , 1977Fraser DW, Tsai TR, Orenstein W, Parkin WE, Beecham HJ, Sharrar RG, et al. Legionnaires’ disease: description of an epidemic of pneumonia N. Engl. J. Med, 297 (1977), pp. 1189–1197, 10.1056/NEJM197712012972201 [DOI] [PubMed] [Google Scholar]
  19. Hicks et al. , 2012Hicks LA, Garrison LE, Nelson GE, Hampton LM Legionellosis—United States, 2000–2009 Am. J. Transplant, 12 (2012), pp. 250–253, 10.1111/j.1600-6143.2011.03938.x [DOI] [PubMed] [Google Scholar]
  20. ISO, 2017 ISO ISO 11731: Water Quality-Detection and Enumeration of Legionella International Organization for Standardization (ISO), Geneva, Switerland: (2017) [Google Scholar]
  21. Joly et al. , 2006Joly P, Falconnet PA, Andre J, Weill N, Reyrolle M, Vandenesch F, et al. Quantitative real-time Legionella PCR for environmental water samples: data interpretation Appl. Environ. Microbiol, 72 (2006), pp. 2801–2808, 10.1128/AEM.72.4.2801-2808.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. King et al. , 2016King DN, Donohue MJ, Vesper SJ, Villegas EN, Ware MW, Vogel ME, et al. Microbial pathogens in source and treated waters from drinking water treatment plants in the United States and implications for human health Sci. Total Environ, 562 (2016), pp. 987–995, 10.1016/j.scitotenv.2016.03.214 [DOI] [PubMed] [Google Scholar]
  23. Kuchta et al. , 1983Kuchta JM, States SJ, McNamara AM, Wadowsky RM, Yee RB Susceptibility of Legionella pneumophila to chlorine in tap water Appl. Environ. Microbiol, 46 (1983), pp. 1134–1139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kwok et al. , 2018Kwok MK, Lin SL, Schooling CM Re-thinking Alzheimer’s disease therapeutic targets using gene-based tests EBioMedicine, 37 (2018), pp. 461–470, 10.1016/j.ebiom.2018.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kyritsi et al. , 2018Kyritsi MA, Mouchtouri VA, Katsioulis A, Kostara E, Nakoulas V, Hatzinikou M, et al. Legionella colonization of hotel water systems in touristic Places of Greece: association with system characteristics and physicochemical parameters Int. J. Environ. Res. Public Health, 15 (2018), 10.3390/ijerph15122707 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. LaBauve and Wargo, 2012. LaBauve AE, Wargo MJ Growth and laboratory maintenance of Pseudomonas aeruginosa Curr. Protoc. Microbiol (2012), 10.1002/9780471729259.mc06e01s25 (Chapter 6: Unit 6E 1) [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee et al. , 1993Lee TC, Vickers RM, Yu VL, Wagener MM Growth of 28 Legionella species on selective culture media: a comparative study J. Clin. Microbiol, 31 (1993), pp. 2764–2768 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee et al. , 2002Lee JV, Surman SB, Hall M, Cuthbert L Development of an international EQA scheme for the isolation of Legionella spp. from environmental specimens [Google Scholar]
  29. Marre R, Abu Kwaik Y, Bartlett CL, Cianciotto NP, Fields S, Frosch M, et al. (Eds.), Legionella, ASM Press, Washington DC: (2002), pp. 271–274 [Google Scholar]
  30. Mahdi et al. , 2014Mahdi O, Eklund B, Fisher N Laboratory culture and maintenance of Stenotrophomonas maltophilia Curr. Protoc. Microbiol, 32 (2014), 10.1002/9780471729259.mc06f01s32 (Unit 6F 1) [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Maze et al. , 2014Maze MJ, Slow S, Cumins AM, Boon K, Goulter P, Podmore RG, et al. Enhanced detection of Legionnaires’ disease by PCR testing of induced sputum and throat swabs Eur. Respir. J, 43 (2014), pp. 644–646, 10.1183/09031936.00191913 [DOI] [PubMed] [Google Scholar]
  32. McCabe et al. , 1970McCabe LJ, Symons JM, Lee RD, Robeck GG Survey of community water supply systems J. AWWA, 62 (1970), pp. 670–687 [Google Scholar]
  33. Merault et al. , 2011Merault N, Rusniok C, Jarraud S, Gomez-Valero L, Cazalet C, Marin M, et al. Specific real-time PCR for simultaneous detection and identification of Legionella pneumophila serogroup 1 in water and clinical samples Appl. Environ. Microbiol, 77 (2011), pp. 1708–1717, 10.1128/AEM.02261-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Murdoch et al. , 2013Murdoch DR, Podmore RG, Anderson TP, Barratt K, Maze MJ, French KE, et al. Impact of routine systematic polymerase chain reaction testing on case finding for Legionnaires’ disease: a pre-post comparison study Clin. Infect. Dis, 57 (2013), pp. 1275–1281, 10.1093/cid/cit504 [DOI] [PubMed] [Google Scholar]
  35. Ristroph et al. , 1981Ristroph JD, Hedlund KW, Gowda S Chemically defined medium for Legionella pneumophila growth J. Clin. Microbiol, 13 (1981), pp. 115–119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rowbotham, 1980Rowbotham TJ Preliminary report on the pathogenicity of Legionella pneumophila for freshwater and soil amoebae J. Clin. Pathol, 33 (1980), pp. 1179–1183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Schwake et al. , 2016Schwake DO, Garner E, Storm RO, Pruden A, Edwards MA Legionella DNA markers in tap water coincident with a spike in legionnaires disease in Flint, MI Environ. Sci. Technol. Lett, 3 (2016), pp. 311–315, 10.1021/acs.estlett.6b00192 [DOI] [Google Scholar]
  38. Siracusano et al. , 2020Siracusano S, Rizzetto R, Porcaro AB Bladder cancer genomics Urologia, 87 (2) (2020), pp. 49–56, 10.1177/0391560319899011 [DOI] [PubMed] [Google Scholar]
  39. Stout et al. , 1992Stout JE, Yu VL, Muraca P, Joly J, Troup N, Tompkins LS Potable water as a cause of sporadic cases of community-acquired legionnaires’ disease N. Engl. J. Med, 326 (1992), pp. 151–155, 10.1056/NEJM199201163260302 [DOI] [PubMed] [Google Scholar]
  40. Tilton, 1979Tilton RC Legionnaires’ disease antigen detected by enzyme-linked immunosorbent assay Ann. Intern. Med, 90 (1979), pp. 697–698, 10.7326/0003-4819-90-4-697 [DOI] [PubMed] [Google Scholar]
  41. US EPA, 1994US EPA National Primary Drinking Water Regulations: Disinfectants and Disinfection Byproducts United States Environmental Protection Agency, Washington DC: (1994), pp. 38668–38829 [Google Scholar]
  42. US EPA, 2006US EPA Long term 2 enhanced surface water treatment rule. 71 Fed. Regist. (2006), pp. 654–786 [Google Scholar]
  43. Wang et al. , 2012Wang H, Edwards M, Falkinham JO 3rd, Pruden A Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba hosts in two chloraminated drinking water distribution systems Appl. Environ. Microbiol, 78 (2012), pp. 6285–6294, 10.1128/AEM.01492-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Warren and Miller, 1979 Warren WJ, Miller RD Growth of Legionnaires disease bacterium (Legionella pneumophila) in chemically defined medium J. Clin. Microbiol, 10 (1979), pp. 50–55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wellinghausen et al. , 2001Wellinghausen N, Frost C, Marre R Detection of legionellae in hospital water samples by quantitative real-time LightCycler PCR Appl. Environ. Microbiol, 67 (2001), pp. 3985–3993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Whiley and Taylor, 2016 Whiley H, Taylor M Legionella detection by culture and qPCR: comparing apples and oranges Crit. Rev. Microbiol, 42 (2016), pp. 65–74, 10.3109/1040841X.2014.885930 [DOI] [PubMed] [Google Scholar]
  47. WHO, 2007WHO Legionella and the Prevention of Legionellosis World Health Organization; (2007) [Google Scholar]
  48. Wullings and van der Kooij, 2006 Wullings BA, van D der Kooij Occurrence and genetic diversity of uncultured Legionella spp. in drinking water treated at temperatures below 15 degrees C Appl. Environ. Microbiol, 72 (2006), pp. 157–166, 10.1128/AEM.72.1.157-166.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yanez et al. , 2005Yanez MA, Carrasco-Serrano C, Barbera VM, Catalan V Quantitative detection of Legionella pneumophila in water samples by immunomagnetic purification and real-time PCR amplification of the dotA gene Appl. Environ. Microbiol, 71 (2005), pp. 3433–3441, 10.1128/AEM.71.7.3433-3441.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES