Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2021 Jul 7;205(3):379–390. doi: 10.1111/cei.13628

Interleukin‐4 protects mice against lethal influenza and Streptococcus pneumoniae co‐infected pneumonia

Yang Peng 1, Xiaofang Wang 1,2, Hong Wang 1, Wenchun Xu 1, Kaifeng Wu 3, Xuemei Go 1, Yibing Yin 1, Xuemei Zhang 1,✉
PMCID: PMC8374225  PMID: 34061992

Abstract

Streptococcus pneumoniae co‐infection post‐influenza is a major cause of mortality characterized by uncontrolled bacteria burden and excessive immune response during influenza pandemics. Interleukin (IL)‐4 is a canonical type II immune cytokine known for its wide range of biological activities on different cell types. It displays protective roles in numerous infectious diseases and immune‐related diseases, but its role in influenza and S. pneumoniae (influenza/S. pneumoniae) co‐infected pneumonia has not been reported. In our study, we used C57BL/6 wild‐type (WT) and IL‐4‐deficient (IL‐4−/−) mice to establish co‐infection model with S. pneumoniae after influenza virus infection. Co‐infected IL‐4−/− mice showed increased mortality and weight loss compared with WT mice. IL‐4 deficiency led to increased bacterial loads in lungs without altering influenza virus replication, suggesting a role of IL‐4 in decreasing post‐influenza susceptibility to S. pneumoniae co‐infection. Loss of IL‐4 also resulted in aggravated lung damage together with massive proinflammatory cytokine production and immune cell infiltration during co‐infection. Administration of recombinant IL‐4 rescued the survival and weight loss of IL‐4−/− mice in lethal co‐infection. Additionally, IL‐4 deficiency led to more immune cell death in co‐infection. Gasdermin D (GSDMD) during co‐infection was induced in IL‐4−/− mice that subsequently activated cell pyroptosis. Treatment of recombinant IL‐4 or inhibition of GSDMD activity by disulfiram decreased immune cell death and bacterial loads in lungs of IL‐4−/− co‐infected mice. These results suggest that IL‐4 decreases post‐influenza susceptibility to S. pneumoniae co‐infection via suppressing GSDMD‐induced pyroptosis. Collectively, this study demonstrates the protective role of IL‐4 in influenza/S. pneumoniae co‐infected pneumonia.

Keywords: co‐infection, IL‐4, influenza, pyroptosis, Streptococcus pneumoniae

Our results demonstrated a protective effect of IL‐4 in influenza/S. pneumoniae co‐infection. IL‐4 significantly decreased the S. pneumoniae burden and robust inflammatory response via suppressing immune cell pyroptosis in co‐infected mice. Please let us know if there are any further instructions and we are very willing to response as soon as impossible.

graphic file with name CEI-205-379-g002.jpg

INTRODUCTION

Influenza is highly contagious and constitutes a significant public health problem due to its rapid transmission and highly associated morbidity and mortality, with 3–5 million cases of severe illness and 250 000–500 000 deaths worldwide annually [1]. Investigations of clinical patients and autopsies have shown that post‐influenza bacterial co‐infection contributes significantly to the death cases, particularly during pandemics, and Streptococcus pneumoniae was the main co‐infecting bacteria detected in the 1918 and 2009 influenza pandemics [2, 3]. Interactions among host, influenza and co‐infecting bacteria have been profiled partially during the past few years. The researchers revealed that dysregulated immune responses [4] impaired barrier function in the lungs [5] and disordered homeostasis [6] were the important mechanisms contributing to uncontrolled bacterial burden and the excessive inflammatory response which eventually led to morbidity and mortality induced by co‐infection.

Interleukin (IL)‐4 is a canonical type II immune cytokine that exerts both immunostimulatory and immunosuppressive activities [7, 8, 9]. It displays protective roles in infectious diseases, including Clostridioides difficile infection [10], Murid gammaherpesvirus 4 infection post‐Helminth [11] and Litomosoides sigmodontis infection [12]. IL‐4 could also protect mice from inflammation‐related diseases, including steroid‐induced osteonecrosis [13] and multiple sclerosis [14] through inhibiting excessive inflammatory injury. IL‐4 is demonstrated to inhibit macrophage apoptosis in vitro [15], as well as the assembly of NLR family pyrin domain containing 3 (NLRP3) inflammasome, which is involved in pyroptosis, a programmed cell death different from apoptosis, after lipopolysaccharide (LPS) or LPS/adenosine triphosphate (ATP) stimulation in macrophages [16]. Studies have shown that inhibiting excessive inflammatory responses and improving immune cell survival can play a beneficial role in influenza and bacterial co‐infection pneumonia [17, 18]. These studies suggest that IL‐4 might play a vital role in influenza/S. pneumoniae co‐infection.

In this study, we demonstrate that IL‐4 plays a significantly protective role in influenza/S. pneumoniae co‐infected pneumonia. IL‐4 could decrease post‐influenza susceptibility to S. pneumoniae co‐infection and alleviate lung inflammatory injury by inhibiting gasdermin D (GSDMD)‐induced pyroptosis in co‐infected mice.

MATERIALS AND METHODS

Mice and infectious reagents

Wild‐type (WT) C57BL/6 mice were obtained from and bred in Chongqing Medical University. IL‐4−/− mice with a C57BL/6 genetic background were purchased from The Jackson Laboratory. All mice used in this study were aged 8–10 weeks and housed at the Central Animal Care Services of Chongqing Medical University under specific pathogen‐free conditions. Influenza virus strain A/Puerto Rico/8/1934 (ATCC‐VR‐1469, along to H1N1) was purchased from the American Type Culture Collection and replicated in the allantoic cavities of 9‐day‐old specific pathogen‐free embryonated chicken eggs by viral inoculation. Pneumococcal strain CMCC 31693 (serotype 19F) was purchased from the National Center for Medical Culture Collections and grown in semisynthetic casein hydrolysate medium supplemented with 0.5% yeast extract.

Mouse infection model

After anesthetization with intraperitoneal (i.p.) injection of 1.5% pentobarbital sodium (0.1 ml/20 g body weight), mice were inoculated intranasally with 400 plaque‐forming units (PFU) of IAV strain PR8 in 30 µl phosphate‐buffered saline (PBS) or 1× 108 colony‐forming units (CFU) of pneumococcal strain 19F in 20 µl of PBS to establish a single infection model. Secondary 19F infection was performed 3 days after PR8 inoculation to establish a mouse co‐infection model.

Survival, body weight and determination of bacterial and viral burdens

Mice in different groups were weighed and monitored daily for mortality. Bacterial burden was determined by plating titrating doses of organ homogenate on agar plates followed by CFU analysis. Viral loads were determined by measuring levels of PR8 M1 gene expression through reverse transcription–polymerase chain reaction (RT–PCR). Primers for the influenza matrix M1 gene were as follows: forward: 5′‐TGAGTCTTCTAACCGAGGTC‐3′; reverse: 5′‐GGTCTTGTCTTTAGCCATTCC‐3′. The number of copies of the M1 gene was calculated using an M1‐containing plasmid of known concentration as a standard.

Lung histology

Whole lungs from infected mice were collected and inflated with 4% formaldehyde, embedded in paraffin and sliced into 5‐mm sections. Lung sections were stained with hematoxylin and eosin (H&E) to evaluate the pathological changes.

Lactate dehydrogenase assays, total proteins and wet‐to‐dry ratio of lung

Total proteins and lactate dehydrogenase (LDH) activity in bronchial alveolar lavage fluid (BALF) were tested, respectively, by bicinchoninic acid (BCA) protein assay kit and LDH assay kits (Beyotime, Jiangsu, China). The wet/dry ratio of lung samples was calculated from the initial weight of the whole lung to its weight after desiccation at 70°C for 72 h.

Enzyme‐linked immunosorbent assay (ELISA)

Cytokine levels in lung homogenate were quantified by ELISA kits (Biolegend, San Diego, California, USA), including IL‐6 (2–500 pg/ml), IL‐1β (16–2000 pg/ml), interferon (IFN)‐γ (4–1000 pg/ml), tumor necrosis factor (TNF)‐α (4–500 pg/ml), chemokine (C‐X‐C motif) ligand 1 (CXCL1) (1.8–1000 pg/ml), CCL2 (30–1000 pg/ml) and CXCL10 (4–1000 pg/ml).

Preparation of pulmonary single‐cell suspension

The mice were anesthetized and the lungs were collected. The lungs were cut into small pieces of approximately 1 mm3 and 2 ml digestive buffer solution was added (including RPMI‐1640 containing 1 mg/ml type IV collagenase and 5 U/ml DNase I) for incubating at 37℃ for 30 min. The digested tissue was filtered using a 70‐mm cell screen. The filtered cells were collected and centrifuged at 4℃ for 800 g for 5 min. The supernatant was discarded and 1 ml red blood cell (RBC) lysis buffer was added to degenerate the RBC. Cell precipitation was obtained by centrifugation at 800 g at 4℃ for 5 min. The cells were precipitated and cleaned twice with PBS precooled in the 4℃ refrigerator, then resuspended with PBS to obtain the single‐cell suspension of mouse lung tissue.

Flow cytometry

Cells from BALF were obtained by centrifugation, purified and counted. Cells were stained with mouse CD11b/allophycocyanin (APC) antibodies (eBiosciences) together with lymphocyte antigen 6 complex locus G6D (Ly‐6G) [1A8]/fluorescein isothiocyanate (FITC) (eBiosciences) or F4/80 [BM8]/PE/cyanin 5 (eBiosciences) antibodies to analyze neutrophils and macrophages, respectively. Ly6 complex locus G6D/fluorescein isothiocyanate (Ly6G+FITC) (Abcam, Cambridge, UK) was used to distinguish the recruited macrophage in total macrophage. Cells were stained with annexin V/FITC and propidium iodide (PI) (BD Bioscience, Franklin, New Jersey, USA) for cell survival analysis. For analysis of T cells, cells were stained with mouse CD8a/FITC (BD Bioscience) antibodies, fixed, permeabilized and then stained with intracellular IFN‐γ/PE (BD Bioscience) antibodies.

Western blotting and antibodies

Lysates of immune cell from BALF were used for Western blotting. Activation of pyroptosis was analyzed by the expression of GSDMD (anti‐GSDMD rabbit polyclonal antibodies; Abcam), IL‐1β (anti‐IL‐1β rabbit polyclonal antibodies; Abcam) and caspase‐1 (anti‐caspase‐1 antibodies; Abcam). GAPDH (anti‐GAPDH rabbit polyclonal antibodies; Proteintech, Boulder, Colorado, USA) served as a loading control. Protein bands were visualized with the use of the ECL Western blotting system.

Recombinant IL‐4 and disulfiram treatment

Mice were treated with mrIL‐4 (2 μg/mouse; R&D Systems, Minneapolis, Minnesota, USA) at 3 and 5 days after PR8 infection by i.p. injection and with disulfiram (0.2 mg/mouse) at 3 days after PR8 infection by i.p. injection.

Statistical analysis

All statistical analyses were performed with software GraphPad Prism version 5.01 (La Jolla, California, USA). A p value of 0.05 was considered statistically significant. Kaplan–Meier survival curves were assessed by log‐rank (Mantel‐Cox) test, and Mann–Whitney U‐test and unpaired Student’s t‐test were used to compare two groups. Comparisons of more than two groups were performed with Tukey’s multiple comparisons.

RESULTS

IL‐4 is required for the survival of mice in influenza/S. pneumoniae co‐infection

To investigate the role of IL‐4 in influenza/S. pneumoniae co‐infection, we infected WT and IL‐4−/− mice with mouse adapted strains of influenza A virus (PR8) and S. pneumoniae (19F) to establish single and co‐infection models (Figure 1a). WT and IL‐4−/− mice with single PR8 or 19F infection showed similar weight loss, both with 100% survival (Figure 1b–d). In PR8+19F co‐infection, IL‐4 deficiency significantly decreased the survival rate (Figure 1d). Co‐infected IL‐4−/− mice also displayed significantly increased weight loss compared with WT mice (Figure 1e). Next, we injected co‐infected WT and IL‐4−/− mice i.p. with rIL‐4 (2 μg/mouse) at 3 and 5 days after PR8 infection (0 and 2 days after 19F co‐infection) to determine whether exogenous IL‐4 could rescue mice from lethal co‐infection. As shown in Figure 1e,f, IL‐4−/− mice showed significantly decreased weight loss and improved survival rate in co‐infection after rIL‐4 treatment. Co‐infected WT mice also showed a trend towards diminished weight loss and increased survival rate after rIL‐4 treatment. These results suggest that IL‐4 can enhance the resistance of mice to lethal co‐infection, indicating a protective and therapeutic role of IL‐4 in influenza/S. pneumoniae co‐infection.

FIGURE 1.

FIGURE 1

Open in a new tab

Interleukn (IL)‐4 is required for the survival of mice in influenza/Streptococcus pneumoniae co‐infection. Wild‐type (WT) and IL‐4−/− mice were infected with PR8 alone, 19F alone or PR8+19F co‐infection. Mice were monitored for 2 weeks after primary PR8 or 19F infection. (a) C57BL/6 WT mice and IL‐4−/− mice were inoculated intranasally with influenza [PR8; 400 plaque‐forming units (PFU) alone, S. pneumoniae, 19F; 1 × 108 colony‐forming units (CFU)] alone or PR8+19F co‐infection. Secondary 19F super‐challenge was performed 3 days after influenza infection. (b,c) Body weight loss of single infected mice was recorded daily (n = 4–5/group). (d) Kaplan–Meier survival curves were assessed by log‐rank (Mantel–Cox) test (n = 10–12/group). **p < 0.01. (e,f) Co‐infected WT and IL‐4−/− mice were injected intraperitoneally (i.p.) with 2 μg rIL‐4 at 3 and 5 days after influenza infection (0 and 2 days after 19F co‐infection); the survival and weights were monitored for 2 weeks after influenza (n = 10–13 /group). Kaplan–Meier survival curves were assessed by log‐rank (Mantel–Cox) test for significance. *p < 0.05

IL‐4 deficiency increases post‐influenza susceptibility to S. pneumoniae co‐infection in mice

Virus replication and bacterial burden are thought to be correlated with the severity of pneumonia. We therefore investigated whether IL‐4 affected influenza virus or bacterial loads in influenza/S. pneumoniae co‐infection. Lungs were collected from mice 3 days after PR8 infection or 1 day after 19F co‐infection for viral load detection. Non‐significant difference in viral loads was observed between WT and IL‐4−/− mice in both single influenza infection or co‐infection (Figure 2a,b). Lung homogenates and nasal washes were collected from mice 1 day after 19F primary infection or co‐infection to determine bacterial loads. There was no difference in bacterial loads between WT and IL‐4−/− mice in 19F infection alone (Figure 2c,d), whereas significantly increased bacterial loads were observed both in nasal washes and lungs of IL‐4−/− mice compared with WT mice in co‐infection (Figure 2e,f). Together, IL‐4 deficiency increases the susceptibility to S. pneumoniae co‐infection in mice without altering influenza virus replication in early stage.

FIGURE 2.

FIGURE 2

Open in a new tab

Interleukin (IL)‐4 deficiency increases post‐influenza susceptibility to Streptococcus pneumoniae co‐infection in mice. Lungs and nasal washes were collected 3 days after PR8 single infection, 1 day after 19F single infection, 1 day after 19F co‐infection (4 days after PR8 infection). (a,b) Viral loads in lungs were determined by PR8 M1 gene copy detected with quantitative polymerase chain reaction (PCR) (n = 3/group). (c–f) Lung homogenates and nasal washes were inoculated on blood agar plates, and bacterial loads were determined by colony‐forming units (CFU) analysis (n = 4–5/group). The labeled CFU/lung or CFU/nasal wash indicates the total number of CFU in each lung homogenate or nasal wash sample. *p < 0.05, **p < 0.01 based on Mann–Whitney U‐test; NS = not significant

IL‐4 deficiency aggravates lung inflammatory damage of mice in influenza/S. pneumoniae co‐infection

To profile lung inflammatory damage and inflammation response in co‐infection, we collected lungs and BALF from mice 3 days after PR8 infection and 1 day after 19F primary infection or co‐infection for histopathology assays. H&E staining of lung sections showed that PR8 or 19F single infection caused mild lung damage which showed no difference between WT and IL‐4−/− mice (Figure 3a). In contrast, more multifocal necrosis and expansion of airspaces were displayed by histology in IL‐4−/− mice compared to WT counterparts (Figure 3a). Co‐infected IL‐4−/− mice also showed increased cytotoxicity as assessed by LDH activity, increased epithelial permeability measured by total proteins and an increased trend of edema, as evaluated by the lung wet/dry ratios compared with WT mice, while there was no difference in PR8 or 19F infection alone in cytotoxicity, total protein level and pulmonary edema between WT and IL‐4−/− mice. To further confirm the effect of IL‐4 on lung inflammatory injury, we continued to test the total proteins and lung wet/dry ratios 3 days after co‐infection. IL‐4−/− mice still showed significantly increased epithelial permeability and edema compared with WT mice at later stages in co‐infection (Figure 3b–d). Additionally, we detected the levels of proinflammatory cytokines. In PR8 infection alone, the level of IL‐6 in WT mice was significantly lower than that of IL‐4−/− mice, while the level of IL‐1β was higher than that of IL‐4−/− mice with no difference in TNF‐α. In 19F infection alone, the level of IL‐1β in WT mice was significantly lower than that in IL‐4−/− mice, and there was no difference in IL‐6 or TNF‐α. However, IL‐6, TNF‐α and IL‐1β in lungs of IL‐4−/− mice were all significantly higher than those of WT mice 1 day after co‐infection (Figure 3e–g). IFN‐γ did not differ between WT and IL‐4−/− mice in both single infection or co‐infection (Figure 3h). The results above suggest that IL‐4 plays different immune regulatory roles in different infection models and shows a comprehensive and powerful inflammatory inhibitory effect in influenza/S. pneumoniae co‐infection.

FIGURE 3.

FIGURE 3

Open in a new tab

Interleukin (IL)‐4 deficiency aggravates lung inflammatory damage of mice in influenza/Staphylococcus pneumoniae co‐infection. Lungs and bronchoalveolar lavage fluid (BALF) were collected 3 days after PR8 single infection, 1 day after 19F single infection and 1 and 3 days after 19F co‐infection (4 and 6 days after PR8 infection). (a) Lung sections were stained with hematoxylin and eosin (H&E) for histopathology assay. (b) The lactate dehydrogenase (LDH) activity was tested by LDH assay kits (n = 4–5/group). (c) The total protein levels in BALF were tested by bicinchoninic acid (BCA) protein assay kits (n = 4–5/group). (d) The wet/dry ratios of lungs were determined to evaluate lung oedema of mice in different infection scenarios (n = 4–5/group). (e–h) Levels of proinflammatory cytokines IL‐6, tumour necrosis factor (TNF)‐α, IL‐1β and interferon (IFN)‐γ in lungs were detected by enzyme‐linked immunosorbent assay (ELISA) kits (n = 4–5/group). **p < 0.05, **p < 0.01, ***p < 0.01, based on unpaired Student’s t‐test; NS = not significant

IL‐4 deficiency facilitates inflammatory macrophage recruitment in influenza/S. pneumoniae co‐infection

The recruitment of immune cells is related to the clearance of pathogens and inflammatory damage. We then examined infiltration of immune cells prior to the 19F super‐challenge (3 days after PR8 infection) and 1 day after co‐infection. The proportions, as well as absolute numbers of both macrophages and neutrophils, were comparable between WT and IL‐4−/− mice 3 days after PR8 infection alone (Figure 4a–e). After 19F super‐challenge, the proportion and absolute number of macrophages both increased in IL‐4−/− mice compared with WT mice (Figure 4a,d). As shown in Supporting information, Figure S1, the macrophages were mostly recruited inflammatory macrophages in both PR8 infection and co‐infection. In contrast, we did not observe significant differences in the percentage and absolute number of neutrophils between WT and IL‐4−/− mice (Figure 4b,e). IL‐4 deficiency did not affect the proportion of CD8+ IFN‐γ+ T cells (Supporting information, Figure S2). Furthermore, chemokine CCL2 in lungs, which can facilitate lung macrophage influx, was significantly elevated in IL‐4−/− mice compared with WT mice in co‐infection (Figure 4f). We did not observe a difference in concentrations of CXCL1 or CXCL10, which mainly recruit neutrophils and T cells, respectively, between WT and IL‐4−/− mice (Figure 4g,h). Observing both increased macrophage recruitment and bacterial burden 1 day after co‐infection in IL‐4−/− mice, we considered if the increased macrophage could combat the bacteria and decrease the bacterial burden at the late stage in co‐infection. As shown in Supporting information, Figure S3, IL‐4−/− mice still displayed increased bacterial burden without differences in viral load regardless of the greater cell infiltration 3 days after co‐infection, which suggests that the increased immune cells failed to control the bacterial burden.

FIGURE 4.

FIGURE 4

Open in a new tab

Interleukin (IL)‐4 deficiency facilitates macrophage recruitment into lungs of mice in influenza/Staphylococcus pneumoniae co‐infection. Bronchoalveolar lavage fluid (BALF) was collected 3 days after PR8 single infection and 1 day after 19F co‐infection (4 days after PR8 infection). BALF cells were counted, purified and identified by flow cytometry. Neutrophils were determined by gating on CD11b+ lymphocyte antigen 6 complex locus G6D (Ly6G+) cells, whereas macrophages were determined by gating on CD11b+ F4/80+ cells. (a,b) Percentages of neutrophils and macrophages. (c–e) Absolute numbers of total cells, macrophages and neutrophils. The absolute number of macrophages and neutrophils was obtained by multiplying the number of cells by the corresponding ratio (n = 5–7/group). **p < 0.01 based on Mann–Whitney U‐test. (f–h) Levels of chemokines chemokine (C‐X‐C motif) ligand 1 (CCL2), CXCL1 and CXCL10 in lungs were measured by ELISA kits (n = 5/group). **p < 0.01 based on unpaired Student’s t‐test; NS = not significant

IL‐4 deficiency increases immune cell death in lungs of mice with influenza/S. pneumoniae co‐infection

To determine the cause of increased post‐influenza susceptibility to S. pneumoniae co‐infection at the early stage and failed clearance of bacteria at a later stage in IL‐4−/− mice, we tested the survival of immune cells by annexin V/FITC and PI staining. There was no difference in apoptosis (annexin V+/PI−) of immune cells in both single and co‐infection between WT and IL‐4−/− mice (Figure 5a,b]. In contrast, immune cells of co‐infected IL‐4−/− mice showed an increased proportion of cells that were positive for both annexin V and PI (Annexin V+/PI+) compared with WT counterparts (Figure 5a,c). We further examined the death of lung parenchymal cells and, as shown in Supporting information, Figure S4, the death of pulmonary parenchyma cells showed no difference between co‐infected WT and IL‐4−/− mice. The results above indicate that IL‐4 deficiency might increase post‐influenza susceptibility to S. pneumoniae co‐infection and decrease bacterial clearance in mice by increasing immune cell death.

FIGURE 5.

FIGURE 5

Open in a new tab

Interleukin (IL)‐4 deficiency increases immune cell death in lungs of mice with influenza/Staphylococcus pneumoniae co‐infection. Bronchoalveolar lavage fluid (BALF) was collected 3 days after PR8 single infection, 1 day after 19F single infection and 1 day after 19F co‐infection (4 days after PR8 infection). (a) The representative images of BALF cell apoptosis analyzed by flow cytometry with the staining of annexin V and propidium iodide (PI). (b,c) Statistical analysis of the percentage of cells positive for annexin V but not PI and cells positive for both annexin V and PI (n = 3/group). **p < 0.01 based on Mann–Whitney U‐test; NS = not significant

rIL‐4 and pyroptosis inhibition by disulfiram decrease immune cell death and post‐influenza susceptibility to S. pneumoniae co‐infection

Pyroptosis is a programmed cell death that could be positive for both annexin V and PI staining. A series of works have demonstrated that pyroptosis was involved in the outcome, pathogen clearance and inflammatory response in infectious diseases [19]. We then tested the pyroptosis activation of immune cells from BALF. Cells from BALF of co‐infected IL‐4−/− mice showed increased expression of GSDMD, cleaved GSDMD and cleaved IL‐1β compared with WT counterparts. rIL‐4 administration can also inhibit GSDMD and cleaved IL‐1β expression in both co‐infected WT and IL‐4−/− mice (Figure 6a). Consistently, IL‐4 could also inhibit the expression of cleaved caspase‐1, which is responsible for cleaving GSDMD and IL‐1β (Supporting information, Figure S5). To further determine whether IL‐4 reduces immune cell death by inhibiting pyroptosis, mice were administered with the pyroptosis inhibitor disulfiram and rIL‐4. Disulfiram is a small molecule that can effectively inhibit the formation of GSDMD pores. Administration of disulfiram and rIL‐4 obviously decreased immune cell death in co‐infected IL‐4−/− mice (Figure 6b–d). Disulfiram and rIL‐4 treatments reduced the BALF protein levels and bacteria loads in co‐infected IL‐4−/− mice (Figure 6e,f). rIL‐4 treatment also decreased the BALF protein levels in co‐infected WT mice (Figure 6e). Additionally, inflammatory cytokine levels including IL‐6, TNF‐α and IL‐1β decreased significantly after disulfiram and rIL‐4 treatment in co‐infected IL‐4−/− mice (Figure 6g–i). These results suggest that IL‐4 could ameliorate lung inflammatory damage and decrease post‐influenza susceptibility to S. pneumoniae co‐infection by inhibiting immune cell pyroptosis in mice.

FIGURE 6.

FIGURE 6

Open in a new tab

Recombinant human interleukin (rhIL)‐4 and pyroptosis inhibition by disulfiram decrease immune cell death and post‐influenza susceptibility to Staphylococcus pneumoniae co‐infection. Co‐infected wild‐type (WT) and IL‐4−/− mice were injected intraperitoneally (i.p) with rIL‐4 (2 μg/mouse) or disulfiram (0.2 mg/mouse). Lungs and bronchoalveolar lavage fluid (BALF) were collected 1 day after 19F co‐infection (4 days after PR8 infection). (a) The expressions of gasdermin D (GSDMD) and IL‐1β in BALF cells were detected by Western blotting. (b) The representative images of BALF cell apoptosis analyzed by flow cytometry with the staining of annexin V and propidium iodide (PI). (c,d) The statistical analysis of percentage of cells positive for annexin V but not PI and cells positive for both annexin V and PI (n = 3/group). (e) The total protein levels in BALF were tested by bicinchoninic acid (BCA) protein assay kits (n = 4–5/group). (f) Lung homogenates inoculated on blood agar plates, and bacterial loads were determined by colony‐forming units (CFU) analysis (n = 4–5/group). (g,h) Levels of proinflammatory cytokines IL‐6, tumor necrosis factor (TNF)‐α and IL‐1β in lungs were detected by enzyme‐linked immunosorbent assay (ELISA) kits (n = 4–5/group). *p < 0.05, **p < 0.01, ***p < 0.001 above all based on Tukey’s multiple comparisons; NS = not significant

DISCUSSION

At present, the prevention and treatment of influenza/S. pneumoniae co‐infection mainly depend upon the use of vaccines and antibiotics. The efficacy of vaccines against bacterial pathogens is limited to the vaccine strains, and some bacterial vaccines have diminished effectiveness in influenza virus‐infected hosts [20, 21, 22]. A series of studies have shown that current clinical treatment was difficult to control regarding both pathogen load and excessive inflammatory response concurrently in viral and bacterial co‐infection [23, 24, 25, 26]. Hence, effective approaches to protect from influenza/S. pneumoniae co‐infection are still necessary. IL‐4 has been shown to play anti‐inflammatory roles in acute lung injury [27, 28], acute kidney injury [29] and multiple sclerosis [14], but there have been few studies concerning the role of IL‐4 in Gram‐positive bacterial infection or viral infection, as well as co‐infection. Our study, for the first time to our knowledge, highlights the protective role of IL‐4 in the development of influenza/S. pneumoniae co‐infection.

In this study, we demonstrated IL‐4 deficiency resulted in significantly decreased survival and increased lung bacterial loads of co‐infected mice without altering influenza virus replication. IL‐4 deficiency also led to heightened proinflammatory cytokine release, including IL‐6, IL‐1β and TNF‐α in early co‐infection. It has been reported that large amounts of proinflammatory cytokine levels are associated with the deterioration of many infectious diseases, including severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) and COVID‐19 [30]. IL‐6, IL‐1β and TNF‐α are the main proinflammatory cytokines associated with inflammatory damage in influenza/MERS co‐infection and S. pneumonia [31, 32, 33]. Hence, IL‐4 could play a protective role in influenza/S. pneumoniae co‐infection through a significant anti‐inflammatory effect.

IL‐4 is the main cytokine involved in the pathogenesis of allergic airway disease [34]. Significant alterations of co‐infection were noted in the allergic mice, including reduced morbidity and mortality, bacterial burden, maintenance of alveolar macrophages and reduced lung inflammation and damage [35]. Consistent with this, another study also showed that allergic airway disease (AAD) improved survival of co‐infected mice. Mice with AAD had significantly deceased proinflammatory responses during infection [36]. The researches above suggest that IL‐4 may play a protective role in influenza and S. pneumoniae co‐infection via significant anti‐inflammatory effect, which was confirmed in our study.

Neutrophils and macrophages constitute the first line of host defense against invading pathogens. Meanwhile, they are also the main cells responsible for tissue inflammatory damage; therefore, we focused upon changes in these two types of cells. A few researches have demonstrated the correlation between increased neutrophil recruitment and increased susceptibility of co‐infected mice at days 6–7 after influenza infection [37, 38, 39]. Alveolar macrophages (AMs) perform a critical role in keeping homeostasis and host defense against pulmonary infections, including influenza, Staphylococcus aureus and S. pneumoniae, as well as co‐infections [40, 41, 42, 43, 44]. The recruited inflammatory macrophages (IMs) contribute to both inflammatory injury and pathogen clearance [45, 46, 47]. Our results demonstrate that IL‐4 deficiency led to increased inflammatory cell infiltration and CCL2 level 1 day after co‐infection accompanied by increased bacterial load. Consistently, IL‐4−/− co‐infected mice still showed significantly increased immune cell infiltration and bacterial load 3 days after co‐infection, which demonstrated that the recruited inflammatory immune cells in IL‐4−/− co‐infected mice failed to eliminate bacterial but led to severe inflammatory injury.

The increased recruitment of inflammatory cells appears to contradict the results of the increased bacterial load. There are reports showing that the survival of immune cells can affect the susceptibility to post‐influenza bacteria co‐infection [17, 18]. The connection among immune cell survival, bacterial clearance and inflammation in other infectious diseases was also reported by researches [48, 49]. Therefore, we tested BALF cell death. The death pattern exhibited differently between single PR8 and 19F infections. Single PR8 infection led to more annexin V+PI+ cell death, while single 19F led to more annexin V+PI− cell death. In co‐infection, the death pattern was similar to that of single 19F infection.

Super‐challenge of 19F led to more inflammatory cell infiltration which could replace the dead cells 3 days post PR8 infection and exhibit a similar death pattern of single 19F infection 1 day after super‐challenge. IL‐4 deficiency did not affect the BALF cell death in single infections. In contrast, BALF cells of co‐infected IL‐4−/− mice showed an increased proportion of cells that were positive for both annexin V and PI (annexin V+PI+) compared with WT counterparts, which indicate that IL‐4 may exert protection by inhibiting BALF cell death. The results also showed that single PR8‐infected mice showed more annexin V+/PI+ cell death than co‐infection, and 19F‐infected mice showed similar annexin V+/PI+ cell death with co‐infection. However, the lung injury of single infected mice was slightly lower than that in co‐infected mice. The results above indicated that the worse lung injury and higher death rate in IL‐4−/− co‐infected mice was not directly caused by increased BALF cell death, but the uncontrollable bacterial load led by it.

We further demonstrate that IL‐4 could decrease immune cell death via inhibiting immune cell pyroptosis. IL‐4 can inhibit the expression of GSDMD, IL‐1β and caspase‐1 in immune cells. Pyroptosis inhibitor disulfiram can rescue the increased immune cell death induced by IL‐4 deficiency in co‐infection. Pyroptosis is a programmed cell death accompanied by amounts of inflammatory cytokine release. Pyroptosis of macrophages was reported to exacerbate acute lung injury and increase lung inflammation by augmenting concentrations of cytokines IL‐6, TNF‐α and IL‐1β [50]. Recent research has also reported that combination effect of leukocytosis and pyroptosis may perform as a major contributor to cytokine storms in COVID‐19 patients [51]. A series of works demonstrate that pyroptosis was involved in the outcome, pathogen clearance and inflammatory response in infectious diseases [19].

Our previous results suggested that the increased bacterial load was caused by increased immune cell death in co‐infected IL‐4−/− mice. Consistent with this, disulfiram and rIL‐4 treatments significantly reduced the bacteria loads in co‐infected IL‐4−/− mice. BALF protein and inflammatory cytokine levels, including IL‐6, TNF‐α and IL‐1β, decreased significantly after disulfiram and rIL‐4 treatment in co‐infected IL‐4−/− mice, which indicated milder inflammatory injury. Collectively, our results demonstrate that pyroptosis exerted a harmful role in influenza/S. pneumoniae co‐infection. Increased immune cell pyroptosis led to decreased bacterial clearance and early elevated cytokine levels, which resulted in more inflammatory cell infiltration accompanied later by aggravated lung destruction in co‐infected IL‐4−/− mice.

To summarize, our results demonstrate a protective effect of IL‐4 in influenza/S. pneumoniae co‐infection. IL‐4 significantly decreased the S. pneumoniae burden and robust inflammatory response in mice via suppressing immune cell pyroptosis in influenza/S. pneumoniae co‐infection. Our study also shows the potential therapeutic prospect of IL‐4 in influenza/S. pneumoniae co‐infection.

ETHICS STATEMENT

All animal experiments described in this study were approved by the Animal Care and Use Committee of Chongqing Medical University and performed under strict accordance to the regulations of Guide for the Care and Use of Laboratory Animals.

CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS

Yang Peng and Xiaofang Wang conceived this study and wrote the manuscript. Xuemei Zhang, Yibing Yin supervised and conducted this study. Yang Peng, Xiaofang Wang, Hong Wang, Wenchun Xu, Kaifeng Wu, Xuemei Gou did the experiments, collected and analyzed the data.

Supporting information

Fig S1

Click here for additional data file. (4.4MB, tif)

Fig S2

Click here for additional data file. (994.9KB, tif)

Fig S3

Click here for additional data file. (2.5MB, tif)

Fig S4

Click here for additional data file. (1.9MB, tif)

Fig S5

Click here for additional data file. (2.4MB, tif)

Supplementary Material

Click here for additional data file. (17.3KB, docx)

ACKNOWLEDGEMENTS

This work was supported by China Postdoctoral Science Foundation (2019M662206) and Anhui Provincial Postdoctoral Science Research Project (2019B377). The authors thank the experimental platform provided by Chongqing Medical University.

Peng Y, Wang X, Wang H, Xu W, Wu K, Go X, et al. Interleukin‐4 protects mice against lethal influenza and Streptococcus pneumoniae co‐infected pneumonia. Clin Exp Immunol. 2021;205:379–390. 10.1111/cei.13628

Yang Peng and Xiaofang Wang contributed equally to this work.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  • 1.Robinson KM, Ramanan K, Clay ME, McHugh KJ, Rich HE, Alcorn JF. Novel protective mechanism for interleukin‐33 at the mucosal barrier during influenza‐associated bacterial superinfection. Mucosal Immunol. 2018;11:199–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chertow DS, Memoli MJ. Bacterial coinfection in influenza: a grand rounds review. JAMA 2013;309:275–82. [DOI] [PubMed] [Google Scholar]
  • 3.Morens DM, Taubenberger JK, Fauci AS. Predominant role of bacterial pneumonia as a cause of death in pandemic influenza: implications for pandemic influenza preparedness. J Infect Dis. 2008;198:962–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Robinson KM, Kolls JK, Alcorn JF. The immunology of influenza virus‐associated bacterial pneumonia. Curr Opin Immunol. 2015;34:59–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Braciale TJ, Sun J, Kim TS. Regulating the adaptive immune response to respiratory virus infection. Nat Rev Immunol. 2012;12:295–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.McCullers JA. The co‐pathogenesis of influenza viruses with bacteria in the lung. Nat Rev Microbiol. 2014;12:252–62. [DOI] [PubMed] [Google Scholar]
  • 7.Kopf M, Le Gros G, Bachmann M, Lamers MC, Bluethmann H, Köhler G. Disruption of the murine IL‐4 gene blocks Th2 cytokine responses. Nature 1993;362:245–8. [DOI] [PubMed] [Google Scholar]
  • 8.Kühn R, Rajewsky K, Müller W. Generation and analysis of interleukin‐4 deficient mice. Science 1991;254:707–10. [DOI] [PubMed] [Google Scholar]
  • 9.Tepper RI, Levinson DA, Stanger BZ, Campos‐Torres J, Abbas AK, Leder P. IL‐4 induces allergic‐like inflammatory disease and alters T cell development in transgenic mice. Cell 1990;62:457–67. [DOI] [PubMed] [Google Scholar]
  • 10.Donlan AN, Simpson ME, Petri WA Jr. Type 2 cytokines IL‐4 and IL‐5 reduce severe outcomes from Clostridiodes difficile infection. Anaerobe 2020;66:102275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rolot M, Dougall AM, Chetty A, Javaux J, Chen T, Xiao X, et al. Helminth‐induced IL‐4 expands bystander memory CD8+ T cells for early control of viral infection. Nat Commun. 2018;9:4516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ritter M, Tamadaho RS, Feid J, Vogel W, Wiszniewsky K, Perner S, et al. IL‐4/5 signalling plays an important role during Litomosoides sigmodontis infection, influencing both immune system regulation and tissue pathology in the thoracic cavity. Int J Parasitol. 2017;47:951–60. [DOI] [PubMed] [Google Scholar]
  • 13.Wu X, Feng X, He Y, Gao Y, Yang S, Shao Z, et al. IL‐4 administration exerts preventive effects via suppression of underlying inflammation and TNF‐α‐induced apoptosis in steroid‐induced osteonecrosis. Osteoporos Int. 2016;27:1827–37. [DOI] [PubMed] [Google Scholar]
  • 14.Casella G, Colombo F, Finardi A, Descamps H, Ill‐Raga G, Spinelli A, et al. Extracellular vesicles containing IL‐4 modulate neuroinflammation in a mouse model of multiple sclerosis. Mol Ther. 2018;26:2107–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Czimmerer Z, Varga T, Kiss M, Vázquez CO, Doan‐Xuan QM, Rückerl D, et al. The IL‐4/STAT6 signaling axis establishes a conserved microRNA signature in human and mouse macrophages regulating cell survival via miR‐342‐3p. Genome Med. 2016;8:63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hwang I, Yang J, Hong S, Ju Lee E, Lee SH, Fernandes‐Alnemri T, et al. Non‐transcriptional regulation of NLRP3 inflammasome signaling by IL‐4. Immunol Cell Biol. 2015;93:591–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gou X, Yuan J, Wang H, Wang X, Xiao J, Chen J, et al. IL‐6 During influenza‐streptococcus pneumoniae co‐infected pneumonia‐A protector. Front Immunol. 2019;10:3102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang X, Yuan J, Wang H, Gan N, Zhang Q, Liu B, et al. Progranulin decreases susceptibility to Streptococcus pneumoniae in influenza and protects against lethal coinfection. J Immunol. 2019;203:2171–82. [DOI] [PubMed] [Google Scholar]
  • 19.Man SM, Karki R, Kanneganti TD. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev. 2017;277:61–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li R, Lim A, Phoon MC, Narasaraju T, Ng JK, Poh WP, et al. Attenuated Bordetella pertussis protects against highly pathogenic influenza A viruses by dampening the cytokine storm. J Virol. 2010;84:7105–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Metzger DW, Furuya Y, Salmon SL, Roberts S, Sun K. Limited efficacy of antibacterial vaccination against secondary serotype 3 pneumococcal pneumonia following influenza infection. J Infect Dis. 2015;212:445–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mina MJ, Klugman KP, McCullers JA. Live attenuated influenza vaccine, but not pneumococcal conjugate vaccine, protects against increased density and duration of pneumococcal carriage after influenza infection in pneumococcal colonized mice. J Infect Dis. 2013;208:1281–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ghoneim HE, McCullers JA. Adjunctive corticosteroid therapy improves lung immunopathology and survival during severe secondary pneumococcal pneumonia in mice. J Infect Dis. 2014;209:1459–68. [DOI] [PubMed] [Google Scholar]
  • 24.Karlström A, Boyd KL, English BK, McCullers JA. Treatment with protein synthesis inhibitors improves outcomes of secondary bacterial pneumonia after influenza. J Infect Dis. 2009;199:311–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Karlström A, Heston SM, Boyd KL, Tuomanen EI, McCullers JA. Toll‐like receptor 2 mediates fatal immunopathology in mice during treatment of secondary pneumococcal pneumonia following influenza. J Infect Dis. 2011;204:1358–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu X, He Y, Xiao K, White JR, Fusco DN, Papanicolaou GA. Effect of linezolid on clinical severity and pulmonary cytokines in a murine model of influenza A and Staphylococcus aureus coinfection. PLOS ONE. 2013;8:e57483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.D’Alessio FR, Craig JM, Singer BD, Files DC, Mock JR, Garibaldi BT, et al. Enhanced resolution of experimental ARDS through IL‐4‐mediated lung macrophage reprogramming. Am J Physiol Lung Cell Mol Physiol. 2016;310:L733–L746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Liu H, He Y, Lu C, Zhang P, Zhou C, Ni Y, et al. Efficacy of pulmonary transplantation of engineered macrophages secreting IL‐4 on acute lung injury in C57BL/6J mice. Cell Death Dis. 2019;10:664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhang M‐Z, Wang X, Wang Y, Niu A, Wang S, Zou C, et al. IL‐4/IL‐13–mediated polarization of renal macrophages/dendritic cells to an M2a phenotype is essential for recovery from acute kidney injury. Kidney Int. 2017;91:375–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hu B, Huang S, Yin L. The cytokine storm and COVID‐19. J Med Virol. 2021;93:250–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lee MH, Arrecubieta C, Martin FJ, Prince A, Borczuk AC, Lowy FD. A postinfluenza model of Staphylococcus aureus pneumonia. J Infect Dis. 2010;201:508–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Goodman RB, Pugin J, Lee JS, Matthay MA. Cytokine‐mediated inflammation in acute lung injury. Cytokine Growth Factor Rev. 2003;14:523–35. [DOI] [PubMed] [Google Scholar]
  • 33.Banerjee A, Stevenaert F, Pande K, Haghjoo E, Antonenko S, Gorman DM, et al. Modulation of paired immunoglobulin‐like type 2 receptor signaling alters the host response to Staphylococcus aureus‐induced pneumonia. Infect Immun. 2010;78:1353–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kips JC, Tournoy KG, Pauwels RA. New anti‐asthma therapies: suppression of the effect of interleukin (IL)‐4 and IL‐5. Eur Respir J. 2001;17:499–506. [DOI] [PubMed] [Google Scholar]
  • 35.LeMessurier KS, Iverson AR, Chang TC, Palipane M, Vogel P, Rosch JW, et al. Allergic inflammation alters the lung microbiome and hinders synergistic co‐infection with H1N1 influenza virus and Streptococcus pneumoniae in C57BL/6 mice. Sci Rep. 2019;9:19360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Roberts S, Salmon SL, Steiner DJ, Williams CM, Metzger DW, Furuya Y. Allergic airway disease prevents lethal synergy of influenza A virus‐Streptococcus pneumoniae coinfection. MBio 2019;10:e01335‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Damjanovic D, Lai R, Jeyanathan M, Hogaboam CM, Xing Z. Marked improvement of severe lung immunopathology by influenza‐associated pneumococcal superinfection requires the control of both bacterial replication and host immune responses. Am J Pathol. 2013;183:868–80. [DOI] [PubMed] [Google Scholar]
  • 38.Kudva A, Scheller EV, Robinson KM, Crowe CR, Choi SM, Slight SR, et al. Influenza A inhibits Th17‐mediated host defense against bacterial pneumonia in mice. J Immunol. 2011;186:1666–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.McCullers JA, Rehg JE. Lethal synergism between influenza virus and Streptococcus pneumoniae: characterization of a mouse model and the role of platelet‐activating factor receptor. J Infect Dis. 2002;186:341–50. [DOI] [PubMed] [Google Scholar]
  • 40.Ghoneim HE, Thomas PG, McCullers JA. Depletion of alveolar macrophages during influenza infection facilitates bacterial superinfections. J Immunol. 2013;191:1250–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Huang FF, Barnes PF, Feng Y, Donis R, Chroneos ZC, Idell S, et al. GM‐CSF in the lung protects against lethal influenza infection. Am J Respir Crit Care Med. 2011;184:259–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Jakab GJ. Sequential virus infections, bacterial superinfections, and fibrogenesis. Am Rev Respir Dis. 1990;142:374–9. [DOI] [PubMed] [Google Scholar]
  • 43.Schneider C, Nobs SP, Heer AK, Kurrer M, Klinke G, van Rooijen N , et al. Alveolar macrophages are essential for protection from respiratory failure and associated morbidity following influenza virus infection. PLOS Pathog. 2014;10:e1004053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sun K, Metzger DW. Influenza infection suppresses NADPH oxidase‐dependent phagocytic bacterial clearance and enhances susceptibility to secondary methicillin‐resistant Staphylococcus aureus infection. J Immunol. 2014;192:3301–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schiwon M, Weisheit C, Franken L, Gutweiler S, Dixit A, Meyer‐Schwesinger C, et al. Crosstalk between sentinel and helper macrophages permits neutrophil migration into infected uroepithelium. Cell 2014;156:456–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hua X, Vijay R, Channappanavar R, Athmer J, Meyerholz DK, Pagedar N, et al. Nasal priming by a murine coronavirus provides protective immunity against lethal heterologous virus pneumonia. JCI Insight. 2018;3:e99025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bain CC, Bravo‐Blas A, Scott CL, Perdiguero EG, Geissmann F, Henri S, et al. Constant replenishment from circulating monocytes maintains the macrophage pool in the intestine of adult mice. Nat Immunol. 2014;15:929–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chen W, Bichara DA, Suhardi J, Sheng P, Muratoglu OK. Effects of vitamin E‐diffused highly cross‐linked UHMWPE particles on inflammation, apoptosis and immune response against S. aureus. Biomaterials 2017;143:46–56. [DOI] [PubMed] [Google Scholar]
  • 49.Feng H, Guo L, Song Z, Gao H, Wang D, Fu W, et al. Caveolin‐1 protects against sepsis by modulating inflammatory response, alleviating bacterial burden, and suppressing thymocyte apoptosis. J Biol Chem. 2010;285:25154–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.He X, Qian Y, Li Z, Fan EK, Li Y, Wu L, et al. TLR4‐upregulated IL‐1β and IL‐1RI promote alveolar macrophage pyroptosis and lung inflammation through an autocrine mechanism. Sci Rep. 2016;6:31663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yap JKY, Moriyama M, Iwasaki A. Inflammasomes and pyroptosis as therapeutic targets for COVID‐19. J Immunol. 2020;205:307–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig S1

Click here for additional data file. (4.4MB, tif)

Fig S2

Click here for additional data file. (994.9KB, tif)

Fig S3

Click here for additional data file. (2.5MB, tif)

Fig S4

Click here for additional data file. (1.9MB, tif)

Fig S5

Click here for additional data file. (2.4MB, tif)

Supplementary Material

Click here for additional data file. (17.3KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES