Abstract
Early orthodontic correction of skeletal malocclusion takes advantage of mechanical force to stimulate unclosed suture remodeling and to promote bone reconstruction; however, the underlying mechanisms remain largely unclear. Gli1+ cells in maxillofacial sutures have been shown to participate in maxillofacial bone development and damage repair. Nevertheless, it remains to be investigated whether these cells participate in mechanical force-induced bone remodeling during orthodontic treatment of skeletal malocclusion. In this study, rapid maxillary expansion (RME) mouse models and mechanical stretch loading cell models were established using two types of transgenic mice which are able to label Gli1+ cells, and we found that Gli1+ cells participated in mechanical force-induced osteogenesis both in vivo and in vitro. Besides, we found mechanical force-induced osteogenesis through inositol 1,4,5-trisphosphate receptor (IP3R), and we observed for the first time that inhibition of Gli1 suppressed an increase in mechanical force-induced IP3R overexpression, suggesting that Gli1+ cells participate in mechanical force-induced osteogenesis through IP3R. Taken together, this study is the first to demonstrate that Gli1+ cells in maxillofacial sutures are involved in mechanical force-induced bone formation through IP3R during orthodontic treatment of skeletal malocclusion. Furthermore, our results provide novel insights regarding the mechanism of orthodontic treatments of skeletal malocclusion.
1. Introduction
Skeletal malocclusion is the most severe type of malocclusion since it is difficult to correct by orthodontic methods in adults; however, skeletal malocclusion can be corrected using orthopedic force when the patient is at their growth peak with unclosed sutures [1]. It has been reported that unclosed maxillofacial sutures can be remodeled using orthopedic force, and maxillofacial sutures are the residence of mesenchymal stem cells (MSCs) which participate in maxillofacial bone development and damage repair [2, 3]. Moreover, MSCs are commonly known to tend to osteogenesis after stimulation by mechanical stretching or incubation on stiff culture substrates [4–7]. However, it remains largely unclear whether MSCs that reside in maxillofacial sutures participate in orthopedic force-induced bone remodeling during skeletal malocclusion correction. Furthermore, MSCs are not single-cell populations but constitute a complex mixture of multiple types of subpopulations [8]. Gli1+ cells, which are closely associated with osteogenesis and odontogenesis, are one of the subpopulations of MSCs [9], and they were reported to reside in the maxillofacial suture, the periosteum, and the nearby dura. When adjacent bone is injured, Gli1+ cells residing in the suture differentiate and participate in repair mechanisms [10, 11]. Our previous study found that Gli1+ cells in periodontal tissues are involved in orthodontic force-induced alveolar bone remodeling [12]; however, whether and how Gli1+ cells from maxillofacial sutures participate in orthopedic force, greater than orthodontic force, induced maxillofacial bone remodeling remains unknown.
Inositol 1,4,5-trisphosphate receptor (IP3R) is a channel which mainly located on the endoplasmic reticulum (ER) membrane controlling Ca2+ release from the ER [13, 14]. Applying mechanical force on cells causes deformation of cellular membrane structures, and membrane proteins such as IP3R can be easily affected by such force [15–17]. A previous study showed that mechanical stretching induced IP3R-mediated Ca2+ release from the ER and caused intracellular Ca2+ concentrations to increase [18]. The increase in intracellular Ca2+ concentrations was reported to improve osteogenic potential of mouse bone marrow mesenchymal stem cells (BMMSCs) [19]; however, it is unclear whether Gli1+ cells respond to mechanical force through IP3R-regulated intracellular Ca2+ concentration change.
This study is aimed at exploring the role of Gli1+ cells in mechanical force-induced bone remodeling and at elucidating the underlying mechanisms. We verified that Gli1+ cells residing in maxillofacial bone sutures are involved in mechanical force-induced maxillofacial bone formation. And IP3R, the calcium ion channel located on the ER, was involved in mechanical force-induced osteogenesis and was regulated by Gli1+ cells. In conclusion, our study revealed the mechanical sensor role of Gli1+ cells residing in maxillofacial bone sutures, and we describe for the first time that Gli1+ cells respond to mechanical force through IP3R-mediated intracellular Ca2+ concentration changes so as to regulate osteogenesis. Our findings thus provide novel insights into the mechanism of early orthodontic treatments of skeletal malocclusion.
2. Materials and Methods
2.1. Study Animals
We used the mouse strains Gli1-LacZ (JAX no. 008211), Gli1CreERT2 (JAX no. 007913), and ROSA26-mT/mG (JAX no. 007676) acquired from the Jackson Laboratory. The mice were housed in a specific pathogen-free environment under a 12 h light cycle. At an age of 4 weeks, genotyping was performed by PCR according to the procedure recommended by the Jackson Laboratory (primers are showed in Table 1), and mice with suitable genotypes were used for subsequent experiments at an age of 6–8 weeks. All experiments involving animals were performed according to the guidelines of the Intramural Animal Use and Care Committee of the Fourth Military Medical University, Xi'an, China (approval number: 2020-kq-006).
Table 1.
Gene type | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
---|---|---|
Gli1-LacZ (wild type) | GGGATCTGTGCCTGAAACTG | AGGTGAGACGACTGCCAAGT |
Gli1-LacZ (mutant type) | GGGATCTGTGCCTGAAACTG | TCTGCCAGTTTGAGGGGACGAC |
Gli1-CreERT2 (wild type) | GCGGTCTGGCAGTAAAAACTATC | GTGAAACAGCATTGCTGTCACTT |
Gli1-CreERT2 (mutant type) | GGGATCTGTGCCTGAAACTG | CTTGTGGTGGAGTCATTGGA |
mT/mG (wild type) | CTCTGCTGCCTCCTGGCTTCT | CGAGGCGGATCACAAGCAATA |
mT/mG (mutant type) | CTCTGCTGCCTCCTGGCTTCT | TCAATGGGCGGGGGTCGTT |
2.2. Animal Treatments
Eight-week-old transgenic Gli1-LacZ mice were assigned to three groups (RME, RME+GANT61, and control) with three individuals per group. The RME and RME+GANT61 groups were treated as shown in Figure 1(a) and Figure 2(a), respectively, and control mice were not subjected to the RME treatment. The RME model was established as previously described [20]. Briefly, using 0.014-inch Australian arch wire, an opening loop was placed at the palatal side of the molars of the upper jaw and was fixed using a light-cured adhesive (3M Unitek, Monrovia, CA, USA). The force applied on the palatal suture was approximately 0.56 N.
2.3. Drug Administration
To inhibit Gli1 expression, GANT61 (HY-13901; MedChemExpress, South Brunswick, NJ, USA) was dissolved according to the manufacturer's instructions and was intraperitoneally injected at 40 mg/kg of body weight every second day until the mice were sacrificed. For in vitro experiments, 10 μM GANT61 was administered for approximately 6 days after incubation of primary cells. To induce Cre activity, tamoxifen (T5648; Sigma-Aldrich, St. Louis, MO, USA) was intraperitoneally injected at 100 mg/g of body weight for 4 consecutive days. Follow-up experiments were performed 7 days after this treatment (Figure 3(a)). Alizarin complexone (A3882; Sigma-Aldrich) and calcein (C0875; Sigma-Aldrich) used to label newly formed bone were intraperitoneally injected at 100 mg/g of body weight on the day before rapid maxillary expansion (RME) and sacrificing, respectively. To inhibit the function of IP3R, 2-aminoethyl diphenylborinate (2-APB; 3170846; Merck Millipore, Darmstadt, Germany) was applied at a concentration of 70 μM, 24 h after incubation.
2.4. Hematoxylin/Eosin (HE) and Masson's Staining
Freshly collected maxillae were fixed at 4°C overnight using 4% paraformaldehyde (Sigma-Aldrich). Then, 17% ethylenediaminetetraacetic acid solution (MP Biomedicals, Santa Ana, CA, USA) was used to decalcify the samples at 4°C. Decalcified samples were embedded in paraffin and were cut into 4 μm thick sections along the coronal plane. HE (Leica, Wetzlar, Germany) staining and Masson's staining (Baso, Zhuhai, China) were performed according to the manufacturer's instructions.
2.5. Micro-Computed Tomography (Micro-CT) Analysis and Calcein Staining
Maxillae were collected, fixed in 4% paraformaldehyde, and scanned by micro-CT (Siemens Inveon, Erlangen, Germany). The horizontal plane was examined, and distances between the bilateral first molars were measured using ImageJ (Media Cybernetics, USA). For calcein staining, fixed samples were dehydrated and embedded in resin. Samples were then cut along the coronal plane and were observed by laser confocal microscopy (A1 Plus, Nikon, Tokyo, Japan), and the distances between two green lines were measured using ImageJ.
2.6. Immunofluorescence Staining
Frozen sections of decalcified samples were used for immunofluorescence staining. Briefly, sections were permeabilized at room temperature (RT) for 10 min using 0.3% TritonX-100 (Sigma-Aldrich); they were blocked using goat serum (Sigma-Aldrich) at 37°C for 30 min and were then incubated with primary antibodies (Table 2) at 4°C overnight. On the following day, the samples were incubated with the respective secondary antibodies in the dark for 2 h at 37°C, and nuclei were dyed using Hoechst (MedChemExpress) for 15 minutes at RT.
Table 2.
Antibody | Manufacture | Catalogue number | Concentration | Application |
---|---|---|---|---|
Anti-GAPDH | Yesen Biotechnology | 30201ES20 | 1 : 2000 | WB |
Anti-beta tubulin | Proteintech | 10068-1-AP | 1 : 2000 | WB |
Anti-RUNX2 | Cell Signaling Technology | 12556 | 1 : 200 for IF; 1 : 1000 for WB | IF; WB |
Anti-β-gal | Abcam | ab9361 | 1 : 200 | IF |
Anti-IP3R | Abcam | ab108517 | 1 : 200 for IF; 1 : 1000 for WB | IF; WB |
Anti-ALP | Santa Cruz Biotechnology | sc-79840 | 1 : 1000 | WB |
Anti-Col1 | Abcam | ab34710 | 1 : 1000 | WB |
Anti-CD73 | eBioscience | 12-0731 | 1 : 100 | FC |
Anti-CD105 | BioLegend | 120413 | 1 : 100 | FC |
Anti-CD29 | eBioscience | 17-0291-82 | 1 : 100 | FC |
Anti-CD11b | BioLegend | 101227 | 1 : 100 | FC |
Anti-CD45 | BD Pharmingen | 553134 | 1 : 100 | FC |
Anti-sca-1 | eBioscience | 17-5981 | 1 : 100 | FC |
2.7. Isolation of JBMMSCs
Jaw bones of six-week-old tamoxifen-treated Gli1-mT/mG transgenic mice were separated and were washed using phosphate-buffered saline (PBS; Gibco, Thermo Fisher Scientific, Waltham, MA, USA). All teeth were carefully removed, and residual bone was cut to pieces using sterile scissors. Bone tissue was then digested using dispase II (Sigma-Aldrich) and collagenase I (MP Biomedicals) at a proportion of 1 : 1 for 1 h at 37°C. Sufficient culture medium containing 20% fetal bovine serum (FBS; Tianhang, Zhejiang, China) was added to terminate digestion after which the mixture was centrifuged at 800 rpm for 5 min. The supernatant was removed, and the pellet was resuspended in culture medium containing α-minimal essential medium (α-MEM; Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 20% FBS, 2 mM L-glutamine (Invitrogen), 100 U/mL penicillin (Invitrogen), and 100 g/mL streptomycin (Invitrogen) after which it was incubated at 37°C and 5% CO2. Passage 3 was used for the following experiments.
2.8. Mechanical Stretching of JBMMSCs
JBMMSCs were seeded on six-well BioFlex culture plates (Flexcell, Burlington, NC, USA) at a density of 2 × 105 cells per well. When cells reached 80% confluence, 8% elongation at 0.5 Hz was applied for 6 h each day using a FX-4000™ Tension System (Flexcell). After 3 days, cells were harvested for the following experiments.
2.9. Alizarin Red and Alkaline Phosphatase (ALP) Staining
JBMMSCs were seeded in six-well plates at a density of 2 × 105 cells per well, and when cells reached 70% confluence, the culture medium was replaced with osteogenic medium containing 50 μg/mL ascorbic acid (MP Biomedicals), 2 mM β-glycerophosphate (Sigma-Aldrich), and 10 nM dexamethasone (Sigma-Aldrich). After 7 days of osteogenic induction, ALP staining was performed using an alkaline phosphatase assay kit (P0321; Beyotime, Shanghai, China) according to the manufacturer's protocol to test ALP activity. After 14 days, alizarin red staining was performed to assess the extent of mineralization. Briefly, cells were fixed using 4% paraformaldehyde for 30 min, washed using PBS, stained with alizarin red solution for 30 min, and then washed again using PBS. After recording pictures of alizarin red-stained cells, calcified nodules were dissolved using 10% cetylpyridinium chloride, and absorbance value was measured at 570 nm to assess calcium concentrations.
2.10. Oil Red O Staining
JBMMSCs were seeded in six-well plates at a density of 2 × 105 cells per well. When the cells reached 70% confluence, the culture medium was replaced by adipogenic induction medium containing 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, and 0.1 mM indomethacin (Sigma-Aldrich). After the 7-day adipogenic induction, cells were fixed using 4% paraformaldehyde for 30 min, washed using PBS, stained with Oil Red O (Aladdin, Shanghai, China) solution for 30 min, and then washed again using PBS.
2.11. Colony Formation Assay
Primary cells were used for the colony formation assay. Approximately 7 days after primary cell incubation, colonies were observed using a microscope. Cells were then fixed using 4% paraformaldehyde for 30 min, washed with PBS, stained with crystal violet solution for 30 min, and then washed again using PBS.
2.12. Flow Cytometry Analysis
Flow cytometry was used to identify JBMMSCs, to assess the proportion of Gli1+ cells in the complete JBMMSC population, and to measure concentrations of intracellular calcium ions. To identify JBMMSCs, cells were digested using 0.25% trypsin (MP Biomedicals) and were washed using PBS, after which the cells were resuspended in centrifuge tubes using 100 μL PBS and incubated at RT for 45 min with 1 μL primary antibodies per tube (Table 1). After washing twice using PBS, cells were examined by flow cytometry (FACSAria, BD Biosciences, San Jose, CA, USA). To assess the proportion of Gli1+ cells, the cells were digested using trypsin, washed using PBS, and subsequently analyzed by flow cytometry using the FITC channel. To measure intracellular calcium ion concentrations, cells were washed using PBS and were then incubated with 5 μM Fluo-8AM (21081; AAT Bioquest, Sunnyvale, CA, USA) for 30 min at RT. After washing twice using PBS, cells were digested using trypsin and were examined by flow cytometry, and mean fluorescence intensity was used to evaluate intracellular calcium ion concentrations.
2.13. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
Total RNA was extracted from the samples using TRIzol reagent (Invitrogen), and RNA was reverse-transcribed to cDNA. Expression of IP3Rs and of osteogenic markers including Col1, ALP, and RUNX2 was evaluated using RT-qPCR as previously described [21], with GAPDH as an internal reference. PCR primer sequences are shown in Table 3.
Table 3.
Gene | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
---|---|---|
GAPDH | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG |
ALP | CCAACTCTTTTGTGCCAGAGA | GGCTACATTGGTGTTGAGCTT TT |
RUNX2 | GACTGTGGTTACCGTCATGGC | ACTTGGTTTTTCATAACAGCGGA |
Col1 | GCTGGAGTTTCCGTGCCT | GACCTCGGGGACCCATTG |
IP3R1 | ATTTGTTCTCTGTATGCGGAGG | AGCTTAAAGAGGCAGTCTCTGA |
IP3R2 | CCTCGCCTACCACATCACC | TCACCACTCTCACTATGTCGT |
IP3R3 | GCCCTTACATGCCAGCAACTA | GCTTGCCCCTGTACTCATCAC |
2.14. Western Blotting
Total protein was extracted from the samples using lysis buffer (Beyotime), and protein concentrations were measured using a bicinchoninic acid (BCA) protein assay kit (Tiangen, Beijing, China) according to the manufacturer's instructions. Subsequently, 20 μg total protein of each sample was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and was transferred to a polyvinylidene fluoride (PVDF) membrane. After 2 h, membranes were blocked using 5% nonfat milk for 1 h and were then incubated with primary antibodies (Table 2) overnight at 4°C. On the following day, the membranes were incubated with the respective horseradish peroxidase-conjugated secondary antibodies for 2 h at RT. A chemiluminescent detection system was used to produce the readings.
2.15. Statistical Analyses
Data are shown as the means ± standard deviation. Analyses were performed using GraphPad Prism (version 8.0.0 for Windows, GraphPad Software, San Diego, CA, USA). Differences between two groups were tested using two-tailed unpaired Student's t-test, and statistical significance is reported at P < 0.05.
3. Results and Discussion
3.1. Gli1+ Cells Residing in Palatal Sutures Involved in Mechanical Force-Induced Maxillofacial Bone Remodeling
In order to investigate the role of Gli1+ cells in mechanical force-induced maxillofacial bone remodeling, we established a RME mouse model to imitate the procedure of orthodontic treatment of skeletal malocclusion using Gli1-LacZ transgenic mice to help detect Gli1+ cells after LacZ staining; as a control, we used mice that were not subjected to RME treatments (Supplementary Figure 1). HE staining showed that palatal sutures of mice in the experimental group were expanded and considerably wider than those of control mice (Figure 1(b)). In addition, periosteal cells on the nasal and oral sides of the palatal sutures increased and migrated into the palatal suture at the early stage of RME; however, cells on both sides decreased during the late stage (Supplementary Figure 2(a)). Masson's staining showed that collagen in the palatal suture was reoriented due to the effects of mechanical force (Figure 1(b)). Furthermore, dynamic bone labelling by calcein staining demonstrated that bone deposition in midpalatal of the RME group was much more than in the controls (Figures 1(c) and 1(d)). Moreover, micro-CT showed that the width of midpalatal suture was wider in the RME group (Figures 1(e) and 1(f)), indicating that palatal sutures of the RME group were expanded. To assess expression patterns in Gli1+ cells, we measured Gli1 expression using immunofluorescence staining and found that Gli1+ cells started to increase on the nasal and oral sides of the palatal suture to a maximum on day 7 after which they decreased over the following days (Figures 1(g) and 1(h); Supplementary Figure 2(b)). Mice of both groups were thus sacrificed on day 7 to conduct the follow-up experiments. In order to assess bone formation during RME, expression of the early osteogenic differentiation marker runt-related transcription factor 2 (RUNX2) was used to evaluate osteogenesis in cells in the expansion area. After a seven-day RME procedure, RUNX2 expression was increased on the nasal and oral sides of the palatal suture (Figures 1(g) and 1(i)), which was consistent with expression patterns of Gli1+ cells. Furthermore, most Gli1+ cells showed upregulated expression of RUNX2, indicating that most Gli1+ cells participated in mechanical force-induced osteogenesis (Figures 1(g) and 1(j)). These results show that bone remodeling was faster in the RME group and that Gli1+ cells residing in maxillofacial sutures participate in mechanical force-induced bone remodeling.
3.2. Pharmacological Inhibition of Gli1+ Cells Suppresses Mechanical Force-Induced Maxillofacial Bone Remodeling
To further confirm the crucial role of Gli1+ cells in mechanical force-induced maxillofacial bone remodeling, Gli1-LacZ transgenic mice subjected to RME treatments were treated with GANT61, a small molecular inhibitor of Gli1, to inhibit Gli1+ cells (RME+GANT61) while the control group was treated with vehicle only (Figure 2(a)). HE staining showed that the mechanical force-induced cell increase on the nasal and oral sides of the palatal suture was suppressed after the GANT61 treatment, and widening of the palatal suture was also suppressed. Masson's staining showed inhibition of collagen reorienting after GANT61 application (Figure 2(b)). In addition, a decrease in bone deposition rate and lower palatal suture width were observed in the GANT61 treatment group using calcein staining (Figures 2(c) and 2(d)) and micro-CT analysis (Figures 2(e) and 2(f)), respectively. More importantly, immunofluorescence staining demonstrated that GANT61 application prevented the RME-induced increase in Gli1+ (Figures 2(g) and 2(h)) and RUNX2+ cells (Figures 2(g) and 2(i)) and suppressed RUNX2+ and Gli1+ cells (Figures 2(g) and 2(j)). Inhibition of Gli1+ cells suppressed mechanical force-induced bone remodeling, indicating that Gli1+ cells play a critical role in the process of mechanical force-induced bone remodeling.
3.3. Mechanical Stretching Induces Gli1+ Cell Increases and Regulates JBMMSC Osteogenesis via IP3R-Mediated Intracellular Calcium Increases
To imitate the mechanical force shared by JBMMSCs during RME progression, mechanical stretching was applied to JBMMSCs separated from the jaw bone of Gli1-mT/mG transgenic mice. This type of transgenic mice shows green fluorescence of Gli1+ after tamoxifen application, while other cells show red fluorescence. Identification of cells from the jaw bone showed positive expressing certain surface markers of MSCs, such as sca-1, CD29, CD105, and CD73 and negative expressing CD45 and CD11b (Supplementary Figure 3(a)); furthermore, they showed typical MSC including osteogenesis, adipogenesis, and clone formation [8] (Supplementary Figure 3(b)). What is more, flow cytometry showed that Gli1+ cells were involved in JBMMSCs under physiological conditions, and the proportion of Gli1+ cells increased after mechanical stretching (Figures 3(b) and 3(c)). Moreover, after mechanical stretching, cells were elongated and were rearranged in the direction of the applied mechanical force (Supplementary Figure 4), and it has been reported that elongated MSCs tend to engage in osteogenesis [22]. Thus, JBMMSCs subjected to mechanical stretching and controls were cultured in osteogenic medium, and ALP and alizarin red staining were used to evaluate osteogenic effects in both groups. Both ALP and alizarin red staining showed upregulation of osteogenesis in JBMMSCs after mechanical stretching (Figures 3(d) and 3(e)). Consistently, western blotting and RT-qPCR showed increased expression of osteogenic differentiation markers, including ALP, RUNX2, and Col1 in the mechanical stretch group (Figures 3(f) and 3(g)). Ion channels residing in membrane structures of cells were previously reported to act as mechanical sensors [23, 24], and intracellular calcium ion was recognized as a common second messenger responding to mechanical force [25, 26]. Thus, we measured expression levels of IP3R, which is a calcium channel residing in the ER membrane [13, 14]. As expected, RNA and protein expressions of IP3R were upregulated after mechanical stretching (Figures 3(f) and 3(h)), and intracellular calcium concentrations were also increased (Figure 3(i)). In order to confirm whether IP3R-mediated changes in intracellular calcium concentrations were related to mechanical force-induced JBMMSC osteogenesis, we inhibited IP3R using 2-APB, a blocker of IP3R, and found that mechanical stretch-induced intracellular calcium was reduced (Figure 4(a)) and that mechanical stretch-induced osteogenesis was also inhibited (Figures 4(b)–4(e)). In summary, mechanical stretching increased the proportion of Gli1+ cells and induced JBMMSC osteogenesis through an IP3R-mediated increase in intracellular calcium concentrations. Based on these results, we speculate that Gli1+ cells may participate in mechanical force-mediated JBMMSC osteogenesis through an IP3R-mediated increase in intracellular calcium concentrations.
3.4. Gli1+ Cells Participate in Mechanical Force-Mediated JBMMSC Osteogenesis through an IP3R-Induced Intracellular Calcium Concentration Increase
To confirm whether Gli1+ cells involved in mechanical stretching induced JBMMSC osteogenesis, we pharmacologically inhibited Gli1+ cells in JBMMSCs using GANT61. Six days after JBMMSCs were isolated from Gli1-mT/mG transgenic mice, GANT61 was applied until JBMMSCs were harvested for the follow-up experiments (Figure 5(a)). Flow cytometry demonstrated that the mechanical stretching-induced increase in Gli1+ cells was inhibited by GANT61 (Figures 5(b) and 5(c)). ALP and alizarin red staining showed an inhibition of osteogenesis in the Gli1+ cell inhibition group (Figures 5(d) and 5(e)), and western blotting and RT-qPCR demonstrated downregulation of ALP, RUNX2, and Col1 in the GANT61 group (Figures 5(f) and 5(g)). These results were consistent with the in vivo experiment and confirmed that Gli1+ cells play an important role in mechanical stretch-induced osteogenesis of JBMMSCs. In line with our hypothesis, the upregulated RNA and protein expression of IP3R induced by mechanical stretching was downregulated due to inhibition of Gli1+ cells (Figures 5(f) and 5(h)), which also led to reduced intracellular calcium concentrations (Figure 5(i)) and thus reduced the osteogenic potential of JBMMSCs. Taken together, our results suggest that Gli1+ cells participate in mechanical force-mediated JBMMSC osteogenesis through an IP3R-mediated increase in intracellular calcium concentrations.
3.5. Gli1+ Cells Participate in RME-Induced Bone Formation via IP3R Upregulation
To confirm the effects of Gli1+ cells on mechanical force-induced IP3R upregulation, we measured IP3R+ cells and Gli1+ cells in palatal suture of RME mouse models to support in vitro experiments. And found that IP3R+ cells increased in RME mice compared with the controls (Figures 6(a) and 6(b)), and most of the increased IP3R+ cells were Gli1+ cells (Figures 6(a) and 6(c)). After inhibition of Gli1+ cells in RME mice, mechanical force-induced IP3R+ cells increase impeded as well (Figures 6(a) and 6(b)), and so did Gli1+ and IP3R+ cells (Figures 6(a) and 6(c)). The in vivo experiment thus also demonstrated that Gli1+ cells participated in mechanical force-induced bone formation through IP3R upregulation.
4. Discussion
Early orthodontic treatment of skeletal malocclusion relies on unclosed sutures in the maxillofacial bones [27]; however, it remains unclear how cells residing in sutures react to mechanical force. Gli1+ cells in maxillofacial sutures are the basis of maxillofacial bone development and damage repair [10], and Gli1+ periodontium stem cells have been identified as mechanical sensors during mechanical force-induced alveolar bone remodeling [12, 28]. In the current study, Gli1+ cells residing in maxillofacial sutures were found to participate in mechanical force-induced bone formation through an IP3R-mediated increase in intracellular calcium levels in vitro and in vivo.
Gli1+ cells are recognized as a subpopulation of MSCs residing surrounding neurovascular bundle (NVB) of dental pulp and bones and are crucial for osteogenesis and odontogenesis under physiological and pathological conditions [9, 29]. Recently, these cells were found to reside in proximity of the NVB of the periodontium and at the front of bone and cementum formation where they act as mechanical sensors during mechanical force-induced bone remodeling [12, 28, 30]. Unlike long bones, maxillofacial bones are flat bones with little bone marrow and few NVBs [31, 32]; however, Gli1+ cells are still found in the periosteum, the dura, and in the suture mesenchyme of maxillofacial bones, and are able to participate in bone formation [10]. And as predicted, Gli1+ cells residing in the maxillofacial bone were found to act as mechanical sensors after stimulation by mechanical force. After pharmacological inhibition of Gli1 expression, mechanical force-induced bone remodeling was impeded. This is consistent with the clinical finding that RME treatment shows no expansion effect on midpalatal sutures in patients with solitary median maxillary central incisor syndrome (SMMCI), which was proven to be caused by a mutation in the SHH gene upstream of Gli1 [33]. Thus, there is reasonable doubt about whether Gli1+ cell deficiency occurs in patients with SMMCI, and our study provides valuable insights which may help understand this particular syndrome.
So far, Gli1+ cells have only been shown to act as mechanical sensors in mechanical force-induced bone remodeling progress in vivo. Thus, we performed an in vitro experiment by applying mechanical stretching to JBMMSCs to assess changes in the Gli1+ cell population and in JBMMSC osteogenesis. Since cells residing in suture were very limited and Gli1+ cells are a considerably small population of MSCs under physiological conditions [10, 34], thus it is complicated to acquire MSCs from midpalatal sutures and to then isolate Gli1+ cells from them. Our in vivo experiments showed that Gli1+ cells increased not only at the centre of the suture but also in the periosteum around the suture. We therefore separated cells from the jaw bone and examined mechanosensing functions of Gli1+ cells during mechanical force-induced osteogenesis by downregulating Gli1 expression. Cells separated from the jaw bone showed typical MSC characteristics, and when cells were cultured to passage 3, the proportion of Gli1+ cells was about 30%, which is in line with previous research showing that Gli1+ cells residing in maxillofacial suture were MSCs [10]. Our findings imply that Gli1+ cells examined in the current study are in fact MSCs. Because of technical limitations, it was difficult for us to separate Gli1+ cells and to directly examine their characteristics under physiological and during mechanical forcing. Thus, more effort should be made to resolve such technical limitations.
Molecules located on cell membranes can sense mechanical signals and transduce them to the nucleus [35, 36]. And calcium ion channels located on cell membranes play a vital role in mechanical force transduction [24]. IP3R which is a type of calcium ion channels mainly located on ER membrane is related to mechanical force-induced calcium change in MSCs [25]. In the present study, we observed that IP3R responded to mechanical force and elicited changes in intracellular calcium concentrations during mechanical force-induced bone remodeling. To our knowledge, our study is the first to describe the association between Gli1+ cells and IP3R-mediated intracellular calcium concentration changes during mechanical force-induced bone formation. However, our results only provide preliminary insights into how Gli1+ cells may regulate mechanical force-induced osteogenesis. The mechanism by which Gli1 regulates IP3R and how intracellular calcium concentration changes affect osteogenesis after mechanical force application require further research. Besides, since 2-APB is mainly used in vitro experiment, and it is hard for mouse to survive after multiple drug treatment and RME operation, we only blocked the function of IP3R in vitro experiment to verify the crucial role of IP3R in mechanical force-induced osteogenesis; more effort should be made to conquer technical limitation to regulate IP3R in vivo and confirm the role of IP3R in mechanical force-induced bone formation during RME process.
5. Conclusions
We demonstrated the crucial role of Gli1+ cells residing in maxillofacial sutures during mechanical force-induced bone remodeling using in vivo and in vitro experiments. Gli1+ cells participated in mechanical force-mediated osteogenesis by regulating IP3R-mediated intracellular calcium concentration, suggesting a novel approach for the orthodontic treatment of skeletal malocclusion.
Acknowledgments
We thank Prof. Shibing Yu for the experimental technology support. This work was supported by the National Natural Science Foundation of China (Nos. 82071075, 81930025, and 81900957).
Contributor Information
Xiaoning He, Email: hxn_800222@163.com.
Kun Xuan, Email: xuankun@fmmu.edu.cn.
Yan Jin, Email: yanjin@fmmu.edu.cn.
Data Availability
The raw data used to support the findings of this study are available from the corresponding authors upon request.
Conflicts of Interest
The authors declare that there is no conflict of interest regarding the publication of this paper.
Authors' Contributions
Xiaoyao Huang and Zihan Li contributed equally to this work.
Supplementary Materials
References
- 1.Caplin J., Han M. D., Miloro M., Allareddy V., Markiewicz M. R. Interceptive dentofacial orthopedics (growth modification) Oral and Maxillofacial Surgery Clinics of North America. 2020;32(1):39–51. doi: 10.1016/j.coms.2019.08.006. [DOI] [PubMed] [Google Scholar]
- 2.Maruyama T., Jeong J., Sheu T. J., Hsu W. Stem cells of the suture mesenchyme in craniofacial bone development, repair and regeneration. Nature Communications. 2016;7(1) doi: 10.1038/ncomms10526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Katebi N., Kolpakova-Hart E., Lin C. Y., Olsen B. R. The mouse palate and its cellular responses to midpalatal suture expansion forces. Orthodontics & Craniofacial Research. 2012;15(3):148–158. doi: 10.1111/j.1601-6343.2012.01547.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Li C. X., Talele N. P., Boo S., et al. MicroRNA-21 preserves the fibrotic mechanical memory of mesenchymal stem cells. Nature Materials. 2017;16(3):379–389. doi: 10.1038/nmat4780. [DOI] [PubMed] [Google Scholar]
- 5.Chen X., Liu Y., Ding W., et al. Mechanical stretch-induced osteogenic differentiation of human jaw bone marrow mesenchymal stem cells (hJBMMSCs) via inhibition of the NF-κB pathway. Cell Death & Disease. 2018;9(2):207–207. doi: 10.1038/s41419-018-0279-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang C., Shan S., Wang C., et al. Mechanical stimulation promote the osteogenic differentiation of bone marrow stromal cells through epigenetic regulation of Sonic Hedgehog. Experimental Cell Research. 2017;352(2):346–356. doi: 10.1016/j.yexcr.2017.02.021. [DOI] [PubMed] [Google Scholar]
- 7.He L., Ahmad M., Perrimon N. Mechanosensitive channels and their functions in stem cell differentiation. Experimental Cell Research. 2019;374(2):259–265. doi: 10.1016/j.yexcr.2018.11.016. [DOI] [PubMed] [Google Scholar]
- 8.Kfoury Y., Scadden D. T. Mesenchymal cell contributions to the stem cell niche. Cell Stem Cell. 2015;16(3):239–253. doi: 10.1016/j.stem.2015.02.019. [DOI] [PubMed] [Google Scholar]
- 9.Zhao H., Feng J., Seidel K., et al. Secretion of Shh by a neurovascular bundle niche supports mesenchymal stem cell homeostasis in the adult mouse incisor. Cell Stem Cell. 2014;14(2):160–173. doi: 10.1016/j.stem.2013.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zhao H., Feng J., Ho T. V., Grimes W., Urata M., Chai Y. The suture provides a niche for mesenchymal stem cells of craniofacial bones. Nature Cell Biology. 2015;17(4):386–396. doi: 10.1038/ncb3139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Di Pietro L., Barba M., Prampolini C., et al. GLI1 and AXIN2 are distinctive markers of human calvarial mesenchymal stromal cells in nonsyndromic craniosynostosis. International Journal of Molecular Sciences. 2020;21(12):p. 4356. doi: 10.3390/ijms21124356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Liu A. Q., Zhang L. S., Chen J., et al. Mechanosensing by Gli1+ cells contributes to the orthodontic force-induced bone remodelling. Cell Proliferation. 2020;53(5, article e12810) doi: 10.1111/cpr.12810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Prole D. L., Taylor C. W. Structure and function of IP3Receptors. Cold Spring Harbor Perspectives in Biology. 2019;11(4) doi: 10.1101/cshperspect.a035063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhang S., Fritz N., Ibarra C., Uhlén P. Inositol 1, 4, 5-trisphosphate receptor subtype-specific regulation of calcium oscillations. Neurochemical Research. 2011;36(7):1175–1185. doi: 10.1007/s11064-011-0457-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chen X., Yan J., He F., et al. Mechanical stretch induces antioxidant responses and osteogenic differentiation in human mesenchymal stem cells through activation of the AMPK-SIRT1 signaling pathway. Free Radical Biology & Medicine. 2018;126:187–201. doi: 10.1016/j.freeradbiomed.2018.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Maeda E., Atsumi Y., Ishiguro M., Nagayama K., Matsumoto T. Shape-dependent regulation of differentiation lineages of bone marrow-derived cells under cyclic stretch. Journal of Biomechanics. 2019;96:109371–109371. doi: 10.1016/j.jbiomech.2019.109371. [DOI] [PubMed] [Google Scholar]
- 17.Castillo A. B., Jacobs C. R. Mesenchymal stem cell mechanobiology. Current Osteoporosis Reports. 2010;8(2):98–104. doi: 10.1007/s11914-010-0015-2. [DOI] [PubMed] [Google Scholar]
- 18.Zheng J., Zhai K., Chen Y., et al. Nitric oxide mediates stretch-induced Ca2+ oscillation in smooth muscle. Journal of Cell Science. 2016;129:2430–2437. doi: 10.1242/jcs.180638. [DOI] [PubMed] [Google Scholar]
- 19.Wu L., Zhang G., Guo C., Pan Y. Intracellular Ca2+ signaling mediates IGF-1-induced osteogenic differentiation in bone marrow mesenchymal stem cells. Biochemical and Biophysical Research Communications. 2020;527(1):200–206. doi: 10.1016/j.bbrc.2020.04.048. [DOI] [PubMed] [Google Scholar]
- 20.Hou B., Fukai N., Olsen B. R. Mechanical force-induced midpalatal suture remodeling in mice. Bone. 2007;40(6):1483–1493. doi: 10.1016/j.bone.2007.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hlaing E. E. H., Ishihara Y., Wang Z., Odagaki N., Kamioka H. Role of intracellular Ca2+–based mechanotransduction of human periodontal ligament fibroblasts. FASEB Journal. 2019;33(9):10409–10424. doi: 10.1096/fj.201900484R. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jiang L., Sun Z., Chen X., et al. Cells sensing mechanical cues: stiffness influences the lifetime of cell-extracellular matrix interactions by affecting the loading rate. ACS Nano. 2016;10(1):207–217. doi: 10.1021/acsnano.5b03157. [DOI] [PubMed] [Google Scholar]
- 23.Jia X., Su H., Chen X., et al. A critical role of the KCa3.1 channel in mechanical stretch-induced proliferation of rat bone marrow-derived mesenchymal stem cells. Journal of Cellular and Molecular Medicine. 2020;24(6):3739–3744. doi: 10.1111/jcmm.15014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chubinskiy-Nadezhdin V. I., Vasileva V. Y., Pugovkina N. A., et al. Local calcium signalling is mediated by mechanosensitive ion channels in mesenchymal stem cells. Biochemical and Biophysical Research Communications. 2017;482(4):563–568. doi: 10.1016/j.bbrc.2016.11.074. [DOI] [PubMed] [Google Scholar]
- 25.Kim T. J., Joo C., Seong J., et al. Distinct mechanisms regulating mechanical force-induced Ca2+ signals at the plasma membrane and the ER in human MSCs. eLife. 2015;4, article e04876 doi: 10.7554/eLife.04876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wang J., Lu D., Mao D., Long M. Mechanomics: an emerging field between biology and biomechanics. Protein & Cell. 2014;5(7):518–531. doi: 10.1007/s13238-014-0057-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Guerrero J. A., Silva R. S., de Abreu Lima I. L., et al. Maxillary suture expansion: a mouse model to explore the molecular effects of mechanically-induced bone remodeling. Journal of Biomechanics. 2020;108:p. 109880. doi: 10.1016/j.jbiomech.2020.109880. [DOI] [PubMed] [Google Scholar]
- 28.Men Y., Wang Y., Yi Y., et al. Gli1+ periodontium stem cells are regulated by osteocytes and occlusal force. Developmental Cell. 2020;54(5):639–654.e6. doi: 10.1016/j.devcel.2020.06.006. [DOI] [PubMed] [Google Scholar]
- 29.Shi Y., He G., Lee W. C., McKenzie J. A., Silva M. J., Long F. Gli1 identifies osteogenic progenitors for bone formation and fracture repair. Nature Communications. 2017;8(1):p. 2043. doi: 10.1038/s41467-017-02171-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Xie X., Xu C., Zhao H., Wang J., Feng J. Q. A biphasic feature of Gli1(+)-mesenchymal progenitors during cementogenesis that is positively controlled by Wnt/β-catenin signaling. Journal of Dental Research. 2021;100 doi: 10.1177/00220345211007429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yang M., Zhang H., Gangolli R. Advances of mesenchymal stem cells derived from bone marrow and dental tissue in craniofacial tissue engineering. Current Stem Cell Research & Therapy. 2014;9(3):150–161. doi: 10.2174/1574888x09666140213142258. [DOI] [PubMed] [Google Scholar]
- 32.Robey P. G. Cell sources for bone regeneration: the good, the bad, and the ugly (but Promising) Tissue Engineering Part B: Reviews. 2011;17(6):423–430. doi: 10.1089/ten.teb.2011.0199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Bolan M., Derech C. D., Côrrea M., Ribeiro G. L. U., Almeida I. C. S. Palatal expansion in a patient with solitary median maxillary central incisor syndrome. American Journal of Orthodontics and Dentofacial Orthopedics : official publication of the American Association of Orthodontists, Its Constituent Societies, and the American Board of Orthodontics. 2010;138(4):493–497. doi: 10.1016/j.ajodo.2008.09.037. [DOI] [PubMed] [Google Scholar]
- 34.Chen J., Li M., Liu A. Q., et al. Gli1+ cells couple with type H vessels and are required for type H vessel formation. Stem Cell Reports. 2020;15(1):110–124. doi: 10.1016/j.stemcr.2020.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Uda Y., Azab E., Sun N., Shi C., Pajevic P. D. Osteocyte mechanobiology. Current Osteoporosis Reports. 2017;15(4):318–325. doi: 10.1007/s11914-017-0373-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wu T., Yin F., Wang N., et al. Involvement of mechanosensitive ion channels in the effects of mechanical stretch induces osteogenic differentiation in mouse bone marrow mesenchymal stem cells. Journal of Cellular Physiology. 2021;236(1):284–293. doi: 10.1002/jcp.29841. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The raw data used to support the findings of this study are available from the corresponding authors upon request.