Abstract
At least three species of Pantoea are responsible for bacterial blight disease and grain discoloration of rice in Sub-Saharan Africa. Thus, measures need to be taken to limit the pathogens' dispersion and robust diagnostic tools are required for rapid and cheap diagnosis in the field as well as for routine seed certification or control. Therefore, several diagnostic tools such as simplex and multiplex PCR schemes and a semi-selective medium have been developed and are being used. However, the use of these tools is time-consuming, expensive and therefore limited to laboratories that can afford the chemicals. We have therefore developed two isothermal loop amplification (LAMP) protocols, one of which detects all Pantoea species in the genus and another one that is specific for P. ananatis.
-
•
The novel LAMP assays allow rapid and sensitive detection of these bacteria.
-
•
They will help plant protection services in routine field and laboratory tests especially for monitoring the phytosanitary status of rice seeds.
Keywords: Diagnostic protocol, Loop-mediated isothermal amplification (LAMP), Pantoea spp., Rice
Graphical abstract
Specifications table
| Subject Area: |
|
| More specific subject area: | Plant Pathology, Molecular plant disease diagnosis tools |
| Protocol name: | LAMP assays for the diagnosis of Pantoea spp. blights of rice |
| Reagents/tools: | Materials and Reagents
|
Bioinformatic softwares used for the development of specific primers.
|
|
| Experimental design: | Two diagnostic tools developed: one that detects all known species of Pantoea and the other one that is specific for P. ananatis. These tools will help monitor the phytosanitary status of rice seeds to avoid the dissemination of Pantoea spp. |
| Trial registration: | N/A |
| Ethics: | N/A |
| Value of the Protocol: |
|
Description of protocol
Background
The Pantoea genus is composed of several species characterized by their ubiquity and versatility in their interactions with living organisms and the environment [5], [6], [7]. Five species, namely P. ananatis, P. agglomerans, P. stewartii, P. allii and P. wallisii, have been widely reported as plant pathogens [8], [9], [10], [11] with P. ananatis, P. agglomerans, P. stewartii on rice plants [12,13] and seeds [14] in Sub-Saharan Africa. Collectively, they cause various diseases and symptoms, such as leaf blight and dieback, red streak, black spot, necrosis, bacterial spot, tumors, rot center, stem necrosis, leaf rot, decay of seed and Stewart's wilt [11].
Pantoea spp. are seed-transmitted and thus pose a significant threat to interstate and continental seed exchanges [7,15,16]. Thus, measures need to be taken to limit the pathogens' dispersion and robust diagnostic tools are required for rapid and cheap diagnosis that can be used in the field as well as in routine screening of seed lots.
New diagnostic tools have been developed, such as simplex and multiplex PCR schemes able of identifying the three major Pantoea species affecting rice plants [12]. A semi-selective medium for their isolation and identification has also been developed [13]. However, their use is complex, time consuming, expensive and cannot be deployed outside the laboratory.
Isothermal loop-mediated amplification (LAMP) is a relatively simple technique that facilitates rapid amplification of DNA and has a high level of sensitivity and specificity at low cost [17,18]. The technique uses the thermostable Bst DNA polymerase for reliable and fast polymerization and operates under isothermal conditions at relatively high temperature [19,20]. The results of LAMP reactions can be detected without electrophoretic separation but by visualization of turbidity, fluorescence or a color change thanks to a metal ion indicator [17]. LAMP has several advantages, such as portability, simplicity and cost-efficiency because the reaction can be carried out in a water bath or heating block. It has been used for highly specific and sensitive DNA amplification to detect various pathogens, including viruses, bacteria, protozoa and fungi [21]. However, LAMP has so far not been applied to rice/Pantoea spp., neglected pathosystems that are wide-spread and important in Africa (12, 14).
The goal of this work was to overcome the above difficulties and facilitate a quick and cost-effective diagnosis of the bacteria in rice leaves and paddy fields. Two diagnostic tools have been therefore developed: one that detects all known Pantoea species and another one that is specific for P. ananatis. These tools will help monitor the phytosanitary status of rice seeds to avoid the dissemination of Pantoea spp.
Procedure
Preparation of LAMP template (bacterial ooze, bacterial lyse and DNA) from diseased leaves and apparently healthy or symptomatic rice seeds
-
A.
Collection of diseased leaves and grains
-
1.
Collect diseased rice leaves at heading to maturity approaching stages and showing or not typical bacterial leaf blight symptoms or apparently healthy/symptomatic rice seed and put them into paper envelopes. Stored seeds can also be used.
-
2.
Label the envelope by explaining variety, location, sampling date, rice ecosystem, take the samples to the laboratory and keep them in the refrigerator.
-
B.
Preparation of bacterial ooze, bacterial lysate and genomic DNA
B-1. Bacterial ooze
-
1.
Clean and air dry the diseased leaves and grains (NB: cut the leaves into small pieces) and sterilize them with a 1% sodium hypochlorite solution, then wash them with sterilized distilled water.
-
2.
Put them into conical 15-ml polypropylene falcon tubes containing sterilized distilled water (5–10 ml) for about 10 to 15 min to allow the bacteria to ooze out from the leaf tissue.
-
3.
Seal the tubes with as shown on the envelopes.
pparafilm. parafilm Tubes containing leaf pieces/seeds in the acqueous solution are labelled with the same information Bacterial ooze that came out from the tissue is ready for use in LAMP tests, or
B-2. Bacterial lysate
-
4.
Bring the tubes (in a cooler box containing ice) to the lab and streak the aqueous solution of each test tube on freshly prepared PSA or PGSA agar plates, label and incubate them at 28 °C for 1–3 days.
-
5.
Then, scrape off the cells from the agar plates and suspend them in nuclease-free water previously distributed in LightCyclerⓇ 480 Multiwell Plate 96 or LightCyclerⓇ 8-Tube Strips.
-
6.
Incubate the LightCyclerⓇ 480 Multiwell Plate 96 or the LightCyclerⓇ 8-Tube Strips at 95 °C for 45 min for bacterial lysis.
-
7.
Use strains of Pantoea (CFBP 466, CFBP 3612T, CFBP 3171PT, CFBP 3615PT, CFBP3845T, CFBP 6627T) and Erwinia (CFBP 6632) as reference strains. Also include other rice pathogenic bacteria such as Burkholderia glumae, Pseudomonas spp., Sphingomonas spp., Xanthomonas oryzae as negative controls.
B-3. Genomic DNA
-
8.
Extract the genomic DNA using the Wizard Genomic DNA Purification Kit according to the manufacturer's instructions. Then, evaluate the DNA quality and quantity by agarose gel electrophoresis and spectrophotometry.
Loop-mediated isothermal amplification (LAMP) reaction
NB: Use either colorimetric LAMP or regular LAMP reactions
-
C.
Colorimetric LAMP reaction
-
1.
To simplify the assays, you can prepare in nuclease-free water all the six LAMP primers in Table 1 stored at –20 °C stocks (F3 and B3 outer primers, 2 µM; FIP and BIP inner primers, 16 µM; F-Loop and B-Loop primers, 4 µM).
-
2.
Prepare the reaction mix from 12.5 µl of WarmStartⓇ Colorimetric LAMP 2X Master Mix, 2.5 µl of pre-mixed LAMP primers and 9 µl of nuclease-free water (Table 2), vortex briefly and centrifuge the reaction mix.
-
3.
Then, add 1 µl of one of the target templates (20 ng/µl genomic DNA, heat-killed bacterial cells or bacterial ooze from leaf tissue or rice seeds) to the 24-µl reagent mixes. Seal, vortex and centrifuge the reaction tubes that will provide a solution of bright pink color, which indicates the initial high pH required for successful LAMP reaction.
-
4.
Incubate the reaction tubes at 65 °C for 30 min and examine by eye, with positive reactions turning into yellow while negative controls remaining pink.
-
5.
In case of an orange color suggestive of a positive reaction, return the tubes to 65 °C for an additional 10 min. In order to intensify the color of positive reactions, cool the reaction tubes to room temperature.
-
6.
Finally, take a photography of the tubes to record the colorimetric result.
-
D.
Regular LAMP reaction
-
1.
Carry out the LAMP reaction in a 25 µl volume containing 0.768 µl of each of the outer primers (F3 and B3; 1 µM) and the inner primers (FIP and BIP; 10 µM), 0.384 µl of each of the loop primers (FLoop and B-Loop; 10 µM), 3.5 µl of dNTPs (10 mM), 1.5 µl of MgSO4 (100 mM), 4 µl of betaine (5 M), 1 µl of Bst 2.0 DNA polymerase (8 U/µl), 2.5 µl of Isothermal Amplification Buffer (10X), 7.66 µl of nuclease-free water (Table 3).
-
2.
Add 1 µl of the template from one of the four types of templates: genomic DNA (20 ng/µl), heat-killed bacterial cells, the bacterial ooze from the leaf tissue or rice seeds.
-
3.
Use 20 µl of mineral oil to cover the surface of the LAMP mixture in each reaction.
Table 1.
Primer sets used for LAMP assays in the present study.
| Target gene | Species | Name | Sequence (5′ - 3′) | Amplicon size with F3+B3 (bp) | Length |
|---|---|---|---|---|---|
| atpD | Pantoea sp. | F3 | GCAGTAGAGATCGCCTCTA | 291 | 19 |
| B3 | GATAACGTTGGAGTCGGTC | 19 | |||
| FIP (F1c+F2) | CCTTGGCGAACGGACACA GTCTAACTCGCAGGAACTG |
37 | |||
| BIP (B1c+B2) | GTGGTGCGGGTGTAGGTAAA CGAGTAACCTGAGTGTTCAG |
40 | |||
| F-Loop | AGGTCGATAACCTTGATGCC | 20 | |||
| B-Loop | AACATGATGGAACTGATCCGT | 21 | |||
| gyrB | P. ananatis | F3 | GAGATACCGATGCAACCG | 280 | 18 |
| B3 | CCAATGCCGTCTTTCTCG | 18 | |||
| FIP (F1c+F2) | CAGACGAATCGATACGCCAGA TCGAATACGACATTCTGGC |
41 | |||
| BIP (B1c+B2) | GCGTGATGCAAGAAACGACC TTCAGGTACTCAACAAAGGC |
40 | |||
| F-Loop | TTCAGGAAGGACAGTTCGC | 19 | |||
| B-Loop | CACTACGAAGGTGGTATCCG | 20 |
Table 2.
Components of the colorimetric LAMP reaction
| LAMP Component | Volume per reaction (µL) |
|---|---|
| WarmStartⓇ Colorimetric LAMP 2X Master Mix | 12.5 µl |
| LAMP Primer Mix (10X) | 2.5 µl |
| Template (genomic DNA, heat-killed bacterial cells, seed extract or plant tissue exudate) | 1 µl |
| Nuclease-free water | 9 µl |
| Total volume | 25 µl |
Table 3.
Composition of the regular LAMP reaction.
| LAMP component | Volume per reaction (µL) |
|---|---|
| Bst 2.0 (New England Biolabs) 8 U/µL | 1 |
| Isothermal Amplification Buffer (New England Biolabs) 10X | 2.5 |
| Betaine (Sigma Aldrich) 5 M | 4 |
| dNTPs (10 mM) | 3.5 |
| MgSO4 (100 mM) | 1.5 |
| Outer primers (F3 and B3; 1 µM) | 0.768 (each) |
| Inner primers (FIP and BIP; 10 µM) | 0.768 (each) |
| Loop primers (Loop F and Loop B; 10 µM) | 0.384 (each) |
| Nuclease-free water | 7.66 |
| Template (genomic DNA, heat-killed bacterial cells, seed extract or plant tissue exudate) | 1 |
| Total | 25 |
| Mineral oil | 20 |
| Quant-IT™ Pico GreenⓇ Reagent (Invitrogen, Carlsbad, CA, USA) | 0.5 |
Data analysis
For the colorimetric LAMP assay, the results can be judged by naked eye. Negative (-) reactions remain pink while positive (+) reactions change to yellow. (Fig. 1).
Fig. 1.
Colorimetric LAMP assay results using bacterial lysates, with Pantoea spp. (I) and P. ananatis (II) diagnostics tools. Negative (-) reactions are indicated in pink and positive (+) reactions are indicated by a change to yellow.
For the regular detection of LAMP products, reaction tubes were placed under UV light. Positive reactions, i.e. DNA amplification, were identified by the bright green fluorescent color and could be seen by naked eye (Fig. 2). Green fluorescent tubes are positive (+) while the others are negative (-).
Fig. 2.
Regular LAMP assay results using bacterial lysates, with Pantoea spp. (I) and P. ananatis (II) diagnostics tools. Green fluorescent tubes are positive (+) while the others are negative (-).
Notes
-
1.
The LAMP reaction is very sensitive. Attention should be paid to avoid contamination during the operation, and a stringent laboratory compartmentalization is strongly recommended for LAMP and other amplification assays.
-
2.
To prevent cross-contamination, different sets of pipettes and different work areas must be used for DNA template preparation, PCR mixture preparation and DNA amplification. Gloves must be changed regularly and sterile pipetting techniques must be applied during the entire LAMP experiment.
-
3.
To avoid potential contamination, agarose gel electrophoresis of LAMP products is not encouraged.
-
4.
For bacterial colonies (lysates), the detection limit of the two LAMP assays was 104 colony-forming units/ml. Using purified DNA, the thresholds were 0.5 fg for the Pantoea-genus-specific tool and 50 fg for the P. ananatis-specific tool.
Recipes
-
•
Peptone sucrose agar (PSA):
To 1 l of sterile distilled water, add 10 g peptone, 10 g sucrose, 16 g agar, and 1 g glutamic acid. Adjust pH to 7.1 ± 0.2 using 1 M KOH or NaOH solution. Autoclave at 121 °C for 20 min. Cool the bottle but let not solidify the medium, then pour into Petri dishes.
-
•
Pantoea genus-specific agar (PGSA).
To 1 l of sterile distilled water (pH 7.1 ± 0.2); add 65 g NaCl; 0.001 g crystal violet; 8.5 g sodium thiosulfate; 13.5 g agar; 10 g peptone; and 10 g sucrose. Autoclave at 121 °C for 20 min. Cool the bottle but don't let to solidify the medium, then pour into Petri dishes.
-
•
1.5% agarose gel: 1.5 g of agarose in 100 ml of 1x TBE and 10 µl 10000x GelRed.
-
•
Preparation of 1 M HCl
To prepare a solution of 1 M HCl, add 83 ml of concentrated HCl (37% w/w) to 1l of water.
-
•
Preparation of 70% ethanol
Following the Gay-Lussac dilution table, add 40.85 ml of 96° ethanol to 100 ml of distilled sterile water.
Declaration of Competing Interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
This protocol has been realized with the financial support of the Allocation de Recherche pour une Thèse au Sud (ARTS) program of the Institut de Recherche pour le Développement (IRD). Dr Kossi KINI received an individual research grant N°C/5921-1 from the International Foundation for Science (IFS). The Africa Rice Center (AfricaRice) and the IRD provided financial support from the Global Rice Science Partnership (GRiSP). In addition, AfricaRice provided financial support obtained from the Ministry of Foreign Affairs, Japan. All these institutions are gratefully acknowledged.
Footnotes
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.mex.2021.101216.
Appendix. Supplementary materials
References
- 1.Benson D.A., Cavanaugh M., Clark K., Karsch-Mizrachi I., Ostell J., Pruitt K.D., Sayers E.W. GenBank. Nucleic Acids Res. 2018;46:D41–D47. doi: 10.1093/nar/gkx1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Rutherford K., Parkhill J., Crook J., Horsnell T., Rice P., Rajandream M.-A., Barrell B. Artemis: sequence visualization and annotation. Bioinformatics. 2000;16:944–945. doi: 10.1093/bioinformatics/16.10.944. [DOI] [PubMed] [Google Scholar]
- 3.Edgar R.C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ye J., Coulouris G., Zaretskaya I., Cutcutache I., Rozen S., Madden T.L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012;13:134. doi: 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Walterson A.M., Stavrinides J. Pantoea: insights into a highly versatile and diverse genus within the Enterobacteriaceae. FEMS Microbiol. Rev. 2015;39:968–984. doi: 10.1093/femsre/fuv027. [DOI] [PubMed] [Google Scholar]
- 6.Weller-Stuart T., De Maayer P., Coutinho T. Pantoea ananatis: genomic insights into a versatile pathogen. Molecular Plant Pathol. 2017;18:1191–1198. doi: 10.1111/mpp.12517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Völksch B., Thon S., Jacobsen I.D., Gube M. Polyphasic study of plant-and clinic-associated Pantoea agglomerans strains reveals indistinguishable virulence potential, Infection. Genet. Evol. 2009;9:1381–1391. doi: 10.1016/j.meegid.2009.09.016. [DOI] [PubMed] [Google Scholar]
- 8.Brady C.L., Venter S.N., Cleenwerck I., Engelbeen K., Vancanneyt M., Swings J., Coutinho T.A. Pantoea vagans sp. nov., Pantoea eucalypti sp. nov., Pantoea deleyi sp. nov. and Pantoea anthophila sp. nov. Int. J. Syst. Evol. Microbiol. 2009;59:2339–2345. doi: 10.1099/ijs.0.009241-0. [DOI] [PubMed] [Google Scholar]
- 9.Brady C.L., Goszczynska T., Venter S.N., Cleenwerck I., De Vos P., Gitaitis R.D., Coutinho T.A. Pantoea allii sp. nov., isolated from onion plants and seed. Int. J. Syst. Evol. Microbiol. 2011;61:932–937. doi: 10.1099/ijs.0.022921-0. [DOI] [PubMed] [Google Scholar]
- 10.Delétoile A., Decré D., Courant S., Passet V., Audo J., Grimont P., Arlet G., Brisse S. Phylogeny and identification of Pantoea species and typing of Pantoea agglomerans strains by multilocus gene sequencing. J. Clin. Microbiol. 2009;47:300–310. doi: 10.1128/JCM.01916-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Doni F., Suhaimi N.S.M., Mohamed Z., Ishak N., Mispan M.S. Pantoea: a newly identified causative agent for leaf blight disease in rice. J. Plant Dis. Protection. 2019;126:491–494. [Google Scholar]
- 12.Kini K., Agnimonhan R., Dossa R., Silué D., Koebnik R. A diagnostic multiplex PCR scheme for identification of plant-associated bacteria of the genus Pantoea. bioRxiv. 2018 doi: 10.1101/456806. [DOI] [PubMed] [Google Scholar]
- 13.Kini K., Dossa R., Dossou B., Mariko M., Koebnik R., Silué D. A semi-selective medium to isolate and identify bacteria of the genus Pantoea. J. Gen. Plant Pathol. 2019;85:424–427. [Google Scholar]
- 14.Dossou B., Silue D. Rice pathogens intercepted on seeds originating from 11 African countries and from the USA. Seed Sci. Technol. 2018;46:31–40. [Google Scholar]
- 15.Walcott R.R., Gitaitis R.D., Castro A.C., Sanders F.H., Jr, Diaz-Perez J.C. Natural infestation of onion seed by Pantoea ananatis, causal agent of center rot. Plant Dis. 2002;86:106–111. doi: 10.1094/PDIS.2002.86.2.106. [DOI] [PubMed] [Google Scholar]
- 16.Goszczynska T., Moloto V.M., Venter S.N., Coutinho T.A. Isolation and identification of Pantoea ananatis from onion seed in South Africa. Seed Sci. Technol. 2006;34:655–668. [Google Scholar]
- 17.Mori Y., Notomi T. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 2009;15:62–69. doi: 10.1007/s10156-009-0669-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Notomi T., Okayama H., Masubuchi H., Yonekawa T., Watanabe K., Amino N., Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:e63. doi: 10.1093/nar/28.12.e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hafner G.J., Yang I.C., Wolter L.C., Stafford M.R., Giffard P.M. Isothermal amplification and multimerization of DNA by Bst DNA polymerase. BioTechniques. 2001;30:852–867. doi: 10.2144/01304rr03. [DOI] [PubMed] [Google Scholar]
- 20.Mead D.A., McClary J.A., Luckey J.A., Kostichka A.J., Witney F.R., Smith L.M. Bst DNA polymerase permits rapid sequence analysis from nanogram amounts of template. BioTechniques. 1991;11:76–78. [PubMed] [Google Scholar]
- 21.Niessen L. Current state and future perspectives of loop-mediated isothermal amplification (LAMP)-based diagnosis of filamentous fungi and yeasts. Appl. Microbiol. Biotechnol. 2015;99:553–574. doi: 10.1007/s00253-014-6196-3. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.