Mitochondrial epileptic encephalopathy, 3-methylglutaconic aciduria and variable complex V deficiency associated with TIMM50 mutations

Abstract

Mitochondrial encephalopathies are a heterogeneous group of disorders that, usually carry grave prognosis. Recently a homozygous mutation, Gly372Ser, in the TIMM50 gene, was reported in an abstract form, in three sibs who suffered from intractable epilepsy and developmental delay accompanied by 3-methylglutaconic aciduria.

We now report on four patients from two unrelated families who presented with severe intellectual disability and seizure disorder, accompanied by slightly elevated lactate level, 3-methylglutaconic aciduria and variable deficiency of mitochondrial complex V. Using exome analysis we identified two homozygous missense mutations, Arg217Trp and Thr252Met, in the TIMM50 gene. The TIMM50 protein is a subunit of TIM23 complex, the mitochondrial import machinery. It serves as the major receptor in the intermembrane space, binding to proteins which cross the mitochondrial inner membrane on their way to the matrix. The mutations, which affected evolutionary conserved residues and segregated with the disease in the families, were neither present in large cohorts of control exome analyses nor in our ethnic specific exome cohort. Given the phenotypic similarity, we conclude that missense mutations in TIMM50 are likely manifesting by severe intellectual disability and epilepsy accompanied by 3-methylglutaconic aciduria and variable mitochondrial complex V deficiency. 3-methylglutaconic aciduria is emerging as an important biomarker for mitochondrial dysfunction, in particular for mitochondrial membrane defects.

Mitochondrial encephalopathies are a heterogeneous group of disorders, with variable onset, course and severity. Most arise from defects in one or several mitochondrial respiratory chain enzymatic complexes; given the bi-genomic origin of the mitochondrial respiratory chain, the mutated gene could be part of the mitochondrial or the nuclear DNA. Isolated complex V deficiency may thus arise from mutations in mitochondrial encoded MT-ATP6 and MT-ATP8 or from mutations in nuclear encoded subunits (1, 2). Most reported patients with isolated, nuclear encoded, complex V deficiency suffer from mutations in TMEM70 (3). These infants present with faltering growth, psychomotor delay, hypotonia, microcephaly, and cardiomyopathy, accompanied by intermittent lactic acidosis and 3-methylglutaconic aciduria (3MGA).

We report the results of the genomic investigation of a new form of epileptic encephalopathy with 3MGA and variable complex V deficiency in four patients originating from two unrelated families.

Patients

Family A

Patient A-II-1 (Fig. 1a) was the first son of consanguineous parents of Bedouin origin, who presented with infantile spasms, severe developmental delay, and severe hypotonia. He was born at term following an uneventful pregnancy with a birth weight of 2860 g and head circumference of 32 cm. Early stages of development were reportedly normal but at 3 months of age generalized hypotonia and involuntary abnormal movements were noted. At 4 months EEG revealed hypsarrhythmia; therapy with ACTH was initiated with favorable response; treatment was later changed to Sabril followed by the addition of valproate, maintaining him seizure-free from 7 months of age with normalization of the EEG at 10 months. Developmental delay was already noted at 8 months, and the patient was markedly hypotonic with head lag; however, he eventually walked independently at 3 years. At 7 years he was noted of having failure to thrive (weight 15.5 kg, first percentile, height 110 cm, first percentile, head circumference 49 cm) at that age he could climb stairs and run and was toilet trained at day time. His comprehension, however, remained poor and in addition his speech consisted of only few words and he communicated by simple gestures. Visual tracking was initially delayed and electroretinogram (ERG) and visual evoked potential (VEP) at 14 months were abnormal. Repeated examination at 7 years revealed bilateral optic atrophy. Brain imaging at 4 and 15 months disclosed progressive bilateral widening of the lateral and third ventricles, consistent with brain atrophy. Laboratory investigation at 27 months revealed slightly elevated plasma lactate (2.4 mM, control <2.1) and urinary 3MGA.

Fig. 1.

(a, b) Family pedigree of the two families, patients suffering from intellectual disability and 3MGA are represented by filled symbols. The genotype of the variants p.Thr252Met and p.Arg217Trp in the TIMM50 gene is given. (c, d) Sequence around the site of the variants p.Thr252Met (C) and p.Arg217Trp (d) in affected (upper panel), obligatory heterozygote (middle) and an unrelated healthy individual (lower panel). (e) Evolutionary conservation at and around TIMM50 variants p.Arg217Trp (left panel) and p.Thr252Met (right panel); the mutated residues are marked in red.

Patient A-II-3 was a female, the third child in family A. The pregnancy was uneventful and she was born at term with a birth weight of 3020 g. Similar to her brother, she presented at 4 months with abnormal movements and hypsarrhythmia by EEG and was treated with ACTH that was later replaced by Topamax and valproate which led to disappearance of the abnormal movements. Yet the EEG remained abnormal. She had delayed global development and started walking independently only at 3 years (partly because of bilateral acetabular dysplasia which was noted only at 2 years and treated with casts). At 6 years she had failure to thrive (weight 17 kg, seventh percentile, height 107 cm, fourth percentile, head circumference 48 cm), was not toilet trained, had few words and her comprehension was that of a 1-year-old. At 9 years she was profoundly retarded, aggressive and restless and there was total lack of communication.

Ophthalmological examination initially revealed that her fundi were normal at age 2; at 9 years, however, there was bilateral optic atrophy of moderate severity. Initial brain imaging at 4 months disclosed bilateral widening of the lateral ventricles; at 8 years there was an abnormal signal at the cerebral crus, inferior colliculi and cerebellar peduncles (Fig. 2a,b).

Fig. 2.

Brain MRI. (a, b) imaging of patient A-II-3 at 8 years, black arrows indicate abnormal signal at the cerebellar peduncle. (c–e) Imaging of patient B-II-3 at 10 years showing enlarged ventricles with relative paucity of periventricular white matter with bilateral lenticular nuclei increased T2-signal (c), low T1-signal (d) and restricted diffusion (e) indicted by the white arrows. Similar changes are noted at the left head of the caudate.

Laboratory investigation at 4 months revealed slightly elevated plasma lactate (2.6 mM, control <2.1) and 3MGA. The enzymatic activities of the mitochondrial respiratory chain complexes I–V in mitochondria obtained from fresh muscle at 2 years of age, were essentially normal also when normalized to citrate synthase (a mitochondrial control enzyme).

The other children in family A were healthy; the sixth pregnancy was terminated at gestational week 32 because of a cardiac single ventricle and hypoplastic aorta. At the time of writing the mother was at her eighth pregnancy.

Family B

Patient B-II-2 was a male, the second child to first cousin parents of Muslim origin (Fig. 1b). He was born at term after an uneventful pregnancy and his birth weight was 3.200 kg. The neonatal period was reportedly normal but at 3 months of age myoclonic jerks were noted and EEG was interpreted as abnormal; he was given Depalept and Lamictal which controlled the myoclonus. His psychomotor development was delayed and at 15 years, at the time of examination, he could walk and climb stairs but was unable to feed himself with spoon, to undress or draw a circle. He had 10 words but no sentences, obeyed simple commands and was able to recognize body parts; he was hyperactive and behaved aggressively when frightened. His head circumference was 45 cm.

Brain MRI at age 7 years disclosed mild atrophic changes and dilatation of lateral ventricles. Laboratory investigation including plasma ammonia, lactate, acyl-carnitines and amino acids were normal but CSF lactate was elevated to 4.8 mM (N < 2.8 mM). Urinary organic acid analysis disclosed 3MGA.

Patient B-II-3 was a female, the third child in the family. She was born term, after an uneventful pregnancy, by cesarean section due to prolonged labor. The birth weight was 2700 g and the postnatal course was unremarkable. At 2 months of age she had generalized tonic movements of the upper and lower limbs and uprolling of the eyes. EEG disclosed depressed background activity without abnormal epileptic activity. The patient was started on Valproate and Lamictal and responded favorably. Nonetheless, her psychomotor development was markedly delayed; she sat at 2 years, and stood with support only at 7 years. At 10 years she was still not toilet trained, had no communication but heard well and recognized family members; she shouted and behaved aggressively when frightened. She fed well on soft foods but failed to thrive and looked cachectic with severely reduced muscle mass (weight 17.8 kg, −4.15 SD, height 114 cm, −3.8 SD and head circumference 46 cm). Her muscle tone was globally increased, the tendon reflexes were hyperactive and there was an overt clonus in the upper and lower limbs.

At 10 years fundoscopic examination and echocardiography were normal.

Brain MRI at 3 years disclosed mild generalized atrophy and at 10 years supratentorial atrophy, mainly of the white matter and symmetrical abnormally high T2/low T1 signal intensity in the lentiform nuclei bilaterally (Fig. 2c–e).

Routine laboratory investigations including lactate, creatine phosphokinase (CPK), liver transaminases and plasma amino acids were normal, and urinary organic acid analysis revealed 3MGA.

The activities of the enzymatic complexes of the mitochondrial respiratory chain were determined in isolated mitochondria from frozen muscle of patient B-II-3 obtained at 7 years of age. This study disclosed normal activities of complex I–IV whereas the activity of complex V (measured as oligomycin sensitive Mg²⁺ATPase in the presence of dinitrophenol) was reduced to 54% of the control mean normalized to citrate synthase activity.

Methods

Homozygosity mapping

For family A, SNP genotyping was performed on genomic DNA of all members of family A, except A-II-2 and A-II-6 whose DNA were not available, using the Human OmniExpressExome 8V1 DNA Analysis Bead-Chip (Illumina, San Diego, CA) and analyzed using GenomeStudio software (Illumina, San Diego, CA).

Whole exome analysis

For family A the TruSeqV2 (Illumina) that employed 101-bp paired-end read sequencing was used. Image analysis and base calling were performed using Illumina Genome Analyzer Pipeline software (versions 1.13.48.0) with default parameters. Reads were aligned to a human reference sequence (UCSC assembly hg19, NCBI build 37) using a package called Efficient Large-scale Alignment of Nucleotide Databases (Illumina). Genotypes were called at all positions where there were high-quality sequence bases using a Bayesian algorithm called the Most Probable Genotype (4) and variants were filtered using the graphical software tool VarSifter v1.5 (5). The database dbSNP covers the 1.22% of the human genome corresponding to the Consensus Conserved Domain Sequences and more than 1000 non-coding RNAs (6).

For patient B-II-2 exonic sequences were enriched in his DNA sample using SureSelect Human All Exon 50 Mb Kit V4 (Agilent Technologies, Santa Clara, CA). Sequences were determined by HiSeq2000 (Illumina) as 100-bp paired-end runs. Data analysis including read alignment and variant calling was performed by DNAnexus software (Palo Alto, CA, USA) using the default parameters with the human genome assembly hg19 (GRCh37) as reference. Parental consent was given for DNA studies. The study was performed with the approval of the ethical committees of Hadassah Medical Center and the Ministry of Health.

Modeling the mutation in yeast

Arg159 in the Saccharomyces cerevisiae Tim50 (Gene ID: 856042), corresponding to amino acid Arg217 in humans, was exchanged to Trp, generating Arg159Trp (R159W), according to the protocol of Agilent technologies (QuikChange Site-Directed Mutagenesis), using forward primer 5'CACTTATGTATAAATGGTTCAA GGCCAGGTTC3' and reverse primer 5'GAACCTGGC CTTGAACCATTTATACATAAGTG3'. PCR products were digested with BamHI and HindIII and ligated into a pRS315 vector containing the presequence of Tim50, its endogenous promoter and 3'UTR (7) that was digested with the same restriction enzymes as well. Yeast strain YPH499, described in (8) was transformed with plasmids encoding either Tim50 wild-type (WT) or the R159W mutated Tim50. Transformants were selected on media containing 5-fluoroorotic acid. For growth analysis, yeast cells were grown on synthetic media lacking leucine, containing 2% glucose [SCD (–LEU)] or in synthetic media containing 3% glycerol (SCG).

Hsp60 import in yeast

A 5 ml yeast culture was grown in SCD (–Leu) at 30°Cto mid-log phase and shifted to 37°C for 8 h. One milliliter of the culture was pelleted by centrifugation at 800 g for 5 min. Total cell extracts were prepared by alkaline lysis. Proteins were separated using SDS-PAGE followed by immunoblot with antibodies against Hsp60. Blots were visualized by the Odyssey Infrared Imaging System (LI-COR, Lincoln, NE). Cells expressing Tim50 wt or an unpublished temperature sensitive (ts) mutant, were used as controls.

Results

Analysis of SNP arrays in Family A identified regions of homozygosity in all family members (Table S1, Supporting information). One such region (~2.3 MB), found on chromosome 19 (hg19), was shared by A-II-1 and A-II-3. Whole exome analysis on both parents and both affected children in this family revealed ~50,000 variants per sample in candidate regions; 361 variants were homozygous recessive and 41 affected protein function. Of the remaining 41 variants, three had mean allele frequency of less than 1%, and included IGFLR1 [NM_024660.2:c.456dup; p.(Val153Cysfs*104)], ZFP30 [NM_014898.2:c.1421C> G;p.(Ala474Gly)], and TIMM50 [NM_001001563.1:c.C755T: p.(Thr252Met)]. IGFLR1 was associated with inflammatory skin conditions (PMID: 21454693) and ZFP30 was identified to be a regulator of neutrophilic airway inflammation (PMID: 25114278). Since A-II-1 and A-II-3 had biochemical evidence of 3-MGA, a known mitochondrial marker (9), the likely candidate was TIMM50. Further analysis of the DNA of A-II-8, revealed that the fetus is homozygous for the c.C755T variant.

Exome analysis of patient B-II-2 yielded 38.3 million mapped reads with a mean coverage of ×67. Following alignment to the reference genome (Hg19) and variant calling, we performed a series of filtering steps under the hypothesis of a recessively inherited, homozygous, rare, causal allele. These included removing variants which were called less than ×8, were off-target, heterozygous, synonymous, on the X chromosome, had MAF>1% at ExAC [Exome Aggregation Consortium, Cambridge, MA, (URL: http://exac.broadinstitute.org)] or MAF > 4% at the Hadassah in-house database. Twenty-three variants remained (Table S2), but we focused on hg19 chr19:g.39976210C > T, NM_001001563.1:c.C649T:p.(Arg217Trp) in TIMM50 because it was the only gene encoding a mitochondrial protein and because of the evolutionary conservation of the mutated residue (Fig. 1e). Furthermore, the variant segregated in the family (Fig. 1b,d), was not carried by any of the 60,700 individuals whose exome analyses were deposited at ExAC (accessed March 2016) and was not present in our in-house database (approximately 700 Moslem-Arab exome analyses).

Both c.649C > T and c.755C > T were predicted pathogenic by various prediction tools (Table S3). The mutated residues Arg217 and Thr252 are located in the mitochondrial intermembrane space and are predicted to alter protein folding (data not shown).

The S. cerevisiae Tim50 protein is a subunit of the mitochondrial presequence import machinery called the TIM23 complex. Tim50 serves as the major receptor in the intermembrane space that binds to proteins on their way to cross the mitochondrial inner membrane. The majority of its substrates are targeted to the matrix, but some are destined to the inner mitochondrial membrane or intermembrane space. Its function is essential for yeast viability; mutations that impair the Tim50 structure result in defective cell growth (10). Tim50 is an evolutionary conserved protein. Human TIMM50 and yeast Tim50 share 23% sequence identity and 44% similarity (11). We therefore performed a complementation study of the delta-Tim50 growth defect; nonetheless, despite this considerable homology, the human homologue failed to rescue delta-Tim50 growth defect (data not shown). Still, we examined the effect of R159W mutated Tim50, the yeast homologous substitution of the human p.Arg217Trp on yeast cell growth. As detailed in Methods, yeast cells expressing either the WT or mutant copy of Tim50 were grown on glucose and glycerol at 30°C and 35°C (Fig. 3a). Both strains displayed normal growth, indicating that this substitution, in contrast to humans, is tolerated in yeast cells and does not significantly impair the import function of Tim50 in this organism. We have also examined Hsp60 import in these strains; similar to many mitochondrial proteins, Hsp60 is translated in the cytosol as a precursor carrying an amino terminal mitochondrial targeting signal which is cleaved following its import into mitochondria to generate the mature form. When yeast cell lysates of a WT strain is run in SDS-PAGE, the mature form is the predominant band whereas the band representing the precursor form is hardly visible. However, when mitochondrial import is defective, the precursor form accumulates in the cytosol and becomes more prominent in the gel. As can be seen in Fig. 3b, in the WT strain the mature form is the prominent one; a similar distribution of the forms was detected in yeast cell lysates of the R159W strain.

Fig. 3.

(a) Growth analysis of the Tim50 R159W mutant. Serial dilutions of Tim50 WT or Tim50 R159W cells were grown for 5 days at the indicated temperature on SCD (–Leu) and SCG plates (b). Hsp60 import analysis in vivo. Tim50 WT and mutant cells were grown at 30°C to mid-log phase and shifted to 37°C for 8 h. Total cell extracts were prepared by alkaline lysis. Accumulation of the precursor form of Hsp60 was analyzed by SDS-PAGE and immunoblot with Hsp60 antibodies.

Discussion

We report on four patients who presented with severe intellectual disability and seizure disorder, accompanied by slightly elevated lactate level, 3MGA and variable deficiency of mitochondrial complex V. Using exome analysis we identified two homozygous missense mutations, Arg217Trp and Thr252Met, in the TIMM50 gene. The mutations segregated with the disease in the families, were neither present in large cohorts of control exome analyses nor in our ethnic specific exome cohort, and affected evolutionary conserved residues. Although we could not demonstrate the pathogenicity of the mutations in a yeast based system, we propose that they are disease causing. This assumption is not only supported by the bioinformatic considerations but also by the similar phenotype and presence of 3MGA in the four patients. Furthermore, a homozygous mutation, Gly372Ser, in the TIMM50 gene, was recently reported in three sibs who suffered from intractable epilepsy, microcephaly, developmental delay, visual deficit and spastic quadriplegia accompanied by 3MGA (12).

Mitochondrial preproteins with N-terminal presequences are imported by the general translocase of the outer membrane (TOM) complex and are then received in the intermembrane space (IMS) by Tim50, an essential member of the presequence translocase of the inner membrane (TIM23) complex (8, 13). Tim50 is the receptor subunit of the TIM23 complex that recognizes presequences upon their emergence from the TOM complex (14). The binding of Tim50 to the channel forming subunit Tim23 triggers closure of the channel in the absence of a substrate and hence prevents ion leakage across the inner membrane (15). The fact that the Arg217Trp orthologous mutation in yeast Tim50 did not affect yeast cell growth and Hsp60 import is not surprising. A profound decrease in the activity of Tim50 in yeast or humans will be lethal. A milder effect could still be tolerated by yeast but harmful to human brain.

3MGA is emerging as an important biomarker for mitochondrial dysfunction, specifically for mitochondrial membrane defects (9). Thus patients with TAZ mutations, manifesting by Barth syndrome (short stature, neutropenia, cardiomyopathy and 3MGA) suffer from a defect in the maturation of cardiolipin, the major mitochondrial membranes phospholipid (16). Patients with mutations in DNAJC19 are manifesting similarly (cardiomyopathy and 3MGA, with additional ataxia), likely because DNAJC19 regulate cardiolipin remodeling by the TAZ protein, tafazzin (17). Altered cardiolipin subspecies due to defective mitochondrial phospholipid metabolism are also found in patients with SERAC1 mutations, manifesting by encephalopathy, dystonia, deafness and 3MGA (18). Perturbation of the mitochondrial membranes by abnormal protein aggregates was proposed to account for the 3MGA in patients with CLPB mutations, manifesting by encephalopathy, cataract and neutropenia (19, 20). Fragmented mitochondrial network with disrupted mitochondrial morphology is likely secondary to inner membrane abnormality observed in fibroblasts of patients with OPA3 mutations and in the retina of OPA3 mutant mice (21, 22); patients with mutations in OPA3, which encodes an inner membrane mitochondrial protein, suffer from optic atrophy, cataract, spasticity and 3MGA (23, 24).

Exploiting the power of exome sequencing in patients originating from consanguineous families, we have recently identified deleterious mutations in the HTRA2 and QIL1 genes in patients with infantile encephalopathy, 3MGA and with mitochondria of abnormal size and shape with distorted cristae (25, 26). HTRA2 encodes a HTRA2/Omi, which participates in the mitochondrial quality control machinery and protects the cell from apoptosis, whereas QIL1/MIC13 is a constituent of MICOS, a six subunit complex which helps to form and stabilize cristae junctions within the mitochondria. The present report and the recent abstract of Serajee et al. (12) add TIMM50, a mitochondrial inner membrane protein, to the growing list of mitochondrial disorders accompanied by 3MGA.

Our findings support the importance of intact mitochondrial inner membrane for the normal function of the mitochondrial respiratory chain complexes; patients with TAZ or QIL1/MIC13 mutations have dysfunctional respiratory chain complexes (27). The link between TIMM50 mutation and deficiency of complex V in some of the patients is presently unclear. It was shown that the import of subunits 9 and ß of complex V in yeast is dependent on Tim50 (11). Whether it is a general impairment of the mitochondrial inner membrane inflicted by, for example, aggregation of non-imported preproteins in the IMS or failed transport of a specific preprotein, essential for complex V activity, is still a matter of conjecture.