Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Aug 19.
Published in final edited form as: Br J Haematol. 2018 Nov 15;184(4):605–615. doi: 10.1111/bjh.15677

SET alpha and SET beta mRNA isoforms in chronic lymphocytic leukaemia

Danielle M Brander 1,2, Daphne R Friedman 1,2,3, Alicia D Volkheimer 3, Dale J Christensen 1, Laura Z Rassenti 4, Thomas J Kipps 4, Eross Guadalupe 1, Youwei Chen 1, Dadong Zhang 1,2, Xi Wang 1,2, Carter Davis 1, Kouros Owzar 1,2, J Brice Weinberg 1,2,3
PMCID: PMC8375670  NIHMSID: NIHMS995038  PMID: 30443898

Summary

Alteration in RNA splicing is implicated in carcinogenesis and progression. Mutations in spliceosome genes and alternative splicing of other genes have been noted in chronic lymphocytic leukaemia (CLL), a common B cell malignancy with heterogeneous outcomes. We previously demonstrated that differences in the amount of SET oncoprotein (a physiological inhibitor of the serine/threonine phosphatase, PP2A) is associated with clinical aggressiveness in patients with CLL. It is unknown if alternative splicing of gene transcripts regulating kinases and phosphatases affects disease pathobiology and CLL progression. We show here for the first time that mRNA levels of the alternatively spliced SET isoforms, SETA and SETB (SETα and SETβ), significantly correlate with disease severity (overall survival and time-to-first-treatment) in CLL patients. In addition, we demonstrate that relative increase of SETA to SETB mRNA can discriminate patients with a more aggressive disease course within the otherwise favourable CLL risk classifications of IGHV mutated and favourable hierarchical fluorescence in situ hybridisation groups. We validate our finding by showing comparable relationships of SET mRNA with disease outcomes using samples from an independent CLL cohort from a separate institution. These findings indicate that alternative splicing of SET, and potentially other signalling cascade molecules, influences CLL biology and patient outcomes.

Keywords: Chronic lymphocytic leukaemia, SET, PP2A, alternative RNA splicing, phosphatase

Introduction

Chronic lymphocytic leukaemia (CLL) is characterized by marked clinical heterogeneity whereby some patients never require treatment and have life expectancies similar to their age-matched peers, while other patients experience rapid progression and treatment resistance with significantly shortened survival.(The International CLL-IPI Working Group 2016, Chiorazzi, et al 2005, Parikh, et al 2016, Pflug, et al 2014, Thompson, et al 2016) Despite significant advances in CLL, including available novel therapeutics, there remains great variability in outcomes; a better understanding of disease pathobiology is needed to identify these disparate groups.

Alternative RNA splicing can alter normal cellular functions, cooperating with other oncogenic progresses to drive leukaemogenesis or cancer progression.(Hanahan and Weinberg 2011, Surget, et al 2013) In both adult and paediatric AML, for instance, relative change in the expression of the different alternatively spliced isoforms of BIRC5 (survivin), an inhibitor of apoptosis protein, is related to risk of aggressive disease relapse and rapid progression with shortened patient survivals.(Beghini, et al 2000, Moore, et al 2014, Wagner, et al 2006) In lymphoid malignancies, such as CLL, mutations in certain spliceosome-related genes and alternative splicing also appear to modulate disease severity. For example, in CLL, mutations in the 3’ region of NOTCH1 induce aberrant NOTCH1 mRNA splice variants(Puente, et al 2015) and SF3B1 mutations induce alternative splicing in numerous genes.(Wang, et al 2017) Both NOTCH1 and SF3B1 mutations are associated with inferior CLL-specific clinical outcomes.

Recent advances in the understanding of the critical role that B-cell receptor signalling and modulation of apoptosis play in CLL has led to development and use of novel therapies in this malignancy.(Byrd, et al 2013, Furman, et al 2014) SET protein, a potent endogenous inhibitor of protein phosphatase 2A (PP2A), is a known regulator of oncogenic signalling, apoptosis and the cell cycle. For this reason, we previously evaluated SET protein in CLL, and demonstrated that the SETα and SETβ proteins are expressed at higher levels in malignant CLL and non-Hodgkin lymphoma (NHL) cells compared to normal B cells.(Christensen, et al 2011)

Because of the growing appreciation of RNA splicing as an oncogenic mechanism, we here measured SETA and SETB mRNA expression in CLL cells from patients attending the Duke University or Durham Veteran’s Affairs Medical Centers (Duke/DurVAMC), and from patients in an independent cohort of CLL patients from the Moores Cancer Center of the University of California San Diego (UCSD). Additionally, we evaluated the extent to which relative expression of SET isoforms influences disease progression within the context of established clinical and molecular prognostic factors. This evaluation connects the oncogenic processes of alternative splicing and second messenger signalling on the cellular level with the heterogeneity of disease aggressiveness that can be observed in patients with CLL.

Methods

Patient Inclusion & CLL cell preparation

Patients diagnosed with CLL at Duke/DurVAMC and the UCSD, were enrolled on Institutional Review Board-approved protocols to collect clinical data and peripheral blood. All patients provided written, informed consent prior to enrolment in accordance with the Declaration of Helsinki. Indications for treatment were based on the International Workshop on CLL guidelines(Hallek, et al 2008), but selection and timing of therapy was at the discretion of the treating physicians. Some patients had treatment prior to being evaluated at the participating centres. Time to first treatment (TTFT) was defined as the length of time from the date of CLL diagnosis to initiation of first treatment. Overall survival (OS) was defined as the length of time from diagnosis to death from any cause. The follow-up time was the time from initial diagnosis until the time of death or the time of last contact.

CLL cells from the first collected sample were purified as previously published. In brief, Duke/DurVAMC CLL cells were enriched using the RosetteSep® B cell enrichment cocktail (Stem Cell Technologies, Vancouver, BC, Canada) according to the manufacturer’s directions, yielding a CLL purity by flow cytometry (CD5+CD19+ B-cells) of greater than 95%(Christensen, et al 2011). At UCSD, the leukaemia cells were isolated by ficoll/Hypaque density gradient technique.(Rassenti, et al 2004) Patient characteristics and prognostic markers were obtained from clinical records, with the IGHV mutation status and CD38 expression levels determined on the Duke/DurVAMC samples as previously described.(Volkheimer, et al 2007) In every case, the first sample available was utilized to calculate CD38 expression levels and determine positivity (≥30% considered positive).

Quantitative polymerase chain reaction measurement of SET mRNA

Primers and probes for quantitative real time polymerase chain reaction (RT-qPCR) designed to amplify only the alpha or beta forms of SET are described in Figure 1 and its legend. Total RNA was extracted from pellets of 10 × 106 CLL cells using RNeasy Mini Kit (Qiagen, Germantown, MD) following the manufacturer’s instructions. cDNA was prepared with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using the manufacturer’s protocol, with inclusion of the QiaShredder (Qiagen) homogenization and the on-column DNase digestion with RNase-Free DNase Set (Qiagen). After isolation, the nucleic acid concentration of each sample was determined using a NanoDrop 1000 (Thermo Scientific, Waltham, MA, USA). Quantitative PCR was performed with 1 μg of RNA reverse transcribed using Transcriptor Universal cDNA Master (Roche, Indianapolis, IN) followed by utilization of TaqMan master mix (Applied Biosystems) and following the manufacturer’s protocol. Fold changes were calculated using ΔΔCt method. For quantification, SETA was cloned onto pCMV6-XL5 plasmid and SETB was cloned in the pcDNA3.1 plasmid. Absolute copy numbers were calculated based on OD and number of bases. Serial ten-fold dilutions of plasmid DNA were used in the qPCR to produce a standard curve for absolute quantification of CLL samples.

Figure 1: SETA, SETB and total primers and probes.

Figure 1:

Open in a new tab

The SETA forward primer is located within exon 1, which is unique to the alpha form. The SETB forward primer is located within exon 2, which is unique to the beta form. The reverse primer for both SETA and SETB lies within exon 3, which is common to both forms of SET. The SETA probe lies partially in the alpha exon and partially in the common exon. The SETB probe lies entirely in the beta exon. A primer/probe combination was also designed in order to amplify all SET mRNA isoforms. The forward primer, the reverse prime, and the probe all lie in the common exon. All primers and probes were purchased from Integrated DNA Technologies (Coralville, Iowa)

SETA forward primer: AGAAGAAACCAAGACCACCTCCTG

Reverse primer for both SETA and SETB: GTGTTCAATCGCTTCTTGCTGTTC

SETA probe: TGCAGGCTTGCCGAAGAAGGGAGAAA

SETB probe: AAGGAGCTCAACTCCAACCACGACG

Forward primer for all SET isoforms: CCA TCT TCG AAG TCC ACC GAA ATC

Reverse primer for all SET isoforms: GCC TCT TCC TGC TGG CTT TAT T

Probe for all SET isoforms: GGA TTT GAC GAA ACG TTC GAG TCA AAC GCA

Statistical Analyses

For the primary inferential analysis of TTFT and OS, the SETA/SETB mRNA ratio was analysed as a continuous variable. The dichotomized data were used for visual display of the effects in Kaplan-Meier plots (high vs. low SETA/SETB mRNA ratio); an individual patient’s CLL cell SETA/SETB mRNA ratio at or above the median ratio for the group was considered a “high SET ratio;” if the SETA/SETB was below the median ratio it was considered a “low SET ratio.” The secondary analysis was to test for an interaction effect of SETA/SETB ratio with other established CLL risk biomarkers.

The primary inferential analyses were based on the continuous variables, and the dichotomized data were used for visual display of the effects in Kaplan-Meier plots. The secondary analysis was to test for an interaction effect of SETA/SETB mRNAratio with other established CLL risk biomarkers including Rai stage, IGHV mutation status, CD38 positivity (≥30% considered positive) and favourable vs. unfavourable A(unfavourable = del(17p) or del(11q) alone or in any combination, or three or more abnormalities) with respect to TTFT and OS. This interaction testing was to determine if the effect of the effect of the SETA/SETB mRNA on patient outcomes was dependent on the other prognostic variables (positive interaction).

The distributions of continuous variables were assessed using boxplot, and log2 transformation was used for skewed variables. All statistical analyses were conducted using the R statistical environment v3.3.2 (https://www.r-project.org/). Cox proportional hazard regression was used for the time to event analyses using the R extension package survival v2.40. (Cox & Oakes 1984, Therneau 2016) Score test p-values and Wald test p-values were reported for univariate analysis and interaction analyses, respectively. P-values were not adjusted for multiple testing.

Results

Patient characteristics

The Duke/DurVAMC combined population was analysed independently from the validation cohort of UCSD patients. The median SETA/SETB mRNA ratio (SETA/B) of the Duke/DurVAMC population was 0.94 (range = 0.13 – 33.50) and the median for the UCSD population was 0.93 (range = 0.24 – 19.20) (p = not significant). Patient characteristics of the analysed Duke/DurVAMC (n=307) and UCSD cohorts (n=166) are summarized in Table I. FISH is reported hierarchically as detailed in Table I footnotes. The cohorts were representative of other published CLL populations with regards to age and distribution of prognostic factors.(Molica, et al 2016) There were no significant differences between the Duke/DurVAMC and UCSD patients relative to sex (32% vs. 40% female, respectively, p=0.1) and low risk Rai stage 0 at diagnosis. Patients in the San Diego cohort had higher CD38 positivity than those in the Duke/DurVAMC cohort (28% vs. 19%; p=. 047), but the percent of patients with the adverse marker unmutated IGHV (UM-IGHV) was not significantly different between the groups (43% vs. 39%, p=0.529).

Table I.

Patient characteristics Duke/DurVAMC and UCSD

Duke/DurVAMC UCSD
Number of patients 310 166
Age, years; median, range 68 (33–94) n/a
Female 32% 40%
Rai Stage
(N=302, Duke; N=134 UCSD) n (%) n (%)
    0 176 (58%) 81 (60%)
    I-IV 126 (42%) 53 (40%)
CD38 positive
(N=308, Duke; N=165 UCSD) 60 (19%) 46 (28%)
IGHV unmutated
(N=285, Duke; N=166 UCSD) 122 (43%) 65 (39%)
Hierarchical FISH
(N=252, Duke; N=131 UCSD) n (%) n (%)
    del(17p) 38 (15%) 14 (11%)
    del(11q) 34 (14%) 7 (5%)
    trisomy 12 33 (13%) 10 (8%)
    normal 43 (17%) 32 (24%)
    del(13q) alone 104 (41%) 68 (52%)
Open in a new tab

For hierarchical FISH, groups are listed in order of least favourable (highest risk) to most favourable (lowest risk). del(17p) is presence of any deletion of 17p, alone or in combination with other FISH abnormalities. del(11q) is any deletion of 11q, alone or in combination, but without del(17p). Trisomy 12 is trisomy 12 alone or in combination with del(13q). Normal indicates no FISH abnormalities were detected.

Duke/DurVAMC: Duke University or Durham Veteran’s Affairs Medical Centers; FISH: fluorescence in situ hybridisation; UCSD: University of California San Diego

Increased SETA isoform mRNA relative to SETB isoform mRNA is associated with CLL aggressiveness

The median follow-up time for the Duke/DurVAMC patients was 16.3 years. Established biomarkers and the SETA/B mRNA ratio were tested in univariate analyses for TFTT in both cohorts. As others and we have noted before, UM-IGHV, CD38 positivity (CD38+) and Rai stage I-IV at diagnosis were significantly associated with shorter times to first treatment in both groups.(Chiorazzi, et al 2005, Weinberg, et al 2007) In the Duke/DurVAMC cohort, patients with unfavourable FISH [del(17p), del(11q) or three or more than 3 cytogenetic abnormalities by FISH] had a significantly shorter TTFT and OS (Table II), but those with del(17p) alone did not have a shorter TTFT. The number of patients with del(17p) was small, and this may have limited the power of this analysis.

Table II.

SET mRNA isoform ratio and established CLL prognostic markers for time to first treatment in Duke/Durham VAMC cohort

Time to first treatment Overall survival
Median time [years, (95% CI)] HR P value Median time [years (95% CI)] HR P value
SETA/B mRNA ratio
    high 4.3 (3.3–5.5) [n=155] 1.7 (1.3–2.3) < 0.001 15.3 (11.9–18.8) [n=155] 1.7 (1.2–2.5) 0.005
    low 9.3 (5.9–14.0) [n=153] 22.6 (19.3-) [n=154]
Rai stage
    I-IV 3.3 (2.2–4.9) [n=126] 2.3 (1.7–3.1) < 0.001 13.1 (11.3–18.0) [n=126] 2.2 (1.5–3.2) < 0.001
    0 8.7 (6.2–13.5) [n=175] 28.3 (19.3-) [n=176]
CD38 expression
    positive 2.6 (1.6–5.4) [n=59] 2.1 (1.5–2.9) < 0.001 13.3 (9.2-) [n=59] 2.0 (1.3–3.0) 0.001
    negative 6.3 (5.2–10.8) [n=248] 19.3 (16.3-) [n=249]
IGHV mutation status
    unmutated 3.1 (2.4–3.9) [n=122] 3.3 (2.5–4.6) < 0.001 11.9 (10.3–18.8) [n=122] 2.5 (1.6–3.7) < 0.001
    mutated 11.9 (9.3–18.5) [n=162] 28.3 (20.8-) [n=163]
FISH group
    unfavourable 4.4 (3.1–6.1) [n=67] 1.6 (1.1–2.2) 0.01 14.5 (9.6–18.0) [n=67] 2.3 (1.5–3.6) < 0.001
    favourable 7.3 (5.5–10.8) [n=182] 28.3 (19.3-) [n=183]
Open in a new tab

CI: confidence interval: CLL: chronic lymphocytic leukaemia; Duke/DurVAMC: Duke University or Durham Veteran’s Affairs Medical Centers; FISH: fluorescence in situ hybridisation.

We measured SETA and SETB mRNA using isoform-specific RT-PCR, and evaluated both isoforms with respect to their influence on clinical outcomes by calculating a ratio of SETA to SETB. Patients with higher SETA/B mRNA ratio assessed as a continuous variable had significantly shorter TTFT, [hazard ratio (HR) 1.2, p=0.001]. Results of analyses of the SETA/B mRNA ratio as a dichotomous variable in TTFT and OS (for illustrative purposes only) is displayed as Kaplan-Meier plots in Figure 2 and included in Table II. Patients with a dichotomized high SETA/B mRNA ratio had a median TTFT of 4.3 years (3.5–5.5), while patients with a low SETA/B mRNA ratio had a median TTFT of 9.3 years (5.9–14.0); [HR 1.7 (1.3–2.3), p<0.001]. Patients from the Duke/DurVAMC cohort with dichotomized high SETA/B mRNA ratio had a significantly shorter OS [15.3 years (11.9–18.1)] compared to patients with low SETA/B mRNA ratio [22.6 years (19.3-)], [HR 1.7 (1.2–2.5), p=0.005]. To help validate our SET mRNA PCR assay, we assessed 276 individual purified CLL cell samples (Christensen, et al 2011) for both SETA/B protein by immunoblot and SETA/B mRNA by RT-PCR. Results showed significant correlation of the SETA/B protein by immunoblot assay and SETA/B mRNA by RT-PCR assay (p < 0.0005, R = 0.206).

Figure 2. SETA/B mRNA ratio analysed relative to time to TTFT and OS for the Duke/DurVAMC cohort (top) and the UCSD cohort (bottom).

Figure 2.

Open in a new tab

This is displayed as a dichotomous variable for illustrative purposes with the respective p-values for significance. High SETA/B mRNA ratio was also primarily assessed as a continuous variable in the Duke/DurVAMC cohort in which high SETA/B mRNA ratio had significantly shorter TTFT [hazard ratio (HR) 1.2 (1.2–1.3), p=0.001]. Duke/DurVAMC patients with higher SETA/B mRNA ratio as a continuous variable also had a significantly shorter OS [HR 1.2 (1.1–1.4), p < 0.001). Analysis of SET mRNA in the UCSD patients revealed that a high SETA/B mRNA ratio as a continuous variable was also significantly associated with shorter TTFT [HR 1.3 (1.0–1.6), p=0.02]. Duke/DurVAMC: Duke University or Durham Veteran’s Affairs Medical Centers; OS: overall survival; TTFT: time to first treatment; UCSD: University of California San Diego

As some CLL biomarkers can evolve and be enriched post-chemoimmunotherapeutic treatment, we additionally analysed the patients from the Duke cohort who had a sample for SET mRNA PCR analysis collected prior to any therapeutic intervention. In all cases, we utilized the first sample that was available. In the Duke cohort, 233 patients had TTFT (or follow-up with no treatment) information available and had a CLL sample for qPCR analysis of SET mRNA isoforms collected prior to the first treatment. Of these 233 patients, 116 eventually were treated. As a continuous variable, the HR for TTFT for a higher SET mRNA ratio in this group was 1.05 (95% CI (1.01–1.09)), p=0.01. Similarly, 234 patients in the Duke cohort had OS data available and had their CLL sample for analysis drawn before any therapy was given. Sixty-two of these patients later died. The HR for a higher SET mRNA ratio and death in these patients was 1.06 (1.02–1.11), p=0.004). Therefore SET mRNA isoform ratio retains its prognostic significance for TTFT and OS even when tested in patients of the Duke cohort who had their samples taken before any chemoimmunotherapy was given.

High SETA isoform mRNA relative to SETB isoform mRNA association with shortened TTFT is confirmed in a separate, independent CLL cohort

Analysis of SET mRNA in cells of CLL patients from UCSD revealed that a high SETA/B mRNA ratio as a continuous variable was also significantly associated with shorter TTFT [HR 1.3 (1.0–1.6), p=0.02]. Kaplan-Meier plots of the UCSD cohort analysed with SETA/B mRNA ratio as a dichotomous variable for illustration are included in Figure 2, with Table III listing TTFT and OS for the high and low SETA/B mRNA ratio groups. The median TTFT was 6.1 (4.8–8.1) years in the dichotomized high SETA/B mRNA ratio group vs. 10.3 (8.4–15.6) years in those with a low SETA/B mRNA ratio [HR 1.8 (1.2–2.7), p=0.006]. There was no significant association of high SETA/B mRNA ratio as a continuous or dichotomous variable with shortened OS in the UCSD patients. The lower number of deaths in the UCSD cohort may have contributed to the difference in effect on OS seen between the two cohorts.

Table III.

SET mRNA isoform ratio and established CLL prognostic markers for time to first treatment and overall survival in UCSD cohort

Time to first treatment Overall survival
Median time [years (95% CI)] HR P value Median time [years (95% CI)] HR P value
SETA/B mRNA ratio
    high 6.1(4.8–8.1) [n=83] 1.8 (1.2–2.7) 0.006 21.1 (12.9-) [n=83] 1.9 (0.8–4.5) 0.12
    low 10.3 (8.4–15.6) [n=83] 83, 20.1 (−) [n=83]
Rai stage
    I-IV 6.8 (5.7–10.3) [n=53] 1.9 (1.2–3.0) 0.007 NA (−) [n=53] 2.3 (0.8–6.5) 0.1
     0 1.0 (7.9-) [n=81] 21.1 (−) [n=81]
CD38 expression
    positive 4.8 (3.5–6.3) [n=46] 2.5 (1.7–3.9) < 0.001 21.1 (10.2-) [n=46] 1.9 (0.8–4.4) 0.13
    negative 10.7 (8.1–15.0) [n=119] 20.1 (−) [n=119]
IGHV mutation status
    unmutated 5.5 (3.9–6.5) [n=65] 3.3 (2.1–5.0) < 0.001 NA (10.2-) [n=65] 3.5 (1.5–8.2) 0.002
    mutated 12.1 (10.3-) [n=101] 20.1 (20.1-) [n=101]
FISH group
    unfavourable 4.2 (3.1–8.6) [n=30] 2.0 (1.2–3.3) 0.005 20.1 (15.3-) [n=30] 1.8 (0.6–5.1) 0.3
    favourable 10.3(7.9–12.2) [n=101] 101, NA (−) [n=101]
Open in a new tab

CI: confidence interval: CLL: chronic lymphocytic leukaemia; FISH: fluorescence in situ hybridisation; UCSD: University of California San Diego.

Increased SETA isoform mRNA relative to SETB isoform mRNA provides risk stratification in favourable CLL prognostic groups

Clinically established prognostic markers, such as Rai stage, CD38 positivity, IGHV mutation status and FISH profile, do not fully predict CLL patient outcomes. This indicates that additional modifiers of disease aggressiveness probably exist. We therefore first tested for interactions of the dichotomous SETA/B mRNA ratio with IGHV mutation status, FISH group, CD38 positivity and Rai staging in the Duke/DurVAMC cohort. As expected, CLL patients with UM-IGHV have a shorter TTFT compared to patients with mutated IGHV (M-IGHV) [3.1 vs. 11.9 years, HR=3.34, p<0.001; Figure 3]. Patients with M-IGHV and a high SETA/B mRNA ratio had a shorter TTFT compared to those with M-IGHV and a low SETA/B mRNA ratio. However, SETA/B mRNA ratio did not risk stratify the unfavourable risk UM-IGHV group of patients (pinteraction = 0.01).

Figure 3. Analysis of the interaction of SETA/SETB mRNA ratio with IGHV mutation status and FISH group for the Duke/DurVAMC cohort for TTFT and OS.

Figure 3.

Open in a new tab

The figure shows the interaction of SETA/B mRNA ratio as a dichotomous variable with IGHV mutation status (top) and FISH (bottom) for TTFT (left) and OS (right). As expected, for unfavourable risk UM-IGHV patients (blue and yellow lines), there was shorter TTFT compared to M-IGHV (red and green lines), and for UM-IGHV this poor prognosis appeared independent of the SETA/B mRNA ratio. However, within the favourable risk M-IGHV patients, those with high SETA/B mRNA ratio (red) had a shorter TTFT compared to low SETA/B mRNA ratio (green). This interaction between IGHV mutation status and SETA/B mRNA ratio in TTFT is significant (p=0.01). As expected for patients with unfavourable FISH, defined as any del(17p), del(11q) or three or more abnormalities by FISH (red and green lines), there was shorter TTFT compared to favourable FISH (blue and yellow lines), and for UM-IGHV this poor prognosis appeared independent of the SETA/B mRNA ratio. However, within the favourable FISH population, those with high SETA/B mRNA ratio (blue) had a shorter TTFT compared to low SETA/B mRNA ratio (yellow). This interaction between FISH group and SETA/B mRNA ratio in TTFT was significant (p=0.01). Duke/DurVAMC: Duke University or Durham Veteran’s Affairs Medical Centers; FISH: fluorescence in situ hybridisation; M-IGHV: mutated IGHV; OS: overall survival; TTFT: time to first treatment; UM-IGHV: unmutated IGHV.

As with the UM-IGHV patients, CLL patients with unfavourable FISH had a shorter TTFT compared to those with favourable FISH [4.6 vs. 7.3 years, HR=1.6, p<0.001]. In the favourable risk FISH group, a high SETA/B mRNA ratio predicted a shorter TTFT compared to low SETA/B mRNA ratio, but this risk stratification was not seen in the unfavourable FISH group (pinteraction = 0.01). SETA/B mRNA ratio appeared to risk-stratify CLL patients when combined with other established prognostic markers in the Duke/DurVAMC cohort (Rai stage and CD38 – Figure 4) and the UCSD cohort (IGHV mutation status or the FISH group – Figure 5), although there were no significant interactions in these analyses. Interaction of SET isoform mRNA ratio with CD38 may part be partly affected by the known variability of CD38 in patients across time, while IGHV and FISH have more consistently been shown to be independent prognostic markers, including in a validated international prognostic index, the CLL-IPI. (The International CLL-IPI Working Group, 2016)

Figure 4. Analysis of the interaction of the SET mRNA ratio and Rai stage and CD38 expression for the Duke/DurVAMC cohort for TTFT and OS.

Figure 4.

Open in a new tab

The interaction of SETA/B mRNA ratio as a dichotomous variable with Rai stage (top) and CD38 expression (bottom) is displayed for the Duke/DurVAMC cohort for TTFT (left) and OS (right). There was no evidence for significant interaction between SET mRNA ratio and either Rai stage or CD38 expression. Duke/DurVAMC: Duke University or Durham Veteran’s Affairs Medical Centers; OS: overall survival; TTFT: time to first treatment.

Figure 5. Analysis of the interaction of SETA/B mRNA ratio with IGHV mutation status and FISH group for the UCSD cohort for TTFT and OS.

Figure 5.

Open in a new tab

The figure shows the interaction of SETA/B mRNA ratio as a dichotomous variable with IGHV mutation status (top) and FISH (bottom) for TTFT (left) and OS (right). There is no evidence for significant interaction between SET mRNA ratio and either IGHV mutation status or FISH group. FISH: fluorescence in situ hybridisation; M-IGHV: mutated IGHV; OS: overall survival; TTFT: time to first treatment; UCSD: University of California San Diego; UM-IGHV: unmutated IGHV.

The positive interactions of IGHV and FISH with SET mRNA isoforms indicates that a high SETA/B mRNA ratio is associated with inferior clinical outcomes and can be combined with established prognostic markers for more refined estimation of patient prognosis. The interaction between SETA/B mRNA ratio and IGHV mutation status or FISH group suggests that SET may cooperate with other proteins or cellular pathways in certain biologically-defined patient subgroups, thereby influencing disease aggressiveness primarily for those patients.

Discussion

We present here that expression of the alternatively spliced SET mRNA isoforms is associated with clinical outcomes in patients with CLL. We show for the first time that a relative increase in the expression of SETA mRNA isoform (high SETA/B mRNA ratio) is associated with shortened TTFT and OS in CLL patients. Using an independent group of CLL patients from a separate institution, we also verified that patients with high SETA relative to SETB isoform mRNA expression have inferior outcomes with faster progression to treatment indications (Figure 2). We believe this provides novel insights into CLL disease biology, potentially through SET’s role in dysregulation of the critical kinase-phosphatase balance. However, the dominant function(s) of each SET isoform and the comparative potency between isoforms for these various SET functions in malignant cells is not defined. Alternative splicing of SET mRNA isoforms may provide an additional layer of oncogenic dysregulation in CLL.

SET overexpression and involvement in tumourigenesis has been described in many cancers, including lung, prostate, ovarian and head and neck cancers, and leukaemias(Agarwal, et al 2014, Carlson, et al 1998, Christensen, et al 2011, Cristobal, et al 2012, Cristobal, et al 2015, Cristobal, et al 2017, Gonzalez-Alonso, et al 2015, Liu, et al 2015, Neviani, et al 2005, Switzer, et al 2011) SET is the primary and most potent physiological inhibitor of PP2A, (Neviani and Perrotti 2014, Switzer, et al 2011) a major mammalian serine/threonine phosphatase that plays a critical regulatory role in the cell cycle, apoptosis and appropriate deactivation of oncogenic signalling. Decreased activity of PP2A in CLL due to inappropriate SET protein isoform balance may lead to unregulated kinase activity and unchecked growth and replication, thereby permitting progression of the CLL clone. (Ciccone, et al 2015)

It is now recognized that there are at least four SET isoforms formed from alternative splicing, with SETA (SET-204) and SETB (SET-201) considered the main protein isoforms.(Adachi, et al 1994) To date, investigators have generally focused on the role of total SET in human malignancies without elucidating the impact of relative differences in splice variant expression in disease heterogeneity. Our findings raise questions regarding the shared and independent roles that that the two main splice variants of SET (SETA and SETB) have in oncogenesis and cancer progression, as well as questions regarding the mechanisms that control isoform-specific SET expression in CLL. While normal B cells predominantly contained the β isoform of SET protein, we noted in our prior work that both SETA and B protein were expressed in CLL and NHL cells.(Christensen, et al 2011) SETA and SETB are both capable of inhibiting PP2A(Saito, et al 1999) activity and inhibiting nucleosome acetylation.(Saavedra, et al 2017) We are not aware of research identifying the independent functions of the two SET isoforms or the mechanisms that regulate different SET isoform expression in CLL. The relative differences in SETA and SETB mRNA expression between CLL patients found in this study highlight the need for ongoing work to elucidate the roles of the different SET isoforms and the factors that control their differential expression.

In our cohorts, we found that increased SETA isoform mRNA relative to SETB isoform mRNA identifies a high-risk group within the mutated IGHV and favourable FISH risk groups (Figure 2). We hypothesize that SET may impact the B-cell receptor (BCR)-mediated kinase pathway signalling, which can be affected by IGHV mutation status.(Kipps, et al 2017) In UM-IGHV, BCR activation can enhance pathways associated with proliferation and cellular survival(Packham, et al 2014), and this heightened kinase signalling may be too strong to be negatively regulated by the SET-PP2A axis. Therefore, any relative differences between patients in SET inhibition of PP2A (as reflected in the SETA/B mRNA ratio) may not have a large impact in patients with UM-IGHV. Conversely, in M-IGHV CLL, BCR signalling may activate proliferation pathways to a lesser degree, and this diminished kinase signalling response may be more likely to be modulated by the SET-PP2A axis. Thus, relative changes in SET protein isoforms and subsequent relative changes in PP2A activity could lead to different outcomes based on IGHV mutation status.

In summary, we have found that patients with CLL containing relatively higher expression of SETA isoform mRNA (high SETA/B mRNA ratio) have significantly shorter TTFT and OS compared to those with lower levels, and that this ratio identifies patients with worse clinical outcomes within previously defined CLL favourable risk groups. These results highlight that alternative splicing of SET mRNA may be an important oncogenic control mechanism. Additional work is needed to understand the functional differences in SETA and SETB protein isoforms. CLL patients will benefit from a deeper understanding of the function and control of SET mRNA isoforms and of alternative splicing in general, in that this knowledge can lead to improved patient counseling and development of novel therapeutics in CLL that modulate epigenetics and/or phosphatase activity.

Acknowledgements

We thank the patients for their participation. We also thank the Clinical Researcher Coordinators Ms. Ruth Stanton and Dana Thompson, PhD for their assistance. The research was supported by the VA Research Service, NIH/NCI grants (TJK), and the Biomarker Factory Grant (JBW). Danielle Brander, MD was also supported by the NIH Loan Repayment Program, and was a participant in the ASH Clinical Research Training Institute and the Lymphoma Research Foundation Lymphoma Clinical Research Mentoring Program.

Footnotes

Disclosures. DJC and JBW have a patent regarding use of SET as a predictor of CLL and NHL outcomes. DMB has no conflicts in regarding to work under consideration for publication. For work outside of the publication, DMB has been a consultant for Abbvie, Genentech, Pharmacyclics, Teva, TG Therapeutics; and received clinical trial research support from Abbvie, TG Therapeutics, Gilead, DTRM, and Beigene.

References

  1. Adachi Y, Pavlakis GN & Copeland TD (1994) Identification and characterization of SET, a nuclear phosphoprotein encoded by the translocation break point in acute undifferentiated leukemia. J Biol Chem, 269, 2258–2262. [PubMed] [Google Scholar]
  2. Agarwal A, MacKenzie RJ, Pippa R, Eide CA, Oddo J, Tyner JW, Sears R, Vitek MP, Odero MD, Christensen DJ & Druker BJ (2014) Antagonism of SET using OP449 enhances the efficacy of tyrosine kinase inhibitors and overcomes drug resistance in myeloid leukemia. Clin Cancer Res, 20, 2092–2103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beghini A, Ripamonti CB, Peterlongo P, Roversi G, Cairoli R, Morra E & Larizza L (2000) RNA hyperediting and alternative splicing of hematopoietic cell phosphatase (PTPN6) gene in acute myeloid leukemia. Hum Mol Genet, 9, 2297–2304. [DOI] [PubMed] [Google Scholar]
  4. Byrd JC, Furman RR, Coutre SE, Flinn IW, Burger JA, Blum KA, Grant B, Sharman JP, Coleman M, Wierda WG, Jones JA, Zhao W, Heerema NA, Johnson AJ, Sukbuntherng J, Chang BY, Clow F, Hedrick E, Buggy JJ, James DF & O’Brien S (2013) Targeting BTK with ibrutinib in relapsed chronic lymphocytic leukemia. N Engl J Med, 369, 32–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carlson SG, Eng E, Kim EG, Perlman EJ, Copeland TD & Ballermann BJ (1998) Expression of SET, an inhibitor of protein phosphatase 2A, in renal development and Wilms’ tumor. J Am Soc Nephrol, 9, 1873–1880. [DOI] [PubMed] [Google Scholar]
  6. Chiorazzi N, Rai KR & Ferrarini M (2005) Chronic lymphocytic leukemia. N Engl J Med, 352, 804–815. [DOI] [PubMed] [Google Scholar]
  7. Christensen DJ, Chen Y, Oddo J, Matta KM, Neil J, Davis ED, Volkheimer AD, Lanasa MC, Friedman DR, Goodman BK, Gockerman JP, Diehl LF, de Castro CM, Moore JO, Vitek MP & Weinberg JB (2011) SET oncoprotein overexpression in B-cell chronic lymphocytic leukemia and non-Hodgkin lymphoma: a predictor of aggressive disease and a new treatment target. Blood, 118, 4150–4158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ciccone M, Calin GA & Perrotti D (2015) From the Biology of PP2A to the PADs for Therapy of Hematologic Malignancies. Front Oncol, 5, 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cox DR& Oakes D (1984) Analysis of Survival Data. London. [Google Scholar]
  10. Cristobal I, Garcia-Orti L, Cirauqui C, Cortes-Lavaud X, Garcia-Sanchez MA, Calasanz MJ & Odero MD (2012) Overexpression of SET is a recurrent event associated with poor outcome and contributes to protein phosphatase 2A inhibition in acute myeloid leukemia. Haematologica, 97, 543–550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cristobal I, Rincon R, Manso R, Carames C, Zazo S, Madoz-Gurpide J, Rojo F & Garcia-Foncillas J (2015) Deregulation of the PP2A Inhibitor SET Shows Promising Therapeutic Implications and Determines Poor Clinical Outcome in Patients with Metastatic Colorectal Cancer. Clin Cancer Res, 21, 347–356. [DOI] [PubMed] [Google Scholar]
  12. Cristobal I, Torrejon B, Pedregal M, Rojo FG & Garcia-Foncillas J (2017) Targeting PP2A to overcome enzalutamide resistance in AR+ breast tumors. Endocr Relat Cancer, 24, L5–L6 [DOI] [PubMed] [Google Scholar]
  13. Furman RR, Sharman JP, Coutre SE, Cheson BD, Pagel JM, Hillmen P, Barrientos JC, Zelenetz AD, Kipps TJ, Flinn I, Ghia P, Eradat H, Ervin T, Lamanna N, Coiffier B, Pettitt AR, Ma S, Stilgenbauer S, Cramer P, Aiello M, Johnson DM, Miller LL, Li D, Jahn TM, Dansey RD, Hallek M & O’Brien SM (2014) Idelalisib and rituximab in relapsed chronic lymphocytic leukemia. N Engl J Med, 370, 997–1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gonzalez-Alonso P, Cristobal I, Manso R, Madoz-Gurpide J, Garcia-Foncillas J & Rojo F (2015) PP2A inhibition as a novel therapeutic target in castration-resistant prostate cancer. Tumour Biol, 36, 5753–5755. [DOI] [PubMed] [Google Scholar]
  15. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Dohner H, Hillmen P, Keating MJ, Montserrat E, Rai KR & Kipps TJ (2008) Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood, 111, 5446–5456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hanahan D & Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell, 144, 646–674. [DOI] [PubMed] [Google Scholar]
  17. Kipps TJ, Stevenson FK, Wu CJ, Croce CM, Packham G, Wierda WG, O’Brien S, Gribben J & Rai K (2017) Chronic lymphocytic leukaemia. Nat Rev Dis Primers, 3, 17008. [DOI] [PubMed] [Google Scholar]
  18. Liu H, Gu Y, Wang H, Yin J, Zheng G, Zhang Z, Lu M, Wang C & He Z (2015) Overexpression of PP2A inhibitor SET oncoprotein is associated with tumor progression and poor prognosis in human non-small cell lung cancer. Oncotarget, 6, 14913–14925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Molica S, Shanafelt TD, Giannarelli D, Gentile M, Mirabelli R, Cutrona G, Levato L, Di Renzo N, Di Raimondo F, Musolino C, Angrilli F, Fama A, Recchia AG, Chaffee KG, Neri A, Kay NE, Ferrarini M & Morabito F (2016) The chronic lymphocytic leukemia international prognostic index predicts time to first treatment in early CLL: Independent validation in a prospective cohort of early stage patients. Am J Hematol, 91, 1090–1095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Moore AS, Alonzo TA, Gerbing RB, Lange BJ, Heerema NA, Franklin J, Raimondi SC, Hirsch BA, Gamis AS & Meshinchi S (2014) BIRC5 (survivin) splice variant expression correlates with refractory disease and poor outcome in pediatric acute myeloid leukemia: a report from the Children’s Oncology Group. Pediatr Blood Cancer, 61, 647–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Neviani P & Perrotti D (2014) SETting OP449 into the PP2A-activating drug family. Clin Cancer Res, 20, 2026–2028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Neviani P, Santhanam R, Trotta R, Notari M, Blaser BW, Liu S, Mao H, Chang JS, Galietta A, Uttam A, Roy DC, Valtieri M, Bruner-Klisovic R, Caligiuri MA, Bloomfield CD, Marcucci G & Perrotti D (2005) The tumor suppressor PP2A is functionally inactivated in blast crisis CML through the inhibitory activity of the BCR/ABL-regulated SET protein. Cancer Cell, 8, 355–368. [DOI] [PubMed] [Google Scholar]
  23. Packham G, Krysov S, Allen A, Savelyeva N, Steele AJ, Forconi F & Stevenson FK (2014) The outcome of B-cell receptor signaling in chronic lymphocytic leukemia: proliferation or anergy. Haematologica, 99, 1138–1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Parikh SA, Strati P, Tsang M, West CP & Shanafelt TD (2016) Should IGHV status and FISH testing be performed in all CLL patients at diagnosis? A systematic review and meta-analysis. Blood, 127, 1752–1760. [DOI] [PubMed] [Google Scholar]
  25. Pflug N, Bahlo J, Shanafelt TD, Eichhorst BF, Bergmann MA, Elter T, Bauer K, Malchau G, Rabe KG, Stilgenbauer S, Dohner H, Jager U, Eckart MJ, Hopfinger G, Busch R, Fink AM, Wendtner CM, Fischer K, Kay NE & Hallek M (2014) Development of a comprehensive prognostic index for patients with chronic lymphocytic leukemia. Blood, 124, 49–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Puente XS, Bea S, Valdes-Mas R, Villamor N, Gutierrez-Abril J, Martin-Subero JI, Munar M, Rubio-Perez C, Jares P, Aymerich M, Baumann T, Beekman R, Belver L, Carrio A, Castellano G, Clot G, Colado E, Colomer D, Costa D, Delgado J, Enjuanes A, Estivill X, Ferrando AA, Gelpi JL, Gonzalez B, Gonzalez S, Gonzalez M, Gut M, Hernandez-Rivas JM, Lopez-Guerra M, Martin-Garcia D, Navarro A, Nicolas P, Orozco M, Payer AR, Pinyol M, Pisano DG, Puente DA, Queiros AC, Quesada V, Romeo-Casabona CM, Royo C, Royo R, Rozman M, Russinol N, Salaverria I, Stamatopoulos K, Stunnenberg HG, Tamborero D, Terol MJ, Valencia A, Lopez-Bigas N, Torrents D, Gut I, Lopez-Guillermo A, Lopez-Otin C & Campo E (2015) Non-coding recurrent mutations in chronic lymphocytic leukaemia. Nature, 526, 519–524. [DOI] [PubMed] [Google Scholar]
  27. Rassenti LZ, Huynh L, Toy TL, Chen L, Keating MJ, Gribben JG, Neuberg DS, Flinn IW, Rai KR, Byrd JC, Kay NE, Greaves A, Weiss A & Kipps TJ (2004) ZAP-70 compared with immunoglobulin heavy-chain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N Engl J Med, 351, 893–901. [DOI] [PubMed] [Google Scholar]
  28. Saavedra F, Rivera C, Rivas E, Merino P, Garrido D, Hernandez S, Forne I, Vassias I, Gurard-Levin ZA, Alfaro IE, Imhof A, Almouzni G & Loyola A (2017) PP32 and SET/TAF-Ibeta proteins regulate the acetylation of newly synthesized histone H4. Nucleic Acids Res, 45, 11700–11710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Saito S, Miyaji-Yamaguchi M, Shimoyama T & Nagata K (1999) Functional domains of template-activating factor-I as a protein phosphatase 2A inhibitor. Biochem Biophys Res Commun, 259, 471–475. [DOI] [PubMed] [Google Scholar]
  30. Surget S, Khoury MP & Bourdon JC (2013) Uncovering the role of p53 splice variants in human malignancy: a clinical perspective. Onco Targets Ther, 7, 57–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Switzer CH, Cheng RY, Vitek TM, Christensen DJ, Wink DA & Vitek MP (2011) Targeting SET/I(2)PP2A oncoprotein functions as a multi-pathway strategy for cancer therapy. Oncogene, 30, 2504–2513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. The International CLL-IPI Working Group. (2016) An international prognostic index for patients with chronic lymphocytic leukemia (CLL-IPI): a met-analysis of individual patient data. Lancet Oncol, 17, 779–790. [DOI] [PubMed] [Google Scholar]
  33. Therneau T (2016) A Package for Survival Analysis in S. https://github.com/therneau/survival
  34. Thompson PA, Tam CS, O’Brien SM, Wierda WG, Stingo F, Plunkett W, Smith SC, Kantarjian HM, Freireich EJ & Keating MJ (2016) Fludarabine, cyclophosphamide, and rituximab treatment achieves long-term disease-free survival in IGHV-mutated chronic lymphocytic leukemia. Blood, 127, 303–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Volkheimer AD, Weinberg JB, Beasley BE, Whitesides JF, Gockerman JP, Moore JO, Kelsoe G, Goodman BK & Levesque MC (2007) Progressive immunoglobulin gene mutations in chronic lymphocytic leukemia: evidence for antigen-driven intraclonal diversification. Blood, 109, 1559–1567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wagner M, Schmelz K, Wuchter C, Ludwig WD, Dorken B & Tamm I (2006) In vivo expression of survivin and its splice variant survivin-2B: impact on clinical outcome in acute myeloid leukemia. Int J Cancer, 119, 1291–1297. [DOI] [PubMed] [Google Scholar]
  37. Wang L, Fan J, Francis JM, Georghiou G, Hergert S, Li S, Gambe R, Zhou CW, Yang C, Xiao S, Cin PD, Bowden M, Kotliar D, Shukla SA, Brown JR, Neuberg D, Alessi DR, Zhang CZ, Kharchenko PV, Livak KJ & Wu CJ (2017) Integrated single-cell genetic and transcriptional analysis suggests novel drivers of chronic lymphocytic leukemia. Genome Res, 27, 1300–1311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Weinberg JB, Volkheimer AD, Chen Y, Beasley BE, Jiang N, Lanasa MC, Friedman D, Vaccaro G, Rehder CW, Decastro CM, Rizzieri DA, Diehl LF, Gockerman JP, Moore JO, Goodman BK & Levesque MC (2007) Clinical and molecular predictors of disease severity and survival in chronic lymphocytic leukemia. Am J Hematol, 82, 1063–1070. [DOI] [PubMed] [Google Scholar]

RESOURCES