Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2021 Jul 13;11(16):11216–11222. doi: 10.1002/ece3.7908

Pennisetum setaceum or Pennisetum advena cultivars, what ornamental do we have in our garden

Johannes Leonardus Cornelis Hendrikus van Valkenburg 1,✉, Maarten Costerus 2, Marcel Westenberg 1
PMCID: PMC8366894  PMID: 34429913

Abstract

Pennisetum Rich. or following recent taxonomic insights Cenchrus L. is a genus with some 120 species worldwide, especially in warm areas. The genus includes some crops, some ornamentals but mostly species that are considered weedy. The name of one of the weedy species Pennisetum setaceum (Forssk.) Chiov. is also found on labels of ornamental grasses as P. setaceum “Rubrum.” It has been debated to belong to a species on its own Pennisetum advena Wipff & Veldkamp or Cenchrus advena (Wipff & Veldkamp) Morrone, only known from cultivation, whereas others still adhere to a broader species concept of P. setaceum. The recent inclusion of P. setaceum on the EU List of Union concern has revitalized the discussion on this issue for commercial reasons. Based on a morphological and molecular comparison (ITS, rbcL, and the trnh‐psbA intergenic spacer sequences) of the type specimen of P. advena, five of its “cultivars” in trade and collections of P. setaceum from different regions of the world we conclude that plants currently in trade in Western Europe belong to a separate species P. advena. A drooping inflorescence is consistent as is the difference in width of the leaf blade, the leaf blade being flat or involute, the central vein being swollen or not, and the length of the stipe being 0.3–1.1 mm in P. advena and 1.1–3.1 mm in P. setaceum. On the chloroplast markers rbcL and trnH‐psbA, the species consistently differ in 2 and 4 base pairs, respectively. On the nuclear ITS sequence, there is only 90% overlap between the two species. This justifies these ornamentals to be excluded from the List of Union concern of EU regulation 1143/2014.

Keywords: Cenchrus, EU regulation 1043/2014, fountain grass, invasive plant, NGS

The proper identity of ornamental Pennisetum plants traded as “Rubrum” has been debated. The recent inclusion of Pennisetum setaceum on the EU list of Union concern has revitalized the discussion on this issue for commercial reasons. Based on a morphological and molecular comparison (ITS, rbcL, and the trnh‐psbA intergenic spacer sequences) of the type specimen of Pennisetum advena, five of its “cultivars” in trade and collections of P. setaceum from different regions of the world we conclude that plants currently in trade in Western Europe belong to a separate species P. advena.

graphic file with name ECE3-11-11216-g002.jpg

1. INTRODUCTION

Pennisetum Rich. or following recent taxonomic insights Cenchrus L. is a genus with some 120 species worldwide, especially in warm areas (Chemisquy et al., 2010; Kellogg, 2015). It includes some crops, some ornamentals but mostly species that are considered weedy. There has been or still is considerable confusion with respect to the proper identity of Pennisetum cultivars traded as, “Cherry Sparkler,” “Fireworks,” “Rubrum,” “Sky Rocket,” and “Summer Samba.”

It has been debated that these cultivars belong to a species of its own, Pennisetum advena Wipff and Veldkamp (1999) or Cenchrus advena (Wipff & Veldkamp, 1999) Morrone (Chemisquy et al., 2010; Veldkamp, 2014), only known from cultivation. However, others still adhere to a broader species concept of Pennisetum setaceum (Groom et al., 2017). Finally, there are those that interpret a discussion on relatedness as a proxy for a hybrid status (Meyer, 2012; Padhye et al., 2008). The recent inclusion of P. setaceum (Figure 1) on the List of Union concern of EU regulation 1143/2014 has revitalized the discussion on this issue for commercial reasons (see, e.g., the recommendation by Val’hor, 2017). Listing of a species on the List of Union concern implies that all its lower taxa or hybrids are potentially subject to the same rules and prohibitions, thus resulting in an effective ban on sale of these popular cultivars traded under the name of either P. setaceum or P. advena (Figure 2).

FIGURE 1.

FIGURE 1

Open in a new tab

Pennisetum setaceum as a weed in South Africa

FIGURE 2.

FIGURE 2

Open in a new tab

Pennisetum advena with characteristic drooping inflorescences in an urban garden (photographer Edu Boer)

Provisional molecular results pointing to a distinction in the aforementioned cultivars (Anonymous, 2017) have resulted in these taxa being provisionally excluded from the ban, while a more detailed morphological and molecular study is conducted. Results of this study are presented here.

2. METHODS

2.1. Acquisitions of plants

For a study of Pennisetum species and cultivars in trade in the Netherlands, a large number of living plants was acquired from commercial growers and garden centers and subsequently grown in a quarantine glasshouse (Costerus, 2018; Costerus & van Valkenburg, 2018). In addition, a total of 168 herbarium specimen from the National Herbarium at Leiden belonging to 10 Pennisetum species were consulted for descriptive purposes.

For the present detailed study, plants listed in Table 1 were used. Mother plants of the five major cultivars “Cherry Sparkler,” “Fireworks,” “Rubrum,” “Sky Rocket,” and “Summer Samba” were obtained from Henk de Jong (CNB Plants) (Valkenburg 3871, 3872, 3873, 3874, 3966). The type specimen of P. advena (Wipff 1723) and an African collection of P. setaceum (Mooney 9419) were consulted at Leiden (L, WAG). Naturalized P. setaceum plants were collected from the Canary Islands and in Catalonia, Spain (Simons 2006, Verloove 13345, 13647, 13650). Ornamental P. setaceum were collected in New Zealand (Valkenburg 3934) and cuttings of P. advena intercepted in a mislabeled commercial import from China (Valkenburg 4026).

TABLE 1.

Pennisetum specimen used in this study

Species Collection no. Year Country
P. advena Valkenburg 4026 2019 China
P. advena Wipff 1723 1990 USA
P. advena “Cherry Sparkler” Valkenburg 3874 2017 the Netherlands
P. advena “Fireworks” Valkenburg 3873 2017 the Netherlands
P. advena “Rubrum” Valkenburg 3966 2018 the Netherlands
P. advena “Sky Rocket” Valkenburg 3872 2017 the Netherlands
P. advena “Summer Samba” Valkenburg 3871 2017 the Netherlands
P. setaceum Mooney 9419 1962 Eritrea
P. setaceum Simons 2006 2017 Canary Islands (Spain)
P. setaceum Valkenburg 3934 2018 New Zealand
P. setaceum Verloove 13345 2018 Spain
P. setaceum Verloove 13647 2019 Spain
P. setaceum Verloove 13650 2019 Spain
Open in a new tab

2.2. Macromorphological approach

Of all living material height of the plant including inflorescence was measured, color of the stem, width, length and color of leaves; color and length of inflorescence; length of spikelet; texture of axis of inflorescence; length of stipe; number of spikelets per fascicle; and color, length and presence of long hairs on bristles. For all herbarium specimens, macromorphological measurements were similar. All measurements are used to build an interactive image‐driven key using LUCID software (Identic, Stafford Heights, Australia).

2.3. DNA extractions

Genomic DNA was isolated from approximately 100 mg plant material with the DNeasy Plant Mini Kit (Qiagen, Venlo, the Netherlands) using the TissueLyser procedure and eluted with 50 μl prewarmed (65°C) AE buffer. DNA was stored at −20°C until use.

2.4. PCR amplification and Sanger sequencing

PCRs for the chloroplast rbcL gene and trnH‐psbA intergenic spacer and nuclear ITS (partial 18S, ITS1, 5.8S, ITS2, partial 28S) loci were performed in 25 μl reaction mixes containing 200 nmol/L of either primers rbcL‐a F and rbcLa SI_Rev, trnH2, and psbAF or ITS5 and ITS4 (Table 2), respectively, 1 x MyFiTM Mix (Bio‐line, Taunton, USA) and 2 μl genomic DNA. The cycle conditions for rbcL and trnH‐psbA loci were as follows: 5 min at 95°C, followed by 5 cycles of 30 s at 94°C, 30 s at 45°C, 30 s at 72°C and 35 cycles of 30 s at 94°C, 30 s at 50°C, 30 s at 72°C and a final extension for 10 min at 72°C. The cycle condition for ITS locus was as follows: 5 min at 95°C, followed by 40 cycles of 30 s at 94°C, 30 s at 52°C, 100 s at 72°C, and a final extension for 10 min at 72°C.

TABLE 2.

Primers used in this study

loci Primer name Primer sequence Reference
rbcL rbcL‐a F ATGTCACCACAAACAGAGACTAAAGC Kress & Erickson, (2007)
rbcLa SI_Rev GTAAAATCAAGTCCACCRCG Kress et al. (2009)
trnH‐psbA trnH2 CGCGCATGGTGGATTCACAATCC Tate, (2002)
psbAF GTTATGCATGAACGTAATGCTC Sang et al. (1997)
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC White et al. (1990)
Open in a new tab

PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Venlo, the Netherlands) preceding bidirectional cycle sequencing with the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Bleiswijk, the Netherlands) using amplification primers as sequencing primers in separate reactions according to the manufacturer's instructions. Cycle sequence products were purified with the DyeEx 2.0 Spin Kit (Qiagen, Venlo, the Netherlands) and sequenced using a 3500 Genetic Analyzer (Thermo Fisher Scientific, Bleiswijk, the Netherlands). Consensus sequences were generated from an assembly with trace files from both Sanger sequencing runs in Geneious R10 (Biomatters Auckland, New Zealand). Amplification primer sequences were trimmed in the assembly, and when needed, additional trimming was performed to obtain high‐quality (PHRED >30) consensus sequences.

2.5. Illumina sequencing

Genomic DNA was Illumina sequenced (PE150) with the NextSeq 500 V2 platform with minimal 2 Gb output per sample. The NEBNext® Ultra DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, USA) was used to process the samples. Fragmentation of the DNA using the Bioruptor Pico (Diagenode, Liège, Belgium), ligation of sequencing adapters, and PCR amplification of the resulting product were performed according to the procedure described in the NEBNext Ultra DNA Library Prep Kit for Illumina Instruction Manual. Reads were reference assemble to the rbcL, trnH‐psbA spacer, and ITS sequences of a Pennisetum orientale specimen (NPPO‐NL 6148331) using CLC genomic workbench v10 (Qiagen) with default settings. Variants were detected by using the Basic Variant Detection tool in CLC genomic workbench v10 with default settings.

3. RESULTS

3.1. Macromorphological differences observed

The analysis of all living material and the herbarium collections of the wild samples and cultivars belonging to the 10 species can be found in Costerus (2018) and Costerus and van Valkenburg (2018). It has been reworked to an interactive image‐driven identification key using LUCID software and can be found at https://keys.lucidcentral.org/keys/v3/pennisetum/en/index.html.

For this paper, we focus on the distinguishing characters between P. advena and P. setaceum.

Most obvious morphological characters when judging its ornamental value are the culm of P. setaceum being rarely branched as opposed to P. advena and the inflorescence of the latter being flexuous and drooping as opposed to rigid in P. setaceum. Both characters are added to the attractiveness of the species. Leaf characters in addition to the color of P. setaceum never being purplish are the consistently larger width and flatness of the blade in P. advena as well as the more prominent thickened central vein and involute leaf in P. setaceum. These character differences also apply to the ornamental P. setaceum collected in New Zealand. More detailed measurements on the inflorescence and leaves of P. setaceum. P. advena and cultivars are given in Table 3 with the values as published for both species (Veldkamp, 2014) for comparison.

TABLE 3.

Distinguishing macromorphological characters of the type specimen of Pennisetum advena (J.K. Wipff 1723 L), the five cultivars “Cherry Sparkler” (Valkenburg 3874), “Fireworks” (Valkenburg 3873), “Rubrum” (Valkenburg 3966), “Sky Rocket” (Valkenburg 3872), and “Summer Samba” (Valkenburg 3871), P. setaceum culta in New Zealand (Valkenburg 3934) and values for both species in Veldkamp (2014)

P. advena Cherry Sparkler Fireworks Rubrum Sky Rocket Summer Samba P. setaceum P. advena (Veldkamp) P. setaceum (Veldkamp)
Wipff 1723 Valkenburg 3874 Valkenburg 3873 Valkenburg 3966 Valkenburg 3872 Valkenburg 3871 Valkenburg 3934
Leaf width (mm) 7–9 4–6.5 3–8.5 2–4 3–5.5 4–6 1–2 6–11 1–3.7
Leaf length (cm) 50 36–42 28–49 20–46 20–41 31–44 15–27 22–52 30–100
Leaf color Green, purple Green, purple, white Green, purple, white Green, purple Green, white Green, purple, white Green Green, purple, Green
Length of inflorescence (cm) 21–27 21 16–23 15–22 17–18 18–22 17 22–32 10–26
Length of fascicle (mm) 5.2–5.8 4–5 4–6 3–5 4–6.5 4–5 5.5–6.2 5.2–6.5 4.7–6.8
Length of stipe (mm) 0.44–0.82 0.6–0.9 0.3–0.6 0.4–0.5 0.7–1.0 0.4–0.5 1.7–1.8 0.5–1.1 1–3
Length of longest bristle (mm) 30–37 23–32 22–29 25–33 22–34 25–33 28–32 21–33.5 28–32
Open in a new tab

3.2. Sequence analysis

The results of the sequence analysis for the chloroplast rbcL gene and trnH‐psbA intergenic spacer as well as for the nuclear ITS (partial 18S, ITS1, 5.8S, ITS2, partial 28S) sequence are summarized in Table 4. Based on the rbcL and trnH‐psbA sequences, P. advena and P. setaceum can be distinguished from each other. For rbcL, there are two nucleotide (nt) differences, and for trnH‐psbA region, there are four nt differences between P. advena and P. setaceum. All five cultivars could be matched to the type specimen of P. advena. Interestingly, the trnH‐psbA region of P. setaceum sample “Simons 2006” could not be bidirectionally sequenced by Sanger technology. Illumina sequence data revealed that this problem was caused by the presence of two different variants with a single indel. Each of these variants was present in equal amounts.

TABLE 4.

Sequencing results of the rbcL, trnh‐psbA, and ITS loci for the Pennisetum specimen

Species collection no. Sequencing rbcL trnH‐psbA ITS
P. advena Valkenburg 4026 S1 a3 a aI7, aII8
P. advena Wipff 1723 S, I2 a a aI, aII
“Cherry Sparkler” Valkenburg 3874 S, I a a aI, aII, sI
“Fireworks” Valkenburg 3873 S, I a a aI, aII
“Rubrum” Valkenburg 3966 S, I a a aI, aII
“Sky Rocket” Valkenburg 3872 S, I a a aI, aII, sI
“Summer Samba” Valkenburg 3871 S, I a a aI, aII
P. setaceum Mooney 9419 I s4 s sI, sII
P. setaceum Simons 2006 S, I s sI5, sII6 sI, sII
P. setaceum Valkenburg 3934 S s s sI, sII
P. setaceum Verloove 13345 S s s sI, sII
P. setaceum Verloove 13647 S s s sI, sII
P. setaceum Verloove 13650 S s s sI, sII
Open in a new tab
1

S = Sanger sequencing.

2

I = Illumina sequencing.

3

a = Pennisetum advena sequence.

4

s = Pennisetum setaceum sequence.

5

sI = Pennisetum setaceum variant I sequence.

6

sI = Pennisetum setaceum variant II sequence.

7

aI = Pennisetum advena variant I sequence.

8

aII = Pennisetum advena variant II sequence.

Sanger sequencing of the ITS region revealed the presence of SNPs in both P. advena (n = 3) and P. setaceum (n = 2) specimens. Illumina sequencing revealed that in each of the specimens, two variants of the ITS sequence were present. For P. advena, the ratio between these two variants was for each specimen approximately 55% for variant aI and 45% for variant aII. For P. setaceum sample “Simons 2006,” the ratio between variants sI and sII was approximately 70% and 30%, while for P. setaceum sample “Mooney 9419,” this was the other way around (30% sI and 70% sII). Nevertheless, P. advena and P. setaceum could be distinguished based on their ITS sequences as they are only 90% identical. The cultivars “Fireworks,” “Rubrum,” and “Summer Samba” contained both variants I and II of the P. advena ITS sequences. Based on all three loci (rbcL, trnH‐psbA, and ITS), these three cultivars could therefore be matched to P. advena.

The ITS sequences of the cultivars “Cherry Sparkler” and “Sky Rocket” could not be obtained by Sanger sequencing. Illumina sequencing of these cultivars revealed that both cultivars contained ITS variants I and II of P. advena (aI and aII) and variant I of P. setaceum (sI). For “Cherry Sparkler,” the ratio between the different variants was approx. 45% (aI), 15% (aII), and 40% (sI) and for “Sky Rocket” 20% (aI), 50% (aII), and 30% (sI).

4. DISCUSSION

From a scientific point of view, the above‐mentioned Pennisetum advena and P. setaceum should be addressed as Cenchrus species, following recent molecular and phylogenetic studies on the genera Cenchrus and Pennisetum (Chemisquy et al., 2010; Donadio et al., 2009). Numerous publications have already made the new necessary combinations for the American (Chemisquy et al., 2010), European (Verloove, 2012; Verloove et al., 2014), Southeast Asian (Veldkamp, 2014), Australian (Symon, 2010), and Pacific species (Tornabene & Wagner, 2013). However, as the ornamental plant trade is rather conservative, we have retained the old Pennisetum names for P. advena and P. setaceum and the other common ornamentals P. orientale and especially P. alopecuroides both represented by numerous cultivars in trade. Likewise, the name Pennisetum has been retained on the EU List of Union concern based on the risk assessment by Danas and Verloove (2015).

Although the exact origin of the ornamental plants commonly referred as P. setaceum “Rubrum” is unclear, apart from it being Old World, its introduction in the United States in 1916 is well documented as well as the quest for a valid name for the species. For an elaborate discussion, see Wipff and Veldkamp (1999).

Confusion on hybrid status goes back to Padhye et al. (2008) who somehow misinterpreted the Wipff and Veldkamp (1999) discussion on the origins of P. advena. This misinterpretation was later repeated by Meyer (2012) and has been adopted by numerous people who apparently failed to verify this in the original publication by Wipff and Veldkamp (1999). This view has been expressed already by Melanie Schori from USDA (pers. comm. 2017) in response to questions raised by European umbrella organizations of plant growers to the Community Plant Variety Office, following listing of P. setaceum on the List of Union concern.

Descriptions of some of the patented cultivars such as “Fireworks,” “Cherry Sparkler,” and “Sky Rocket” can be found online as it applies to the United States. Within a European context, as a different legislation applies reference can be made to the website of the Community Plant Variety Office (https://cpvoextranet.cpvo.europa.eu/mypvr/#!/en/publicsearch). Descriptive aspects and a comprehensive bibliography of relevant cultivars are already dealt with in the recommendation for Pennisetum by Val’Hor (2017) and by Costerus (2018).

Distinguishing morphological characters for P. advena have been elaborately discussed by Wipff and Veldkamp (1999). Some refinements resulting from our study can be added. Branching in aerial nodes does sometimes occur in P. setaceum as observed in cultivated plant in New Zealand (Valkenburg 3934) and wild plants in Ethiopia (P.C.M. Jansen 3946). Drooping inflorescence is consistent as is the difference in width of the leaf blade, the leaf blade being flat or involute, the central vein being swollen or not, and the length of the stipe being 0.3–1.1 mm in P. advena and 1.1–3.1 mm in P. setaceum.

From an European perspective, a difference in potential risk of invasiveness of P. advena compared with P. setaceum would be a major criterion to justify it not to be regulated. Simpson and Bashaw (1969) showed that P. advena (purple P. setaceum) rarely sets seed under field conditions and does not behave as an apomictic species nor is the plant capable of selfing as opposed to P. setaceum. Chilling injury studies point to hardiness issues for P. advena when temperatures drop below 5°C for 2 weeks (Padhye et al., 2008). In addition, there are no records of invasive behavior of “purple” P. setaceum.

Sequences from the chloroplast loci rbcL and trH‐psbA as well as the nuclear loci ITS showed enough resolution to distinguish P. advena from P. setaceum. However, Blast searches in the NCBI GenBank with the rbcL and trnH‐psbA sequences revealed very high identities (up to 100%) with other Pennisetum, Cenchrus, and Setaria species, which makes identification based on these two loci alone difficult. Furthermore, GenBank contains a few accessions for P. setaceum (or Cenchrus setaceus), but none for P. advena. In addition, the rbcL and trnH‐psbA sequences (GenBank acc. GU135184 and GU135350) for the Cenchrus setaceus voucher J.R. Abbott 24732 (FLAS) are identical to the rbcl and trnH‐psbA sequences of P. advena from this study, suggesting a misidentification.

To obtain more resolution for molecular identification, the sequence of the nuclear ITS locus was used. Interestingly, both P. advena and P. setaceum each contained two variants of the ITS sequences with 2 and 3 SNP, respectively. Most likely these variants are caused by their polyploid nature, as P. setaceum for instance is known to be hexaploid (Martel et al., 2004), although plants in general may contain multiple copies of ITS (Feliner & Rosselló, 2007). The ratio between the two variants was not the same in each of the specimens, but this could be caused by a sequence artifact or an uneven distribution of the variants among the different chromosome copies.

Using the ITS sequence as a proxy for species hybridization has been successfully used for the identification of Impatiens hybrids (van Valkenburg et al., 2019). The cultivars “Cherry Sparkler” and “Sky Rocket” contained the ITS sequences from both P. advena and P. setaceum, suggesting that these specimens have a hybrid status. Interesting, they contain both P. advena ITS variants, but only one of the P. setaceum variants. This points to a hybrid origin, with P. advena being the seed plant.

5. CONCLUSION

Based on molecular and morphological characters, both species can be clearly separated and the popular ornamentals in trade in Europe belong to P. advena. This justifies these ornamentals to be excluded from the List of Union concern of EU regulation 1143/2014.

CONFLICT OF INTEREST

The authors have no conflict of interest to report.

AUTHOR CONTRIBUTIONS

Johannes Leonardus Cornelis Hendrikus van Valkenburg: Conceptualization (lead); Data curation (equal); Formal analysis (supporting); Investigation (equal); Supervision (lead); Writing‐original draft (equal); Writing‐review & editing (equal). Maarten Costerus: Conceptualization (equal); Data curation (equal); Formal analysis (lead); Writing‐original draft (equal); Writing‐review & editing (equal). Marcel Westenberg: Data curation (equal); Formal analysis (equal); Writing‐original draft (equal); Writing‐review & editing (equal).

ACKNOWLEDGMENT

The authors thank Rob Tanner for critically reading the manuscript.

van Valkenburg, J. L. C. H., Costerus, M., & Westenberg, M. (2021). Pennisetum setaceum or Pennisetum advena cultivars, what ornamental do we have in our garden. Ecology and Evolution, 11, 11216–11222. 10.1002/ece3.7908

DATA AVAILABILITY STATEMENT

DNA sequences: ITS, rbcL, and the trnh‐psbA intergenic spacer sequences were deposited in NCBI GenBank under the following accession numbers: MW177954‐MW178003. Sequences will also be made available at https://qbank.eppo.int/plants/. Herbarium vouchers are available at BR, L, WAG, WAG‐PD, and online at https://www.q‐bankplants.eu/.

REFERENCES

  1. Anonymous , (2017). Are ornamental grasses in trade labelled as Pennisetum setaceum or Pennisetum advena different from Pennisetum setaceum as listed on the List of Invasive Species of Union concern belonging to EU regulation 1143/2014? Report submitted to the European Commission on November 16 2017 on behalf of the Dutch Ministry of Agriculture, Nature and Food Quality. [Google Scholar]
  2. Chemisquy, M. A., Giussani, L. M., Scataglini, M. A., Kellogg, E. A., & Morrone, O. (2010). Phylogenetic studies favour the unification of Pennisetum, Cenchrus and Odontelytrum (Poaceae): A combined nuclear, plastid and morphological analysis, and nomenclatural combinations in Cenchrus. Annals of Botany, 106(1), 107–130. 10.1093/aob/mcq090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Costerus, M. (2018). Morfologische en moleculaire karakterisering van Pennisetum soorten en cultivars. Stage verslag. Wageningen University and research Centre. 84 pp. + appendices [in Dutch]. [Google Scholar]
  4. Costerus, M. E., & van Valkenburg, J. L. C. H. (2018). Pennisetum – Het handelssortiment ontrafeld. Dendroflora, 58, 44–67. https://library.wur.nl/WebQuery/gkz‐dendroflora/855480 [Google Scholar]
  5. Danas, E., & Verloove, F. (2015). EU non‐native organism risk assessment scheme, Pennisetum setaceum (Forssk.) Chiov. https://circabc.europa.eu/sd/a/6309ab79‐275c‐43fe‐b615‐17438b68657e/Pennisetum%20setaceum%20RA.pdf [Google Scholar]
  6. Donadío, S., Giussani, L. M., Kellogg, E. A., Zuolaga, F. O., & Morrone, O. (2009). A preliminary molecular phylogeny of Pennisetum and Cenchrus (Poaceae‐Paniceae) based on the trnL‐F, rpl16 chloroplast markers. Taxon, 58(2), 392–404. [Google Scholar]
  7. Feliner, G. N., & Rosselló, J. A. (2007). Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species‐level evolutionary studies in plants. Molecular Phylogenetics and Evolution, 44(2), 911–919. 10.1016/j.ympev.2007.01.013 [DOI] [PubMed] [Google Scholar]
  8. Groom, Q., Hoste, I., & Verloove, F. (2017). Pennisetum setaceum (Forssk.) Chiov. Report, 5 pp. [Google Scholar]
  9. Kellogg, E. A. (2015). The Families and Genera of Vascular Plants. Vol. XIII. Flowering Plants. Monocots. Poaceae edited by K. Kubitzki. Xv+416 pp. Springer. ISBN 978‐3‐319‐15332‐2. [Google Scholar]
  10. Kress, W. J., & Erickson, D. L. (2007). A two‐locus global DNA barcode for land plants: The coding rbcL gene complements the non‐coding trnH‐psbA spacer region. PLoS One, 2(6), e508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kress, W. J., Erickson, D. L., Jones, F. A., Swenson, N. G., Perez, R., Sanjur, O., & Bermingham, E. (2009). Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings National Academy of Sciences of the United States America, 106, 18621–18626. 10.1073/pnas.0909820106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Martel, E., Poncet, V., Lamy, F., Siljak‐Yakovlev, S., Lejeune, B., & Sarr, A. (2004). Chromosome evolution of Pennisetum species (Poaceae): Implications of ITS phylogeny. Plant Systematics and Evolution, 249, 139–149. [Google Scholar]
  13. Meyer, M. H. (2012). Ornamental grasses in the United States. Horticultural Reviews, 39, 121–152. [Google Scholar]
  14. Padhye, S. R., Cregg, B. M., & Cameron, A. C. (2008). Chilling sensitivity of stored purple fountain grass propagules. Postharvest Biology and Technology, 49(2), 235–240. 10.1016/j.postharvbio.2008.01.022 [DOI] [Google Scholar]
  15. Sang, T., Crawford, D. J., & Stuessy, T. F. (1997). Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany, 84, 1120–1136. [PubMed] [Google Scholar]
  16. Simpson, C. E., & Bashaw, E. C. (1969). Cytology and reproductive characteristics in Pennisetum setaceum . American Journal of Botany, 56(1), 31–36. [Google Scholar]
  17. Symon, B. K. (2010). New taxa, nomenclatural changes and notes on Australian grasses in the tribe Paniceae (Poaceae: Panicoideae). Austrobaileya, 8, 187–219. [Google Scholar]
  18. Tate, J. A. (2002). Systematics and evolution of Tarasa (Malvaceae): An enigmatic Andean polyploid genus. PHD Thesis. The University of Texas (Austin). [Google Scholar]
  19. Tornabene, M. W., & Wagner, W. L. (2013). New combinations for pacific endemic species: Marquesan Poaceae, and micronesian Myrtaceae. Phytokeys, 28, 1–7. 10.3897/phytokeys.28.6139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Val’hor (2017) ‐ Note sur Pennisetum setaceum. https://www.valhor.fr/fileadmin/PEE/PDF/VAL_HOR_PEE_10.2017_Note_Pennisetum_setaceum.pdf [Google Scholar]
  21. van Valkenburg, J. L. C. H., Schoenenberger, N., van de Vossenberg, B. T. L. H., Man in ’t Veld, W. A., Westenberg, M., & Boer, E. (2019). A natural hybrid of Impatiens, in the introduced range, demonstrated by sequence analysis of the nuclear ribosomal DNA‐gene repeat. Botany Letters, 166, 144–152. 10.1080/23818107.2019.1584863 [DOI] [Google Scholar]
  22. Veldkamp, J. F. (2014). A revision of Cenchrus incl. Pennisetum (Gramineae) in Malesia with some general nomenclatural notes. Blumea‐Biodiversity, Evolution and Biogeography of Plants, 59(1), 59–75. [Google Scholar]
  23. Verloove, F. (2012). New combinations in Cenchrus (Paniceae, Poaceae) in Europe and the Mediterranean area. Willdenowia, 42, 77–78. 10.3372/wi.42.42108 [DOI] [Google Scholar]
  24. Verloove, F., Govaerts, R., & Buttler, K. P. (2014). A new combination in Cenchrus (Poaceae: Panicae), with lectotypification of Panicum divisum. Phytotaxa, 181(1), 59–60. 10.11646/phytotaxa.181.1.5 [DOI] [Google Scholar]
  25. White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis M. A., Gelfand D. H., Sninsky J. J., & White T. J. (Eds.), PCR Protocols: A guide to methods and applications (pp. 315–322). Academic Press. [Google Scholar]
  26. Wipff, J. K., & Veldkamp, J. F. (1999). Pennisetum advena sp. nov. (Poaceae: Paniceae): A common ornamental grass throughout the southern United States. SIDA, 18(4), 1031–1036. https://keys.lucidcentral.org/keys/v3/pennisetum/ [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

DNA sequences: ITS, rbcL, and the trnh‐psbA intergenic spacer sequences were deposited in NCBI GenBank under the following accession numbers: MW177954‐MW178003. Sequences will also be made available at https://qbank.eppo.int/plants/. Herbarium vouchers are available at BR, L, WAG, WAG‐PD, and online at https://www.q‐bankplants.eu/.

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES