Skip to main content
3 Biotech logoLink to 3 Biotech
. 2021 Aug 19;11(9):416. doi: 10.1007/s13205-021-02946-x

Molecular mechanisms and biochemical analysis of fluorene degradation by the Pseudomonas sp. SMT-1 strain

Mulugeta Desta 1,✉, Lige Zhang 2, Weiwei Wang 2, Ping Xu 2, Hongzhi Tang 2
PMCID: PMC8377103  PMID: 34485009

Abstract

Fluorene is a harmful organic toxicant extensively disseminated in the water and dry land ecosystem. Its toxicity and ubiquitous presence pose issues concerning its biodegradation. Characterization of the molecular mechanisms of fluorene degradation, detection of metabolites, and appraisal of its viability in toxicant removal by the SMT-1 Pseudomonas sp. strain are the main purposes of this study. In this work, the catabolic intermediates were identified from resting cell reactions of the SMT-1 strain as well as the involved catabolic pathway of fluorene. Based on liquid chromatography mass spectrometry analysis, the identified intermediates were 9-fluorenone; 3,4-dihydroxy-9-fluorenone; phthalate and protocatechuic acid. The specific primers were designed to amplify the fluorene-degrading 4921 dioxygenase gene segment from the SMT-1 Pseudomonas sp. strain. The 4921 dioxygenase gene was expressed, purified and characterized. The apparent Km and Vmax values were 25.99 µM min−1 and 0.77 U mg−1, respectively. The enzyme was most active at pH 7.5 and 25 °C in Tris–HCl buffer and was identified by measuring the initial reaction velocity for 1 min. Effect of metal salts on enzyme activity was accessed to see the impact on protein stability. Most of the analyzed metal salts inhibited enzyme activity to different degrees, and exhibited very low activity in the presence of FeCl3. Understanding the physiological, metabolic pathway and molecular mechanism of fluorene degradation is an important factor in increasing significant information of this biological process. This strain may serve as a potential candidate for further use in the bioremediation process to treat organic toxicant contaminated sites.

Keywords: Bioremediation, Degradation, Fluorene, Environment, Organic toxicant, Pathway

Introduction

Polycyclic aromatic hydrocarbons discharged from several sources, mainly from incomplete combustion of organic materials, use and disposal of petroleum products, coal, and wood preserving products are persistently harmful pollutants to the environment (Hadibarata et al. 2014) High molecular weight aromatic compounds are most significant in pyrogenic sources and are released into the environment largely in the form of exhaust and solid residues (Souza et al. 2015), low molecular weight aromatic rings, such as fluorene, acenaphthene, acenaphthylene, anthracene phenanthrene tend to have a main structure of two to three benzenoid rings are leading in petrogenic sources and can be entered into aquatic biome via oil spills, municipal and urban runoff (Syed et al. 2017). Fluorene is one of the most widespread and persistent contaminants entering in the environment though different ways and from several sources (Latimer et al. 2003). Organic compounds are essential in many industrial applications and provide a wide range of benefits. Nevertheless, fluorene and its derivatives are toxic and carcinogenic compounds cause significant ecological and health problems (Kawasaki et al. 2011). The demand to fluorene biotransformation in the ecosystem is associated with its high prevalence, toxicity and its resistance to degradation in the environment and harmfulness to human and other animals (Mrozik 2013; Cerniglia et al. 1992). Physiochemical approach has been used to remove this toxic compound from contaminated sites; however, the results have not been effective in removing toxic compounds and their derivative pollutants from the environment. Organic toxicant degradation method using microorganisms such as bacteria, fungi and algae has recently gained a vital consideration due to its efficiency and lower cost (Sayed et al. 2021). The capacity to mineralize organic toxic compounds was shown by several groups of bacteria including Arthrobacter, Brevibacterium, Burkholderia, Mycobacterium, Pseudomonas, and Sphingomonas (Cerniglia et al. 1992). However, proper biodegradation and mineralization of harmful aromatic compounds from the environment using microorganisms still need a complete investigation in terms of molecular mechanisms and metabolic pathways. Isolation, characterization and genome sequencing of a fluorene-degrading Pseudomonas sp. strain named SMT-1 was reported (Desta et al. 2019). The obtained genome sequence of this strain helped us to identify pivotal genes involved in fluorene metabolism. The growth and degradation characteristics analysis of the strain revealed its potential in fluorene metabolism. However, metabolic pathways and enzymatic reactions of fluorene catabolism in this strain were unknown. The catabolic ability, metabolic pathways and enzymatic characterization of fluorene degradation in the Pseudomonas sp. strain SMT-1 are explored in this study. The metabolites in Pseudomonas sp. strain SMT-1 of fluorene degradation were detected by Liquid Chromatography Mass Spectrometry (LC–MS). The deduced metabolic pathway was initiated from C-9 position resulted in 9-fluorenol (Grifoll et al. 1995; Trenz 1994). The growth and metabolism characteristics analysis of the strain SMT-1 has shown its potential in fluorene catabolism. However, metabolic pathways and enzymatic reactions of fluorene metabolism in this strain were not yet covered. Therefore, determination of molecular fluorene degradation pathways and understanding enzymatic reactions is a vital aspect in increasing our validation of this biological process. The results of this study would facilitate the comprehension of the detailed mechanisms of fluorene degradation in this strain and further elucidate its possible bioremediation.

Materials and methods

Chemicals and media

Fluorene was purchased from J & K CHEMICA, China. A 100 mM solution in N,N-dimethylformamide was used as stock solution. Mineral salt medium (MSM) consisted of 5.2 g K2HPO4, 3.7 g KH2PO4, 1.0 gNa2SO4, 2 g MgSO4, 2.0 g NH4Cl and 0.5 ml of trace elements solution in 1 L distilled water was prepared according to previously described methods (Liu et al. 2014). The trace elements solutions including 0.05 g CaCl2, 2 H2O, 0.05 g CuCl2; 2 H2O.0.0004 g FeSO4 7 H2O, 0.008 g MnSO4-H2O, 0.1 g ZnSO4 (per liter of 0.1 mM HCl), were used in this study. The mineral salt medium (MSM) was adjusted to different pH values (3.0, 5.0, 7.0. 9.0, and 11.0) with NaOH and Tris HCl and media was sterilized at 121 °C for 15 min. All other reagents used in the experiments were of analytical grade.

Cell growth and fluorene degradation

The Pseudomonas sp. SMT-1 strain was grown to exponential phase in 50 mL sterilized MSM supplemented with 0.4 mm fluorene at 30 °C and 200 rpm shaker speed; and this pre culture was used as a seed broth. The 5% (v/v) fluorene was used as inoculum size to determine the subsequent factors on cell growth and degradation of fluorene. The influence of fluorene on growth of SMT-1 was determined by inoculation of the seed broth into 50 mL fresh MSM containing (0.1, 0.2, 0.3, 0.4 and 0.5 mM) fluorene and cultivated at 30 °C. Under the optimal initial fluorene concentration and pH7.0, bacterial growth and fluorene degradation were monitored at different temperatures (20 °C,25 °C,30 °C,37 °C and 42 °C). During the incubation period, 1 mL aliquots of the culture medium was sampled at the pre-determined intervals and the cell density was determined by measuring the optical density at 600 nm (OD600) using a spectrophotometer. The fluorene concentration was measured by high-performance liquid chromatography (HPLC) (Agilent Technologies 1200 series) with an Agilent Eclipse XDB-C18 column (5 μm, 4.6 by 150 mm), UV–Visible detector set at 254 nm. A mixture of methanol and ddH2O (80%, 20%, respectively, was used as the mobile phase. In this study, we used the analytical method with modifications in the flow rate 0.5 ml min1 and column temperature 30 °C (Veeranagouda et al. 2006).

Resting cell reactions

Strain SMT-1 was grown in a 1-L flask containing MSM + 0.5% yeast extract and 0.1 mM fluorene as carbon source until OD600 0.8 was reached. The cells were then harvested through centrifugation (4200 × g, at 4 °C, 20 min). The cell sediment was re suspended and rinsed twice with 50 mM phosphate saline buffer (PBS) and again resuspended in the same buffer; then cooled at 4 °C and the optical density was adjusted to OD600mm 0.5. The malnourishment treatment was performed by growing cells deprived of substrate in a 50 ml vial at 30 °C at a reciprocal shaking rate of 200 rpm for 2 h (resting cell reaction). The resultant mixture contained 12 ml cell culture with 0.1 mM fluorene. The reaction was stopped by acidification with hydrochloric acid (HCl) at a final pH of 2.5. To extract neutral metabolites, the spent-medium was directly extracted by adding equal volume of ethyl acetate.

Metabolites identification

To identify metabolites, the extracted samples from culture broth and resting cell reactions were dehydrated with anhydrous Na2SO4 and concentrated to 1 mL using reduced pressure and evaporation at 45 °C and then evaporated to dryness using nitrogen gas and utilized for LC–MS analysis. The intermediates were identified by their UV–Visible and electron impact (EI) MS spectra using Agilent 6230 equipment (Agilent Technologies, Germany) Agilent XDB C18 column (4.6 × 250 mm, 4.6 μm) at 30 °C.

Cloning and protein expression

The 4921 dioxygenase gene of Pseudomonas sp. strain SMT-1 was amplified by standard PCR using the open reading frame (ORF) encoding 4921 dioxygenase gene with the following primers: 5′CGCGGATCCATGACCGTGAACATTTCCCA3′as forward and 5′CCCAAGCTTT CAGGCCTCCTGCAAAGCTC3′ as reverse. The 1.0-kb PCR fragment containing the 4921 dioxygenase gene was double digested with BamHI/HindIII and ligated into BamHI/HindIII digested sites of pET28a( +) to form recombinant pET28a plasmid. The successfully cloned plasmids were verified and introduced into E. coli BL21 (DE3). The recombinant cells were grown in Luria Broth containing 50 μg mL−1 ampicillin, to mid-log phase (OD600 of 0.6–0.8) at 37 °C. The 0.2 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was used for culture induction and grown another 14–16 h at 16 °C.

Protein purification

The bacterial cells were harvested by centrifugation (4200 × g, 4 °C) using an Avanti J-20 XP centrifuge with rotor JLA 8.1000 for 20 min. The collected cell pellet was resuspended in volume of lysis buffer (20 mM Tris–HCl, pH 7.5) and disrupted using an ultrasonic cell disruptor in an ice water bath. Cell debris was removed by centrifugation at 10,500 × g, 4 °C using CT15RT versatile refrigerated centrifuge for 40 min. The clear supernatant was filtered using 0.2 mm syringe filter and used for purification by addition a pre washed Ni–NTA agarose resin and washed equilibrated with lysis buffer previously equilibrated with 20 mM imidazole and 50 mM Tris–HCl PH 8.0 buffers. Clear lysate containing the enzyme was loaded onto the column, followed by washing steps with 15 mM imidazole and 40 mM Tris–HCl pH 8.0 buffers, and eluted with 180 mM imidazole pH 8.0 buffer. The protein was analyzed by 4–15% SDS–PAGE gels and stained with Coomassie blue at each step of purification to estimate the protein purity and abundance. Protein concentration was estimated using the Bradford method with bovine serum albumin as a standard. The resulting absorbance was measured at 595 nm using an ultraviolet spectrophotometer.

Enzyme characterization

Enzyme activity of 4921 dioxygenase was measured by determining the absorbance at 320 nm using a UV–Vis 2550 spectrophotometer (Shimadzu, Kyoto, Japan). The activity of the enzyme was determined in mixture comprising 100 mM of fluorene, 0.025 M ferrous sulfate and 1 μL of 10 mg/mL enzyme. The reaction mixture was then diluted in 2 mM Tris–HCl pH 7.5 (in 1 mL total volume) and continuously monitored at 25 °C. During this assay, different pH values such as pH 4.0–6.0 (citric acid/sodium citrate), 6.0–8.0 (phosphate buffer), 8.0–9.0 (Tris–HCl) and 9.0–11.0 (sodium hydrogen carbonate/sodium carbonate) were used to determine the effect of pH on enzyme activity in a final volume of 1 mL. Effect of metal salts on 4921 dioxygenase activity was measured under immediate detection and overnight incubation to check the effect of metal salts on the enzyme stability. In metal salt assay, NaCl, BaCl2, CaCl2, CuCl2, MnCl2, ZnCl2, KCl, FeCl3 and MgCl2 were used to prepare the 2 mM metal solution. The protein was incubated overnight at 25 °C in the buffers and in 2 mM metal solution for the stability assay.

Results

Fluorene degradation analysis was made at different temperature ranges and maximal fluorene degradation was observed at 30 °C. SMT-1 strain has found to use fluorene as a carbon source and degrade under neutral conditions. Neutral to alkaline conditions were likely favorable for growth of the cell in fluorene than in acidic conditions. The optimal growth of the strain was achieved at fluorene concentrations less than 0.5 mM. Furthermore, no growth increase was observed at higher fluorene concentration. The strain was primarily inactive, however, gradually responded to substrate and grown to exponential phase. Enzymes from the stationary phase could be responsible of the extra degradation of fluorene. Clear understanding of catabolic mechanisms and degradation pathway of fluorene is important for efficient removal of this toxic organic compound from the environment. The different characteristics and enzymatic reactions of SMT-1 strain at 30 °C are shown in Table 1. A yellow color of medium was observed during cell growth and fluorene biotransformation of Pseudomonas sp. strain SMT-1. The fluorene degradation pathway in strain SMT-1 was elucidated based on the identified metabolites. Detection of fluorene-catabolic intermediates in SMT-1 was performed using LC–MS analysis. The detected four metabolites of fluorene under LC–MS were 9-fluorenol, 3,4-dihydroxy-9-fluorenone, phthalate and protocatechuic acid (Fig. 1A, B). The primers were designed to amplify the 4921 dioxygenase gene segment from the SMT-1 Pseudomonas sp. strain. The PCR product (~ 1000 bp) was digested (BamHI/HindIII) and cloned in pET28a plasmid. The appropriate cloning procedure was confirmed by undertaking colony PCR and restriction enzyme digestion. The positively cloned recombinant plasmids were verified by sequencing. The SDS-PAGE analysis showed a molecular weight of nearly 38 kDa, corresponding to the molecular weight predicted by the protein sequence (Fig. 2A). Evaluation of enzymatic activities was made through the mixture comprising 100 mM final concentration of fluorene in the reaction mixture, 0.025 M ferrous sulfate and 1 μl of 10 mg/ml enzymes. The maximal enzymatic activity was observed at pH 7.5 in Tris–HCl buffer. The calculated apparent Km and Vmax values for 4921 dioxygenase were 25.99 µM min−1 and 0.77 U mg−1, respectively (Fig. 2C). The optimum temperature for the enzymatic reaction was 25 °C and was identified by measuring the initial reaction velocity for 1 min (Fig. 2B). Effect of metal salts on 4921 dioxygenase activity was measured under immediate detection and overnight incubation at 25 °C to confirm the enzyme stability and inhibition. The activity was inhibited by FeCl3, while activity was nearly twice higher in the presence of MnCl2 (Fig. 2D). The immediate detection has shown relatively higher activity than overnight incubation. However, most of the tested metal salts inhibited enzyme assay to different degrees and exhibited very low activity in the presence of FeCl3. The purified protein exhibited a reddish-brown color suggesting the presence of iron as a cofactor. However, 4921 dioxygenase activity did not show an evident increase after further FeSO4 addition, thus suggesting that the protein was already saturated with iron. The 4921 dioxygenase sequence was compared with others obtained from Gene Bank. The homology analysis was performed using the protein BLAST database. Conserved binding domain and multiple protein sequence alignment of the 4921 dioxygenase was performed using Clustal W. Several conserved motifs in the protein were revealed by multiple sequence alignments of deposited enzyme sequences (Fig. 3B). Analysis of the phylogenetic tree was performed using MEGA 7 (Kumar et al. 2016) (Fig. 3A).

Table 1.

Physiological and enzymatic reactions of strain SMT-1

No. Enzymes Substrate Results
1 Water –
2 Alkaline phosphatase Fosfato de 2-naftilo W
3 Esterase (C4) Butirato de 2-naftilo  + 
4 Lipoid esterase (C8) 2-naftiloctanoato  + 
5 Lipase (C14) 2-naphthyl myristate W
6 Leucine aromatic aminopeptidase L-leucyl-2-naphthylamine  + 
7 Valine aromatic aminopeptidase L-prolyl-2-naphthylamine –
8 Cystine aromatic aminopeptidase L-cystyl-2-naphthylamine –
9 Trypsin N-benzoil-DL-arginil-2-naftilamina –
10 Chymotrypsin N-glutaril-fenilalanina 2-naftilamina –
11 Acid phosphatase N-naftil-fosfato  + 
12 Naphthol-AS-BI- phosphohydrolase Naphthol-AS-BI-phosphate  + 
13 α—Galactosidase 6-bromo-2-naphthyl-αD-galactopyranoside –
14 β—Galactosidase 2-naphthyl-β-D-galactopyranoside –
15 β—Glucuronidase Naftol-AS-βD-glucuronato –
16 α—Glucosaccharase 2-naphthyl-αD-glucopiranósido –
17 β—Glucosaccharase 6-bromo-2-naphthyl-βD-glucopiranósido –
18 N-acetyl-glucosaminidase 1-naftil-N-acetil-βD-glucosamina –
19 α—mannosidase 6-bromo-2-naphthyl-αD-mannofuranoside –
20 β—fucosidase 2-naphthyl-αL-fructopyranose –

 + : Positive reaction; –: Negative reaction, w: weak reaction

Fig. 1.

Fig. 1

A LC-MS detection of intermediates of fluorene catabolism by SMT-1. B Schematic pathway proposed for the degradation of fluorene by Pseudomonas sp. strain SMT-1. A fluorene degradation pathway is proposed based on identification of the metabolic intermediates: 1, fluorene; 2, 9-fluorenol; 3, 9-fluorenone; 4, 3,4-dihydroxy-9-fluorenone; 5, 4-hydroxy-9-fluorenone; 6, 2’,3’-dihydroxy-biphenyl-2-carboxylic acid; 7, 8-hydroxy-3,4-benzocoumarin; 8, phthalate; 9, protocatechuic acid. Structures in brakets are proposed intermediates and have not been detected

Fig. 2.

Fig. 2

A SDS-PAGE analysis of purified recombinant 4921 dioxygenase. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed using a 12% gel. Lane M, protein molecular weight marker (labeled in kDa). Lanes 1, supernatant, lanes 2and 3, the washing fractions with 20 and 50, mM imidazole, respectively. Lane 4 was the final elution using 180 mM imidazole. B Effect of temperature on enzyme activity. C Kinetic curve of 4921 dioxygenases at 25 °C, pH 7.5 in Tris–HCl buffer. D Effects of metal salts on 4921 dioxygenase activity

Fig. 3.

Fig. 3

A Neighbor-joining tree of 4921 dioxygenases from strain SMT-1 and other strains such as Multispecies catechol 12-dioxygenase Pseudomonas (WP 095018433.1), catechol 12-dioxygenase Pseudomonas fragi (WP 095032380.1), catechol 1,2-dioxygenase Pseudomonas sp. TH39 (WP 130871339.1), catechol 1,2-dioxygenase Pseudomonas deceptionensis (WP 048361579.1), catechol 1,2-dioxygenase Pseudomonas psychrophila (WP 046810606.1), etc. B Multiple sequence alignment of 4921- dioxygenase gene using the ClustalW program. Yellow color indicates total matches, blue color indicates the most matches and green color indicates rare matches

Discussion

In this study, a newly isolate fluorene-degrading strain SMT-1, and important genes involved in fluorene degradation were used. Strain SMT-1 contains genes involved in the upper fluorene biodegradation pathway, including α and β subunits of a dioxygenase complex showing 46% and 45% sequence identity with the subunits of an angular dioxygenase from Terrabacter sp. DBF63 mono-oxygenase, 9-hydroxyfluorene dehydrogenase, 1,2-dioxygenase and degrades fluorene through the 9-hydroxyfluorene pathway to form phthalic acid and protocatechuic acid as intermediate products. Microorganisms capable of removing this toxic compound or transforming it into less-toxic substances are of main interest. Isolation, characterization, and genome sequence analysis of Pseudomonas sp. strain SMT-1 that can degrade fluorene was described (Desta et al. 2019). Pseudomonas sp. SMT-1 strain was nominated from other screened species up on its competence to grow on and degrade fluorene and metabolic versatility (Desta et al. 2019). Moreover, understanding the metabolic pathway in toxicant degradation play a pivotal role in the development of bioremediation strategies. The earlier studies show that there were three major catabolic pathways of fluorene degradation. The first pathway initiated at 1,2-dioxygenation of fluorene forms fluorene-1, 2-diol that is further transformed to 3-chromanone via 2-hydroxy-4-(2-oxo-indan-1-ylidene)-2-butenoic acid (Casellas et al. 1997; Monna et al. 1993). The second pathway begins at an initial 3,4-dioxygenation of fluorene leading to salicylate formation (Boldrin et al. 1993). The third pathway starts from C-9 monooxygenation in Brevibacterium sp. and Pseudomonas sp. with subsequent angular carbon dioxygenation to the formation of phthalate that is further transformed to protocatechuate (Boldrin et al. 1993; Wattiau et al. 2011; Grifoll et al. 1994). The catabolic pathway for fluorene transformation was identified based on quantified intermediates. Pseudomonas sp strain SMT-1 has found to degrade fluorene via the third pathway, a similar to Brevibacterium sp. and Pseudomonas sp in which the degradation initiated through monooxygenation of fluorene on C-9 position and give 9-fluorenol which is then dehydrogenated to 9-fluorenone, in which subsequently angular carbon dioxygenation forms 1-hydro-1,1a-dihydroxy-9-fluorenone, leading to phthalate, which is degraded in turn via protocatechuate (Cerniglia et al. 1992; Grifoll et al. 1995). Therefore, this study agrees with the previous study that starts from C-9 monooxygenation in Pseudomonas sp. F274 (Mrozik et al. 2013; Monna et al. 1993). Identification of 8-hydroxy-3,4-benzocoumarin suggests steps in the further catabolism of this compound which involve novel cleavage of the five-membered ring to form a substituted biphenyl, its conversion to phthalate, and further metabolism via 4,5 dihydroxy phthalate, protocatechuate, and 3-carboxy-cis,cis-muconate. An important enzymes, such as, fluorene mono-oxygenase, 9-hydroxyfluorene dehydrogenase, protocatechuate, 3,4dioxygenase, catechol 1,2-dioxygenase which are very important in fluorene degradation were also found in SMT-1. To know the molecular mechanism of fluorene degradation, we assessed putative genes involved in the catabolism of fluorene from genome sequence of strain SMT-1. The fluorene-degrading putative gene fragment was PCR amplified using the specific primers for cloning and expression. The fluorene-degrading gene was heterologously expressed, and purified and characterized. The enzyme activities were measured via regulating substrate degradation and appearance of reaction product by UV–Visible spectrometry. The resting cell reaction was used to detect the conversion of the substrate to the reaction product. Effect of metal salts on enzyme activity was measured to check the effect of metal salts on the enzyme stability. The enzyme activity inhibited when FeCl3 was added; but the enzyme assay was nearly twice as high in the presence of MnCl2. Most of the tested metal salts inhibited enzyme activity to various degrees, and revealed very low activity in the presence of FeCl3.

Conclusion

Organic toxicants are widespread environmental and public health concern. The use of effective and efficient mechanisms and timely intervention are very important. Molecular mechanisms of fluorene degradation and intermediate metabolites in the Pseudomonas sp. SMT-1 strain were identified. The fluorene degradation pathways and catabolic intermediate in the Pseudomonas sp. SMT-1 strain have not been previously described. This is a preliminary finding to define its fluorene-degrading capacity and fluorene-catabolic intermediates that suggest SMT-1 strain metabolizes fluorene via angular deoxygenation and cleavage of the five-membered ring catabolism pathway. A pseudomonas sp. SMT-1 strain is promising and highly effective in degrading fluorene and uses other sources of carbon as growth substrate. The capacity to use wide range of carbon source indicated its adaptability to degrade toxic compounds. The 4921 dioxygenase gene segment from the Pseudomonas sp. SMT-1 strain was amplified, expressed and characterized. The apparent Km and Vmax values were 25.99 µM min−1 and 0.77 U mg−1, respectively. The enzyme was most active at pH 7.5 and 25 °C in Tris–HCl buffer. Pseudomonas sp. SMT-1 strain versatile catabolism activities would be of vital progress to environmental bioremediation. Further study on high molecular weight compounds with many rings would be necessary to more explore the potential of this novel strain in organic toxicant degradation.

Acknowledgements

This work was supported by grants from National Key Research and Development Project (SQ2018YFA090024), the Science and Technology Commission of Shanghai Municipality (17JC1403300), by the “Shuguang Program” (17SG09) supported by Shanghai Education Development Foundation and Shanghai Municipal Education Commission, and by grants from the Chinese National Science Foundation for Excellent Young Scholars (31422004).

Authors’ contributions

HZT outset and designed experiments. MD, ZLG and WW performed experiments. HZT and PX contributed reagents and materials. MD performed all the experiment and data analyses and wrote the manuscript. All authors discussed and revised the manuscript. All authors commented on the manuscript before submission. All authors read and approved the final manuscript.

Declarations

Conflict of interest

The authors declare they have no competing interests.

Accession numbers

The Pseudomonas sp. strain SMT-1 has been deposited in the China Center for Type Culture Collection (CCTCC) under accession number AB2018208. The whole-genome shotgun sequencing data have been deposited at DDBJ/ENA/Gen Bank under accession number QJOV00000000. The version described in this article is the first version QJOV01000000.

References

  1. Boldrin B, Tiehm A, Fritzsche C. Degradation of phenanthrene, fluorene, fluoranthene, and pyrene by a Mycobacterium sp. Appl Environ Microbiol. 1993;59:1927–1930. doi: 10.1128/aem.59.6.1927-1930.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Casellas M, Grifoll M, Bayona J, Solanas A. New metabolites in the degradation of fluorene by Arthrobacter sp. strain F101. Appl Environ Microbiol. 1997;63:819–826. doi: 10.1128/aem.63.3.819-826.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cerniglia E, Sutherland J, Cro WS (1992) Fungal metabolism of aromatic hydrocarbons. In: Winkelmann G (Ed) Microbial degradation of natural products, VCH Verlagsegesellschaft, Weinheim
  4. Desta M, Wang W, Zhang L, Ping X, Tang H. Isolation, characterization and genomic analysis of pseudomonas sp. strain SMT-1, an efficient fluorene-degrading bacterium. J Evolut Bioinf. 2019;15:1–7. doi: 10.1177/1176934319843518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Grifoll M, Selifonov S, Chapman P. Evidence for a novel pathway in the degradation of fluorine by Pseudomonas sp. strain F274. Appl Environ Microbiol. 1994;60:2438–2449. doi: 10.1128/aem.60.7.2438-2449.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Grifoll M, Selifonov S, Gatlin C, Chapman P. Actions of a versatile fluorene-degrading bacterial isolate on polycyclic aromatic hydrocarbons. Appl Environ Microbiol. 1995;61:3711–3723. doi: 10.1128/aem.61.10.3711-3723.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hadibarata T, Teh ZC. Optimization of pyrene degradation by white-rot fungus Pleurotus pulmonarius F043 and characterization of its metabolites. Bioprocess Biosyst Eng. 2014;37(8):1679–1684. doi: 10.1007/s00449-014-1140-6. [DOI] [PubMed] [Google Scholar]
  8. Kawasaki S, Jin F, Takada T. High dispersion power of cardo-typed fluorene. Moieties on Carbon Fillers: INTECH Open Access Publisher; 2011. [Google Scholar]
  9. Kumar S, Stiches G, Tamura K. MEGA 7: molecular genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Latimer J, Zheng J (2003) The sources, transport and fate of PAHin the marine environment. In: Douben PET (Ed) PAHs an ecotoxicological perspective, John Wiley, New York
  11. Liu Y, Wang L, Huang K, Wang W, Nie X, Jiang Y, Li P, Liu S, Xu PHZ. Physiological and biochemical characterization of a novel Nicotine-degrading Bacterium Pseudomonas geniculata N1. PLoS ONE. 2014;9:399. doi: 10.1371/journal.pone.0084399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Monna L, Omori T, Kodama T. Microbial degradation of dibenzofuran, fluorene, and dibenzo-p-dioxin by Staphylococcus auriculans DBF63. Appl Environ Microbiol. 1993;59:285–289. doi: 10.1128/aem.59.1.285-289.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Mrozik A, Piotrowska-Seget Z, Labuzek S, Polish J. Environ. Studies. 2013;12:15–25. [Google Scholar]
  14. Sayed K, Baloo L, Sharma NK. Bioremediation of total petroleum hydrocarbons (TPH) by bioaugmentation and biostimulationin water with floating oil spill containment booms as bioreactor basin. Int J Environ Res Public Health. 2021;18:2226. doi: 10.3390/ijerph18052226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Souza HML, Taniguchi S, Bícego MC. Polycyclic aromatic hydrocarbons in superficial sediments of the Negro River in the Amazon region of Brazil. Jbraz Chem Soc. 2015;26:1438–1449. [Google Scholar]
  16. Syed JH, Iqbal M, Zhong G. Polycyclic Aromatic hydrocarbons in Chinese Forest soils: profile composition, spatial variations and source apportionment. Sci Rep. 2017;7:2692. doi: 10.1038/s41598-017-02999-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Trenz S, Engesser K, Fischer P, Knackmuss H. Degradation of fluorene by Brevibacterium sp. strain DPO1361: a novel C-C bond cleavage mechanism via 1, 10-dihydro-1, 10-dihydroxyfluorene-9-one. J Bacteriol. 1994;176:789–795. doi: 10.1128/jb.176.3.789-795.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Veeranagouda Y, Paul PE, Gorla P, Siddavattam D, Karegoudar TB. Complete mineralization of dimethylformamide by Ochrobactrum sp. DGVK1 isolated from the soil samples collected from the coalmine left overs. Appl Microbiol Biotechnol. 2006;71:369–375. doi: 10.1007/s00253-005-0157-9. [DOI] [PubMed] [Google Scholar]
  19. Wattiau P, Bastiaens L, van Herwijnen R. Fluorene degradation by Sphin-gomonas sp. LB126 proceeds through protocatechuic acid: a genetic analysis. Res Microbiol. 2011;152:861–872. doi: 10.1016/S0923-2508(01)01269-4. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES