Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Oct 1.
Published in final edited form as: Domest Anim Endocrinol. 2021 May 2;77:106632. doi: 10.1016/j.domaniend.2021.106632

Maternal nutrient restriction alters thyroid hormone dynamics in placentae of sheep having small for gestational age fetuses

C B Steinhauser a,#, K Askelson a,#, K C Hobbs a, F W Bazer a, M C Satterfield a,*
PMCID: PMC8380679  NIHMSID: NIHMS1699578  PMID: 34062290

Abstract

Thyroid hormones regulate a multitude of metabolic and cellular processes involved in placental and fetal growth, while maternal nutrient restriction (NR) has the potential to influence these processes. Those fetuses most impacted by NR, as categorized by weight, are termed small for gestational age (SGA), but the role of thyroid hormones in these pregnancies is not fully understood. Therefore, the aims of the present study were to determine effects of NR during pregnancy on maternal and fetal thyroid hormone concentrations, as well as temporal and cell-specific expression of mRNAs and proteins for placental thyroid hormone transporters, thyroid hormone receptors, and deiodinases in ewes having either SGA or normal weight fetuses. Ewes with singleton pregnancies were fed either a 100% NRC (n=8) or 50% NRC (NR; n=28) diet from Days 35 to 135 of pregnancy with a single placentome surgically collected on Day 70. Fetal weight at necropsy on Day 135 was used to designate the fetuses as NR NonSGA (n=7; heaviest NR fetuses) or NR SGA (n=7; lightest NR fetuses). Thyroid hormone levels were lower in NR SGA compared to NR NonSGA ewes, while all NR fetuses had lower concentrations of thyroxine at Day 135. Expression of mRNAs for thyroid hormone transporters SLC16A2, SLC16A10, SLCO1C1, and SLCO4A1 were altered by day, but not nutrient restriction. Expression of THRA mRNA and protein was dysregulated in NR SGA fetuses with protein localized to syncytial and stromal cells in placentomes in all groups. The ratio of deiodinases DIO2 and DIO3 was greater for NR SGA placentae at Day 70, while DIO3 protein was less abundant in placentae from NR SGA than 100% NRC ewes. These results identify mid-gestational modifications in thyroid hormone-associated proteins in placentomes of ewes having SGA fetuses, as well as a potential for placentomes from NonSGA pregnancies to adapt to, and overcome, nutritional restrictions during pregnancy.

Keywords: thyroid hormone, thyroid hormone receptor, pregnancy, placenta, small for gestational age, deiodinase

1. Introduction

Maternal nutrient restriction (NR) can induce insufficient placental development and function, which impairs the transfer of nutrients, hormones, gases, and wastes between the mother and fetus [1]. This impairment results in fetuses that fail to meet their growth potential in utero and adults with an increased lifelong incidence of metabolic and cardiovascular disease [2–4]. In humans, those fetuses that fall below the 10th percentile for weight at a specific gestational age are classified as small for gestational age (SGA) [5]. Although there are reports of altered thyroid hormone levels in human and sheep SGA fetuses [6,7], little is known about the impact of NR on metabolism, transport, and function of thyroid hormones in the placenta.

Thyroid hormones play a fundamental role in metabolic and cellular processes in fetal growth and development through regulation of mitochondrial oxygen consumption, carbohydrate and lipid metabolism, and cardiovascular development [8,9]. The sheep placenta is exposed to, and potentially modified in response to, thyroid hormones provided by the dam throughout gestation even though there is minimal evidence of thyroid hormones being transported all the way from maternal to fetal circulation [10,11]. Around mid-gestation (day 60–70) the fetal thyroid begins synthesizing and secreting thyroxine (T4) [9,10]. Fetal lambs that are thyroidectomized in late gestation have altered heart, liver, and renin-angiotensin system function along with decreased skeletal growth [12–15]. These changes are associated with reduced T4 levels, but T3 levels vary between studies [12–15]. Therefore, while the fetus is producing endogenous thyroid hormones during the second half of pregnancy, localized placental transport and regulation of thyroid hormones originating from the mother potentially play a role in placental development and function, influencing fetal development, throughout gestation. Additionally, it is currently unknown whether situations of external stress, such as nutrient restriction, alter the availability and regulation of thyroid hormones in the placenta and fetus.

Cellular transport of T4 and T3 is mediated by multiple membrane transporters, with the most efficient being solute carrier family 16 member 2 (SLC16A2; also known as MCT8), SLC16A10 (also known as MCT10), solute carrier organic anion transporter 1C1(SLCO1C1; also known as OATP1C1), and SLCO4A1 (also known as OATP4A1) [16]. These proteins also transport other molecules (bile acids, prostaglandins, and steroid hormones), have tissue specific expression patterns, and have differing affinities for T4 and T3 [16]. SLC16A2, SLC16A10, SLCO1C1, and SLCO4A1 all localize to human syncytiotrophoblast cells and/or rat trophoblast cells, indicating a potential role in the placenta, with SLC16A2 and SLC16A10 also being differentially regulated in intrauterine growth restricted pregnancies [16–18]. A variety of transporters may be present in the placenta for thyroid hormones due to the necessity of moving thyroid hormone across apical and basal membranes, concentration gradients, and transporting different forms of thyroid hormones.

Deiodinase enzymes metabolize thyroid hormones into more, or less, active forms. Three iodothyronine deiodinases are found in adult and fetal tissues (DIO1, DIO2, DIO3), but only DIO2 and DIO3 are present and active in the placenta [17]. DIO2 converts T4 to the more biologically active T3, while DIO3 converts T4 to inactive rT3 and T3 to inactive T2. Placental deiodinases regulate thyroid hormone availability to cells of the placenta and fetal blood. DIO3, specifically, is hypothesized to play a key role in protecting the fetus from excessive concentrations of thyroid hormones by catalyzing T4 and T3 into their inactive forms [19,20].

T3 binds to one of four nuclear receptors, THRA1, THRB1, THRB2 or THRB3, and the complex acts as a transcription factor to activate downstream targets. In the human placenta, THRA and THRB localize to nuclei of syncytiotrophoblast and cytotrophoblast cells [21,22], but, to our knowledge, the localization of these receptors in sheep placentomes has not been described.

Our previous studies identified greater variability in the growth of fetuses from NR dams, likely reflecting the capacity of the ewe and/or placenta to adapt to nutritional deficiencies [23–26]. Indeed, we have reported that glucose and lipid homeostasis, among other processes, are altered in both the dam and fetus in NR dams carrying SGA fetuses compared to those carrying normal weight fetuses [23,25,26]. Therefore, we hypothesized that thyroid hormone function would also be differentially related to fetal weight in NR dams and fetuses. The aims of the present study were to determine effects of NR during pregnancy on maternal and fetal thyroid hormone concentrations, as well as temporal and cell-specific expression of mRNAs and proteins for placental thyroid hormone transporters, thyroid hormone receptors, and deiodinases in ewes having either SGA or normal weight fetuses.

2. Materials and methods

2.1. Ethics statement

All experimental procedures were approved by, and performed in accordance with, the Texas A&M University Institutional Animal Care and Use Committee and the National Institutes of Health (NIH) guidelines.

2.2. Animal study and tissue collection

Mature Hampshire ewes of similar parity, frame size, and initial body composition were fed to meet 100% of their National Research Council (NRC) [27] nutritional requirements and used as embryo transfer recipients to generate singleton pregnancies, as described previously [23,26]. Pregnancy was diagnosed by ultrasound on Day 28 of gestation. All ewes were housed individually and fed once daily at 0800 from Days 28 to 135 of gestation. Beginning on Day 28 of gestation, feed intake was adjusted based on weekly body weight measurements. On Day 35 of pregnancy, ewes were assigned randomly to either a control-fed group (100% NRC; n=8) or a nutrient-restricted (NR) group (50% NRC; n=28). The diet composition has been published previously [28]. A total caloric restriction (energy and protein) was induced in the NR ewes by providing 50% of the total weight of feed provided to the 100% NRC ewes of the same body weight. The diet formulation included vitamins and minerals, including iodine and selenium, in excess for all 100% NRC and NR ewes. Maternal blood samples were collected on Days 35, 70, 105, and 135 with plasma harvested in EDTA-containing tubes and, after centrifugation, stored at −20°C.

On Day 70 of pregnancy, a single placentome was surgically removed as previously described [29]. Briefly, placentomes were removed from a similar location on the antimesometrial greater curvature of the gravid uterus, near the fetus, but distal to the edge of the amniotic sac. Chosen placentomes were of a representative size. A cross section of the placentome was subjected to 4% paraformaldehyde fixation for histological processing, while the remainder was snap-frozen for RNA and protein analyses. Necropsies were performed on Day 135 of gestation with blood samples from the fetal heart collected and processed as above. Placentomes were dissected, weighed, and processed as on Day 70.

Fetuses from ewes fed 100% NRC formed the control group (n=8; n=3 female). Fetuses within the NR group (n=28; n=15 female) were segregated into quartiles based on fetal weight distribution. The highest (NR NonSGA; n=7; n=4 females) and lowest (NR SGA; n=7; n=2 female) quartiles were selected for further investigation [24–26].

2.3. Plasma concentrations of triiodothyronine (T3) and thyroxine (T4)

Total T3 in plasma was measured using a human T3 ELISA (Cat#IB19107; IBL America, Minneapolis, MN, USA) according to manufacturer’s instructions (lower detectable limit=0.05μg/dl). Total T4 in plasma was measured using a human T4 ELISA (Cat#IB19108; IBL America) according to manufacturer’s instructions (lower detectable limit=2.0μg/dl). Both assays were validated for linearity using sheep plasma prior to use.

2.4. RNA extraction and cDNA synthesis

Total RNA was extracted from snap-frozen placentomes using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s recommendations. After DNase I treatment (Qiagen, Hilden, Germany), RNA was quantified and quality assessed using a Nanodrop and an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), respectively. Extracted RNA was stored at −80°C. First-strand cDNA was synthesized from 1 μg of RNA using the Superscript First Strand Synthesis System (Invitrogen) according to manufacturer’s instructions. Negative controls with reverse transcriptase omitted were included to verify a lack of genomic contamination and cDNA was stored at −20°C.

2.5. Quantitative PCR (qPCR) analyses

Primers for qPCR were designed using National Center for Biotechnology Information Genbank ovine sequences and Primer-BLAST (http://www.ncbi.nlm.nih.gov/). Primer information is provided in Table 1.

Table 1.

Primer sequences for qPCR

Gene Symbol Accession Number Primer Sequence (5’−3’) Amplicon Size (bp)
DIO2 XM_027972090.1 Fwd GACCTCAGAAGGAATGCGCT 157
Rev CGCTGTTTTCTCCTGGGCAT
DIO3 NM_001122650.1 Fwd TAGACTTCCTGTGCATCCGC 134
Rev GTTGTCATCGGACACGCAGA
GAPDH NM_001190390.1 Fwd GGGCAGCCCAGAACATCAT 88
Rev CCAGTGAGCTTCCCGTTCAG
SDHA XM_027980212.1 Fwd CATCCACTACATGACGGAGCA 90
Rev ATCTTGCCATCTTCAGTTCTGCTA
SLCO4A1 XM_012109022.2 Fwd GAAGGTGTACCGAGACTGTAGCTG 64
Rev GGTAGCATGGCCAAAACCA
SLC5A5 XM_027969435.1 Fwd TGTTCCTGATCGTGTCCAGC 110
Rev CATGTACTGGTCTGGGGCAG
SLC10A1 XM_027971954.1 Fwd GACGATCCAAACGCACTGTC 102
Rev GTGGTCCGATGACTTCAGGG
SLC16A2 XM_027962830.1 Fwd CCCTGCTCGGCATTTACATTT 65
Rev AAATGCTGTGTGTGCAGGTTTG
SLC16A10 XM_004011485.4 Fwd CGCAGGGTTACTCCATGACA 56
Rev CAGCGAGGTAGAATGCCACA
THRA NM_001100919.3 Fwd ACGGCCAATGTTCCCTGAAA 124
Rev TCGCAAGTGATGCAGCGATA
THRB NM_001190391.1 Fwd TGATGTCTTCAGATCGCCCAG 113
Rev AGTCACGTGGTGTTTTCGGT
YWHAZ NM_001267887.1 Fwd GACTGGGTCTGGCCCTTAAC 72
Rev GAGAGCAGGCTTTCTCAGGG

qPCR assays were performed using SYBR Green PCR Mastermix (Applied Biosystems, Foster City, CA) in 10μl reactions with 0.5 μM of each specific primer, on a 7900HT Real-Time PCR System (Applied Biosystems) with approximately 10 ng of cDNA per reaction. The PCR program began with 5 min at 95°C followed by 40 cycles of 95°C denaturation for 10 sec and 60°C annealing/extension for 30 sec. A dissociation curve was produced to verify a single gene-specific peak. Standard curves with 2-fold serial dilutions (eight point) of pooled cDNA were run to determine primer efficiencies. All primer correlation coefficients were greater than 0.97 and efficiencies were 95%–105%. The geometric mean of the reference genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), succinate dehydrogenase complex flavoprotein A (SDHA), and tyrosine 3,5-monooxygenase activation protein zeta (YWHAZ) was used for normalization and does not vary due to gestational age or treatment. All samples were run in triplicate. The 2−ΔΔCt method was utilized and fold-changes were subjected to statistical analyses.

2.6. Immunohistochemistry

Immunohistochemical localization of THRA in paraffin-embedded sheep placentomes (5μm thick) was performed as previously described [25]. Briefly, rabbit anti-human THRA (10139-1-AP; Proteintech Group Inc., Rosemont, IL, USA) was used at 5.4 μg/ml following boiling citrate antigen retrieval. The negative control was nonimmune rabbit IgG diluted to the same concentration as the primary antibody. Immunoreactive protein was visualized using the Vectastain Elite ABC Kit (PK-6101; Vector Laboratories, Inc., Burlingame, CA) according to the manufacturer’s instructions with 3,3′-diaminobenzidine tetrahydrochloride (D5637; Sigma-Aldrich) as the chromagen. Sections were counterstained with Harris-modified hematoxylin (Fisher Scientific), dehydrated, and coverslips affixed using Permount mounting medium (Fisher Scientific).

2.7. Protein extraction and western blots

Total protein was extracted from placentomes following homogenization in lysis buffer as previously described [25] and protein concentrations determined using a Pierce BCA Protein Assay Kit (Thermo Scientific) according to manufacturer’s instructions. Proteins (30 μg per well) were separated by gel electrophoresis in TGX Stain-free Gels (4–20% gradient; Bio-Rad Laboratories, Inc, Hercules, CA, USA) and gels were activated with 1 min of UV light to allow for later visualization of the total protein on the membrane without interfering with the antibody of interest [30]. Proteins were then transferred and blocked as previously described [25]. Primary antibodies against THRA (0.54 μg/ml), rabbit anti-human THRB (0.91 μg/ml; GTX16393; GeneTex, Irvine, CA, USA), DIO2 (0.40 μg/ml; 26513-1-AP; Proteintech Group, Inc.) and rabbit anti-human DIO3 (2 μg/ml; GTX60156; GeneTex) were incubated with membranes overnight at 4°C. Membranes were probed with goat anti-rabbit IgG-horseradish peroxidase-conjugated antibody (7074S; Cell Signaling Technology, Danvers, MA, USA) diluted 1:20,000. Membranes were exposed to UV light and imaged to determine total protein to be used as the loading control. Antibody-bound proteins were visualized using SuperSignal West Dura Substrate (ThermoFisher) according to manufacturer’s instructions. Imaging and quantification were performed on a ChemiDocXRS (Bio-Rad Laboratories) interfaced with Quantity One software (v 4.6.1; Bio-Rad Laboratories). Background was subtracted from bands and total protein independently, and then band density was divided by total protein density for each sample [25] with the ratio subjected to statistical analysis.

2.8. Imaging

Representative brightfield illumination images of immunohistochemistry were captured using a Nikon Eclipse Ni-E microscope (Nikon Corp, Tokyo, Japan) and a 20x objective, interfaced with a DS-Ri1 camera (Nikon), and NIS-Elements AR software (V 4.30.02; Nikon). Photographic plates were assembled using GNU Image Manipulation Program (GIMP; v2.10.14; www.gimp.org).

2.9. Statistical analyses

Concentrations of hormones, gene expression data, and protein data were subjected to a mixed model ANOVA with ewe considered a random effect using GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA). Main effects (treatment, day) and interactions were included with Tukey’s honestly significant difference test used for multiple comparisons. Fetal sex was not included in the model due to lack of power. Data from western blots were log transformed prior to ANOVA analysis. Significance was set at P≤0.05 with 0.05<P≤0.10 indicating a trend toward significance. All data are presented as means ± SEM.

3. Results

Maternal, placental, and fetal weights, as well as other metabolite abundances for this study have been published elsewhere [24–26]. Of note, fetal weight was lower in the NR SGA (3.8±0.2 kg) compared to 100% NRC (5.6±0.1 kg) and NR NonSGA (5.4±0.2 kg; P<0.001) fetuses [24]. Total placentome weight was lower in NR SGA (307±16 g) ewes compared to 100% NRC (546±43 g) and NR NonSGA (524±36 g; P<0.001) ewes [25]. Additionally, there is a strong correlation between fetal weight and placental weight in the NR cohort (R2=0.514; P<0.001) [25].

3.1. Plasma concentrations of T4 and T3

Maternal plasma concentrations of T4 were lower in NR SGA ewes compared to 100% NRC and NR NonSGA ewes (Figure 1A; P<0.001) and decreased over the duration of gestation, specifically from Day 35 to Day 70 and Day 105 to Day 135 (P<0.001) with no treatment by day interaction (P=0.651). Plasma concentrations of T3 were lower in NR SGA compared to NR NonSGA ewes with 100% NRC ewes at intermediate levels (Figure 1B; P=0.042), but there was only a trend toward significance for an effect of day (P=0.094) and no treatment by day interaction was detected (P=0.770). The ratio of T4:T3 was greater in 100% NRC compared to NR NonSGA ewes with NR SGA ewes having an intermediate ratio (Figure 1C; P=0.035), but there was no effect of day (P=0.301) or treatment by day interaction (P=0.650). Concentrations of T4 in plasma at Day 135 were lower in all fetuses from NR dams compared to those from 100% NRC dams (Figure 2A; P=0.011). There was no treatment effect on concentrations of T3 in fetal plasma (Figure 2B; P=0.948) or the T4:T3 ratio (Figure 2C; P=0.572).

Figure 1.

Figure 1.

Concentrations of thyroxine (T4) and triiodothyronine (T3) in plasma of NR ewes. Concentrations of T4 were less in NR ewes carrying SGA fetuses [A] and decreased as pregnancy progressed, but there was no treatment by day interaction. Concentrations of T3 were greater in plasma of NR ewes carrying NR SGA fetuses compared to those with SGA fetuses [B] with a trend toward decreasing concentrations as pregnancy progressed, but there was no treatment by day interaction. The T4:T3 ratio was greater in 100% NRC fed ewes than in NR ewes carrying NonSGA fetuses [C], while there was no effect of day or treatment by day interaction. Differing letters (a,b) indicate significant treatment differences (P<0.05). Legend: NR, nutrient-restricted; NRC, National Research Council; SGA, small for gestational age.

Figure 2.

Figure 2.

Concentrations of thyroxine (T4) and triiodothyronine (T3) in fetuses from NR ewes. Concentrations of T4 were lower in plasma in all fetuses from NR compared to 100% NRC fed ewes [A]. There was no difference in concentrations of T3 [B] or the T4:T3 ratio in fetal plasma [C]. Differing letters (a,b) indicate significant differences (P<0.05). Legend: NR, nutrient-restricted; NRC, National Research Council; SGA, small for gestational age.

3.2. Placentomal expression of thyroid hormone-related genes

Expression of multiple thyroid hormone-related genes was analyzed in placentomes from Day 70 and Day 135 of pregnancy in the same ewes using the placentomectomy method. A treatment by day interaction showed that expression of THRA mRNA was greater on Day 135 for placentomes from NR SGA ewes than for any other group (Figure 3A; P=0.004). Expression of THRB mRNA was not affected by treatment, day, or interaction (Figure 3B; P>0.100). Expression of DIO2 mRNA was greater at Day 70 than Day 135 (Figure 3C; P<0.001) with no treatment or treatment by day effects (P>0.100). There was a treatment effect on DIO3 mRNA with greater expression in NR SGA placentomes compared to NR NonSGA placentomes with 100% NRC placentomes having intermediate expression (Figure 3D; P=0.013), and a day effect with Day 135 placentomes having higher expression than Day 70 (P<0.001). Expression of thyroid hormone transporters SLC16A2 (Figure 3E), SLC16A10 (Figure 3F), and SLCO4A1 (Figure 3H) was greater on Day 135 than Day 70 (P<0.001), while expression of SLCO1C1 (Figure 3G) mRNA was lower on Day 135 than Day 70 (P<0.001) with no treatment or treatment by day effect (P>0.100) on any of the transporters. There was no effect of treatment, day or treatment by day interaction on expression of the iodide transporter SLC5A5 mRNA (Figure 3I; P>0.100).

Figure 3.

Figure 3.

Placentomal gene expression of thyroid hormone receptors, transporters, and deiodinases. Expression of THRA mRNA [A] was greater in NR SGA placentomes at Day 135 compared to all other treatments and days, while THRB mRNA [B] was not affected by day or treatment. Expression of DIO2 mRNA [C] decreased from Day 70 to Day 135. Expression of DIO3 mRNA [D] increased from Day 70 to Day 135 and was greater in placentomes from NR SGA than NR NonSGA groups. Expression of SLC16A2 [E], SLC16A10 [F], and SLCO4A1 [H] mRNAs increased from Day 70 to Day 135, while SLCO1C1 [G] mRNA decreased. There was no change in expression of SLC5A5 mRNA [I]. Differing letters (a,b) indicate a significant treatment main effect (P<0.05). Legend: NR, nutrient-restricted; NRC, National Research Council; SGA, small for gestational age.

3.3. THRA and THRB proteins in placentomes

The antibody against THRA used in this study reacted with both the THRA1 and THRA2 isoforms, therefore, in western blot analyses both isoforms were identified independently, but this was not possible for immunohistochemistry. There was a treatment by day interaction where THRA1 protein was more abundant in Day 135 NR SGA placentomes than for all Day 70 placentomes (Figure 4A; P=0.041), but there were no differences between any other groups. THRA2 protein was more abundant in Day 135 compared to Day 70 placentomes (Figure 4B; P<0.026), but there was no effect of day or treatment by day interaction (P>0.100). Total THRA protein was greater in placentomes on Day 135 than Day 70 (Figure 4C; P<0.001), but there was only a trend toward an effect of the treatment by day interaction with Day 135 NR SGA placentomes having more THRA protein than Day 70 NR placentomes (Figure 4C; P=0.071). THRB protein was more abundant in placentomes from Day 70 than Day 135 of pregnancy (Figure 4D; P<0.001), but there was no effect of treatment or treatment by day interaction (P>0.100).

Figure 4.

Figure 4.

Abundances of THRA1, THRA2, and THRB proteins in placentomes from NR pregnancies. THRA1 protein [A] increased from Day 70 to Day 135 in NR SGA placentomes, but not in 100% NRC or NR NonSGA placentomes, while THRA2 protein [B] increased from Day 70 to Day 135 independent of treatment. Total THRA protein [C] tended to be greater in placentomes on Day 135 for NR SGA compared to Day 70 NR NonSGA and NR SGA groups. THRB protein [D] decreased from Day 70 to Day 135. Differing letters (a,b) indicate significant treatment by day interactions (P<0.05), while differing letters (y,z) indicate a trend toward significance (0.05<P<0.10) for a treatment by day interaction. Legend: NR, nutrient-restricted; NRC, National Research Council; SGA, small for gestational age.

THRA protein localized to the nuclei and cytoplasm of multinucleated syncytial cells of Day 70 and Day 135 placentomes from all treatment groups (Figure 5). As syncytialization progressed to Day 135, it appeared that some nuclei within the syncytia no longer contained the THRA protein. Further, many of the binucleate cells contained no THRA protein in either the nuclei or cytoplasm. Additionally, THRA protein localized to the nuclei and cytoplasm of the endothelial lining of the cotyledonary blood vessels, and many cells within the stroma of the cotyledonary tissue exhibited nuclear immunostaining for THRA protein at Days 70 and 135 of gestation (Figure 5). Fewer stromal cells of the cotyledonary tissue appear to have THRA protein in the NR SGA placentomes compared to 100% NRC and NR NonSGA placentomes at Day 70. Further, at Day 135, the endothelial cells in the cotyledonary blood vessels of the NR NonSGA placentomes do not contain THRA protein while the NR SGA and 100% NRC placentomes have THRA protein.

Figure 5.

Figure 5.

Immunolocalization of THRA protein in placentomes. THRA protein localized to nuclei and cytoplasm of multinucleated syncytial cells at both Day 70 and 135 as well as stromal and endothelial cells in placentomes. Width of field is 422 μm. Legend: BNC, binucleate cell; BV, blood vessel; Endo, endothelial cells; FS, fetal (cotyledonary) stroma; MS, maternal (caruncular) stroma; NR, nutrient-restricted Syn, syncytial cells.

3.4. Deiodinase proteins in placentomes

The abundances of enzymes that metabolize T4 and T3 were assessed in placentomes. The effect of a treatment by day interaction showed that DIO2 protein was less abundant in Day 70 NR NonSGA and Day 135 100% NRC placentomes compared to Day 135 NR NonSGA placentomes (Figure 6A; P=0.002). DIO3 protein was greater in Day 70 100% NRC placentomes compared to Day 70 NR SGA and Day 135 100% NRC placentomes in a treatment by day interaction (Figure 6B; P=0.013). Additionally, a significant effect of the treatment by day interaction for the DIO2:DIO3 protein ratio showed that in 100% NRC and NR NonSGA placentomes at Day 70 the ratio was less than for Day 135, and less than for Day 70 NR SGA placentomes (Figure 6C; P<0.001).

Figure 6.

Figure 6.

Abundances of deiodinase proteins in NR pregnancies. DIO2 protein [A] increased from Day 70 to Day 135 in NR NonSGA placentomes and was greater in NR NonSGA placentomes at Day 135 than in 100% NRC placentomes. DIO3 protein [B] was greater at Day 70 in 100% NRC placentomes compared to Day 70 NR SGA and Day 135 100% NRC placentomes. The ratio of DIO2:DIO3 proteins [C] increased from Day 70 to Day 135 in 100% NRC and NR NonSGA placentomes and was greater in NR SGA placentomes at Day 70 compared to other days of gestation. Differing letters (a,b) indicate significant treatment by day interactions (P<0.05). Legend: NR, nutrient-restricted; NRC, National Research Council; SGA, small for gestational age.

4. Discussion

Thyroid hormones regulate a number of metabolic and cellular processes in both the mother and fetus during pregnancy, but little is known about the role of the placenta in thyroid hormone homeostasis in nutritionally restricted ewes. Fetuses/lambs from nutrient restricted ewes have a wide variation in body weight, but whether this is due to alterations or adaptations in the mother, placenta, and/or fetus remains to be elucidated. This study determined that NR ewes carrying SGA fetuses had lower concentrations of T4 and T3 compared to NR ewes carrying NonSGA fetuses, but all fetuses from NR ewes had lower concentrations of T4 in plasma than fetuses from 100% NRC-fed ewes. Additionally, THRA1 mRNA and protein were greater at Day 135 than Day 70 for NR SGA placentomes, while there was no difference between those two days of gestation for placentomes from NR NonSGA or 100% NRC ewes, indicating activation of a potential compensatory mechanism. In addition, the ratio of DIO2:DIO3 proteins in placentomes increased in NR SGA pregnancies at Day 70 compared to NR NonSGA and 100% NRC pregnancies suggesting greater activation of thyroid hormone function.

Concentrations of T4 and T3 in maternal plasma increase during the first few weeks of pregnancy and then, as seen in this study, slowly decline over the remainder of pregnancy. Previous reports indicated reduced concentrations of T4 and T3 in plasma of nutrient restricted ewes from Days 30–60 and Days 50–130 when all NR ewes were considered as one cohort [6,31]. When ewes carrying NonSGA or SGA fetuses were assessed separately in this study, concentrations of T4 and T3 in plasma of ewes with NonSGA fetuses were greater than for ewes with SGA fetuses. This suggests that some ewes may have innately higher circulating concentrations of thyroid hormones and/or are better able to maintain thyroid hormone levels during a nutritionally limited pregnancy, making them better suited to support normal fetal growth under nutritional duress. In humans, chorionic gonadotropin (hCG) produced by the placenta is responsible for increasing T3 and T4 during pregnancy as hCG can activate the thyroid-stimulating hormone receptor (TSHR) on thyroid follicular cells [32]. Whether there is a similar mechanism in sheep, whereby the placenta regulates maternal thyroid hormone levels, is unknown. It also remains to be determined if there is a unique ability of the ewe, independent of the placenta, to maintain thyroid hormone levels when subjected to nutrient restriction. Interestingly, while concentrations of T4 and T3 were not different between 100% NRC and NR NonSGA ewes in this study, the ratio of T4:T3 was lower in NR NonSGA ewes, suggesting a greater availability of the bioactive T3 in those ewes.

At Day 135 of pregnancy, all fetuses from NR dams had decreased concentrations of T4 regardless of the NR dam’s ability to maintain T4 levels comparable to a well-fed ewe when she carried a larger fetus. But that is not surprising since the majority of T4 in the fetal circulation at Day 135 of gestation is likely produced endogenously by the fetal thyroid. At Day 135 of gestation, this may not be especially detrimental as concentrations of T3 in fetal plasma were not different between groups, but from this time point until parturition, T3 levels increase significantly due to conversion of T4 to T3 by DIO1 in the fetal liver [33,34]. If T4 is deficient, essential functions regulated by T3 at birth and in early neonatal life, including fetal maturation regulated through the hypothalamic-pituitary-adrenal (HPA) axis, thermoregulation, and regulation of glucose metabolism may be compromised [35]. Indeed, the SGA fetuses from NR ewes in this study had lower plasma insulin concentrations than those from well-fed ewes, with NonSGA fetuses having intermediate levels [26], indicating that glucose metabolism is already altered in those fetuses by Day 135 of pregnancy, potentially due to decreased thyroid hormone levels and their action on the pancreas. Additionally, tissue-specific regulation of deiodinases, such as was seen in the placenta, may be modulating local T3 levels and causing individual organ- or cell-specific effects.

From early in pregnancy, T3 acts through a receptor to stimulate production of estradiol, hCG, and placental lactogen (CSH1), all of which have roles in successful maternal adaptation to pregnancy, as well as development of placental trophoblast and vasculature [36]. Interestingly, knockdown of CSH1 mRNA in embryos results in a similar phenomenon to our nutrient restriction model in that both normal and SGA fetuses are produced [37,38]. Additionally, the placentae/fetuses in CSH1 mRNA knockdowns have perturbations in glucose metabolism and blood flow regardless of fetal weight [37,39]. Thus, there is a potential role of CSH1 in thyroid function in the sheep, similar to the role played by hCG in humans. In human placentae, THRA1 and THRA2 localize to nuclei of syncytiotrophoblasts, cytotrophoblasts, and stromal cells in placentomes with a higher proportion of positively-stained nuclei in placentae from term IUGR pregnancies compared to normal pregnancies [21]. As the syncytial cells and stromal cells in sheep placentomes have nuclear localization of THRA, similar events may be occurring in response to T3 regardless of differences in placental type. While there was no visual difference in the localization of THRA in the placentomes of SGA fetuses, there was an increase in THRA1 protein from Day 70 to Day 135 of gestation that did not occur in 100% NRC or NR ewes with NonSGA fetuses. This, along with the increase in expression of THRA mRNA in the placentomes, suggests an effort by the placentome to compensate for the lower concentrations of T4 and T3 in maternal blood. Conversely, it may suggest a detrimental block to T3-regulated processes, which can occur through formation of apo-receptors that are transcription complexes of thyroid hormone receptors that act independently of a ligand. Active repression of T3-regulated genes by these complexes occurs in the hypothyroid environment of fetal development, but has not been studied in ewes subjected to nutrient restriction [40–42].

THRA2 is a non-hormone binding THRA splice variant that heterodimerizes with other isoforms of THRA and THRB, homodimerizes, or interacts with nuclear corepressors, and binds DNA to repress transcription [40,43]. Thus it is hypothesized to act as a negative regulator of thyroid hormone signaling and, in tissues such as the central nervous system where THRA2 levels are higher than THRA1, essentially make the tissue insensitive to thyroid hormones [44]. This is in contrast to tissues such as the pancreas and liver, which are quite thyroid hormone sensitive and have low levels of THRA2 [44]. The ratio of THRA1 to THRA2 in the sheep placenta falls between these two extremes and is fairly equal, thus THRA2 may have a regulatory role in how certain cell types are responding to thyroid hormones at different time points during pregnancy, independent of the availability of a ligand.

There are several transporters involved in thyroid hormone movement, and since any molecule moving between maternal and fetal circulations in the sheep has to navigate a variety of cell types, multiple transporters may be utilized in the placentome. The transporters considered in this study are those with high affinity for one of the thyroid hormones and/or localized to the placenta in other species [16,17,45]. There was no effect of treatment on the expression of any of the transporter mRNAs studied, but expression of SLC16A2, SLC16A10, and SLCO4A1 mRNA increased from Day 70 to Day 135, while SLCO1C1 mRNA decreased. The transporter SLCO1C1 (also known as OATP1C1) has the highest known affinity for T4 and mediates both uptake and efflux of T4, while SLCO4A1 (also known as OATP4A1) has a high affinity for T3 [45]. As thyroid hormones can act on cells of the placentome or be transported into the fetal circulation, the affinity of transporters for different ligands likely correlates with their localization within individual cells. To our knowledge, this is the first report of thyroid hormone transporters in the sheep placenta. While there is little evidence that maternal thyroid hormones cross the placenta into the fetal circulation, at least in the second half of gestation [10,11], the presence of transporters indicates that multiple cell types within the placentome, including the syncytial and cotyledonary stromal cells where THRA protein is located, can be exposed to and acted on by thyroid hormones.

The type III deiodinase, DIO3, regulates the availability of maternal thyroid hormone, and provides a source of free iodide to the fetus, as it converts T4 to rT3 and T3 to T2 [20]. The type II deiodinase (DIO2), on the other hand, converts T4 to the biologically active T3. While there are previous reports of deiodinase activity in the sheep placenta [46,47], to our knowledge, this is the first report of relative levels of deiodinase mRNAs and proteins in placentomes of sheep in mid- and late-gestation. DIO2 protein increased in placentomes from NR NonSGA pregnancies between Days 70 and 135, but not in the 100% NRC and NR SGA groups. This may represent a mechanism whereby the placentome in NR pregnancies maintains T3 levels and/or signaling within the placentome in late pregnancy. In contrast, placentomes from NR SGA pregnancies had lower abundances of DIO3 protein at mid-gestation compared to controls. This differential expression of DIO2 and DIO3 in SGA placentomes at mid-gestation increased the DIO2:DIO3 protein ratio compared to that for placentomes in both the 100% NRC and NR NonSGA groups at Day 70. This may be a beneficial adaptation to maintain higher levels of the more bioactive T3, or a detrimental misregulation, since DIO3 protein levels and the DIO2:DIO3 ratio in NR SGA placentomes at Day 70 are the same as those from the 100% NRC group at Day 135.

5. Conclusions

Results of the present study identified differences in thyroid hormone dynamics in maternal and fetal blood as well as placentomes from NR ewes having either NonSGA or SGA fetuses. During mid-pregnancy, decreases in transfer of T4 and T3 from the maternal circulation in NR SGA pregnancies corresponded to changes in expression of genes and proteins for key thyroid hormone receptors and deiodinases, but not selected transporters in placentomes. In addition, results of this study highlight a potentially significant role for DIO3 in the placentome during mid-pregnancy as it is differentially expressed in NR SGA pregnancies. Collectively, results identified factors potentially associated with placental adaptations to nutritional deficiencies, as well as factors that may be detrimental to maximizing in utero growth potential of fetal lambs.

Highlights:

  • Maternal nutrient restriction (NR) increases variation in fetal weights

  • Thyroid hormone levels are lower in dams with small for gestational age fetuses

  • Thyroxine levels are lower in all nutrient restricted fetuses compared to well-fed

  • Placentomal THRA protein abundances are altered in small for gestational age fetuses

  • The DIO2:DIO3 protein ratio in placentomes is greater in SGA fetuses at Day 70 of gestation

Funding

This work was supported by the Eunice Kennedy Shriver National Institute of Child Health and Human Development grant no. 1R01HD080658-01A1 (M.C.S.) from the National Institutes of Health. The funding body had no involvement in study design, analysis and interpretation of the data, writing of the manuscript, or the decision to submit the manuscript for publication.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of Competing Interest

None.

References

  • [1].Dunlap K, Brown J, Keith A, Satterfield M. Factors controlling nutrient availability to the developing fetus in ruminants. J Animal Sci Biotechnol 2015;6:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].DelCurto H, Wu G, Satterfield MC. Nutrition and reproduction: Links to epigenetics and metabolic syndrome in offspring. Curr Opin Clin Nutr Metab Care 2013;16:385–391. [DOI] [PubMed] [Google Scholar]
  • [3].Wu G, Bazer FW, Wallace JM, Spencer TE. Board-invited review: Intrauterine growth retardation: Implications for the animal sciences. J Anim Sci 2006;84:2316–2337. [DOI] [PubMed] [Google Scholar]
  • [4].Balasuriya CND, Stunes AK, Mosti MP, Schei B, Indredavik MS, Hals IK, Evensen KAI, Syversen U. Metabolic outcomes in adults born preterm with very low birthweight or small for gestational age at term: A cohort study. J Clin Endocrinol Metab 2018;103:4437–4446. [DOI] [PubMed] [Google Scholar]
  • [5].Ananth CV, Vintzileos AM. Distinguishing pathological from constitutional small for gestational age births in population-based studies. Early Hum Dev 2009;85:653–658. [DOI] [PubMed] [Google Scholar]
  • [6].Clarke L, Heasman L, Juniper DT, Symonds ME. Maternal nutrition in early-mid gestation and placental size in sheep. Br J Nutr 1998;79:359–364. [DOI] [PubMed] [Google Scholar]
  • [7].Medici M, Timmermans S, Visser W, de Muinck Keizer-Schrama SM, Jaddoe VW, Hofman A, Hooijkaas H, de Rijke YB, Tiemeier H, Bongers-Schokking JJ, Visser TJ, Peeters RP, Steegers EA. Maternal thyroid hormone parameters during early pregnancy and birth weight: The generation r study. J Clin Endocrinol Metab 2013;98:59–66. [DOI] [PubMed] [Google Scholar]
  • [8].Wrutniak-Cabello C, Casas F, Cabello G. Thyroid hormone action in mitochondria. J Mol Endocrinol 2001;26:67–77. [DOI] [PubMed] [Google Scholar]
  • [9].Forhead AJ, Fowden AL. Thyroid hormones in fetal growth and prepartum maturation. J Endocrinol 2014;221:R87–R103. [DOI] [PubMed] [Google Scholar]
  • [10].Dussault JH, Hobel CJ, DiStefano JJ, Erenberg A, Fisher DA. Triiodothyronine turnover in maternal and fetal sheep. Endocrinology 1972;90:1301–1308. [DOI] [PubMed] [Google Scholar]
  • [11].Hopkins PS, Thorburn GD. Placental permeability to maternal thyroxine in the sheep. J Endocrinol 1971;49:549–550. [DOI] [PubMed] [Google Scholar]
  • [12].Lanham SA, Fowden AL, Roberts C, Cooper C, Oreffo RO, Forhead AJ. Effects of hypothyroidism on the structure and mechanical properties of bone in the ovine fetus. J Endocrinol 2011;210:189–198. [DOI] [PubMed] [Google Scholar]
  • [13].Segar JL, Volk KA, Lipman MH, Scholz TD. Thyroid hormone is required for growth adaptation to pressure load in the ovine fetal heart. Exp Physiol 2013;98:722–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Chen K, Carey LC, Valego NK, Liu J, Rose JC. Thyroid hormone modulates renin and ang ii receptor expression in fetal sheep. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 2005;289:R1006–R1014. [DOI] [PubMed] [Google Scholar]
  • [15].Forhead AJ, Li J, Saunders JC, Dauncey MJ, Gilmour RS, Fowden AL. Control of ovine hepatic growth hormone receptor and insulin-like growth factor i by thyroid hormones in utero. Am J Physiol Endocrinol Metab 2000;278:E1166–1174. [DOI] [PubMed] [Google Scholar]
  • [16].Groeneweg S, van Geest FS, Peeters RP, Heuer H, Visser WE. Thyroid hormone transporters. Endocr Rev 2019;41:146–201. [DOI] [PubMed] [Google Scholar]
  • [17].Sun YN, Liu YJ, Zhang L, Ye Y, Lin LX, Li YM, Yan YQ, Chen ZP. Expression of organic anion transporting polypeptide 1c1 and monocarboxylate transporter 8 in the rat placental barrier and the compensatory response to thyroid dysfunction. PloS one 2014;9:e96047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Loubière LS, Vasilopoulou E, Bulmer JN, Taylor PM, Stieger B, Verrey F, McCabe CJ, Franklyn JA, Kilby MD, Chan SY. Expression of thyroid hormone transporters in the human placenta and changes associated with intrauterine growth restriction. Placenta 2010;31:295–304. [DOI] [PubMed] [Google Scholar]
  • [19].Patel J, Landers K, Li H, Mortimer RH, Richard K. Delivery of maternal thyroid hormones to the fetus. Trends Endocrinol Metab 2011;22:164–170. [DOI] [PubMed] [Google Scholar]
  • [20].Mortimer RH, Galligan JP, Cannell GR, Addison RS, Roberts MS. Maternal to fetal thyroxine transmission in the human term placenta is limited by inner ring deiodination. J Clin Endocrinol Metab 1996;81:2247–2249. [DOI] [PubMed] [Google Scholar]
  • [21].Kilby MD, Verhaeg J, Gittoes N, Somerset DA, Clark PM, Franklyn JA. Circulating thyroid hormone concentrations and placental thyroid hormone receptor expression in normal human pregnancy and pregnancy complicated by intrauterine growth restriction (iugr). J Clin Endocrinol Metab 1998;83:2964–2971. [DOI] [PubMed] [Google Scholar]
  • [22].Knabl J, de Maiziere L, Hüttenbrenner R, Hutter S, Jückstock J, Mahner S, Kainer F, Desoye G, Jeschke U. Cell type- and sex-specific dysregulation of thyroid hormone receptors in placentas in gestational diabetes mellitus. Int J Mol Sci 2020;21:4056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Edwards AK, McKnight SM, Askelson K, McKnight JR, Dunlap KA, Satterfield MC. Adaptive responses to maternal nutrient restriction alter placental transport in ewes. Placenta 2020;96:1–9. [DOI] [PubMed] [Google Scholar]
  • [24].Sandoval C, Lambo CA, Beason K, Dunlap KA, Satterfield MC. Effect of maternal nutrient restriction on skeletal muscle mass and associated molecular pathways in sga and non-sga sheep fetuses. Domest Anim Endocrinol 2020;72:106443. [DOI] [PubMed] [Google Scholar]
  • [25].Steinhauser CB, Askelson K, Lambo CA, Hobbs KC, Bazer FW, Satterfield MC. Lipid metabolism is altered in maternal, placental, and fetal tissues of ewes with small for gestational age fetuses. Biol Reprod 2020;104:170–180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Sandoval C, Askelson K, Lambo CA, Dunlap KA, Satterfield MC. Effect of maternal nutrient restriction on expression of glucose transporters (slc2a4 and slc2a1) and insulin signaling in skeletal muscle of sga and non-sga sheep fetuses. Domest Anim Endocrinol 2021;74:106556. [DOI] [PubMed] [Google Scholar]
  • [27].NRC NRC. Nutrient requirements for sheep. Natl Acad Press, 1985. [Google Scholar]
  • [28].Lassala A, Bazer FW, Cudd TA, Datta S, Keisler DH, Satterfield MC, Spencer TE, Wu G. Parenteral administration of l-arginine prevents fetal growth restriction in undernourished ewes. J Nutr 2010;140:1242–1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Lambo CA, Edwards AK, Bazer FW, Dunlap K, Satterfield MC. Development of a surgical procedure for removal of a placentome from a pregnant ewe during gestation. J Anim Sci Biotechnol 2020;11:48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Gilda JE, Gomes AV. Western blotting using in-gel protein labeling as a normalization control: Stain-free technology. Methods Mol Biol 2015;1295:381–391. [DOI] [PubMed] [Google Scholar]
  • [31].Lekatz LA, Caton JS, Taylor JB, Reynolds LP, Redmer DA, Vonnahme KA. Maternal selenium supplementation and timing of nutrient restriction in pregnant sheep: Effects on maternal endocrine status and placental characteristics1. J Anim Sci 2010;88:955–971. [DOI] [PubMed] [Google Scholar]
  • [32].Glinoer D, De Nayer P, Bourdoux P, Lemone M, Robyn C, Van Steirteghem A, Kinthaert J, Lejeune B. Regulation of maternal thyroid during pregnancy*. J Clin Endocrinol Metab 1990;71:276–287. [DOI] [PubMed] [Google Scholar]
  • [33].Polk DH, Wu SY, Wright C, Reviczky AL, Fisher DA. Ontogeny of thyroid hormone effect on tissue 5’-monodeiodinase activity in fetal sheep. Am J Physiol 1988;254:E337–341. [DOI] [PubMed] [Google Scholar]
  • [34].Klein AH, Oddie TH, Fisher DA. Effect of parturition on serum iodothyronine concentrations in fetal sheep. Endocrinology 1978;103:1453–1457. [DOI] [PubMed] [Google Scholar]
  • [35].Camm EJ, Inzani I, De Blasio MJ, Davies KL, Lloyd IR, Wooding FP, Blache D, Fowden AL, Forhead AJ. Thyroid hormone deficiency suppresses fetal pituitary-adrenal function near term: Implications for the control of fetal maturation and parturition. Thyroid 2020. [DOI] [PubMed] [Google Scholar]
  • [36].Maruo T, Matsuo H, Mochizuki M. Thyroid hormone as a biological amplifier of differentiated trophoblast function in early pregnancy. Acta Endocrinol (Copenh) 1991;125:58–66. [DOI] [PubMed] [Google Scholar]
  • [37].Tanner AR, Lynch CS, Ali A, Winger QA, Rozance PJ, Anthony RV. Impact of chorionic somatomammotropin rna interference on uterine blood flow and placental glucose uptake in the absence of intrauterine growth restriction. Am J Physiol Regul Integr Comp Physiol 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Jeckel KM, Boyarko AC, Bouma GJ, Winger QA, Anthony RV. Chorionic somatomammotropin impacts early fetal growth and placental gene expression. J Endocrinol 2018;237:301–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Ali A, Swanepoel CM, Winger QA, Rozance PJ, Anthony RV. Chorionic somatomammotropin rna interference alters fetal liver glucose utilization. J Endocrinol 2020;247:251–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Samarut J, Plateroti M. Thyroid hormone receptors: Several players for one hormone and multiple functions. In: Thyroid hormone nuclear receptor: Methods and protocols, Plateroti M, Samarut J (Eds.), Springer; New York, 2018, pp 1–8. [DOI] [PubMed] [Google Scholar]
  • [41].Flamant Fdr, Poguet A-L, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A, Samarut J. Congenital hypothyroid pax8−/− mutant mice can be rescued by inactivating the trα gene. Mol Endocrinol 2002;16:24–32. [DOI] [PubMed] [Google Scholar]
  • [42].Mai W, Janier MF, Allioli N, Quignodon L, Chuzel T, Flamant F, Samarut J. Thyroid hormone receptor alpha is a molecular switch of cardiac function between fetal and postnatal life. Proc Natl Acad Sci USA 2004;101:10332–10337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Burgos-Trinidad Ma, Koenig RJ. Dominant negative activity of thyroid hormone receptor variant α2 and interaction with nuclear corepressors. Molecular and cellular endocrinology 1999;149:107–114. [DOI] [PubMed] [Google Scholar]
  • [44].Minakhina S, Bansal S, Zhang A, Brotherton M, Janodia R, De Oliveira V, Tadepalli S, Wondisford FE. A direct comparison of thyroid hormone receptor protein levels in mice provides unexpected insights into thyroid hormone action. Thyroid 2020;30:1193–1204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Hagenbuch B. Cellular entry of thyroid hormones by organic anion transporting polypeptides. Best Pract Res Clin Endocrinol Metab 2007;21:209–221. [DOI] [PubMed] [Google Scholar]
  • [46].Forhead AJ, Jellyman JK, Gardner DS, Giussani DA, Kaptein E, Visser TJ, Fowden AL. Differential effects of maternal dexamethasone treatment on circulating thyroid hormone concentrations and tissue deiodinase activity in the pregnant ewe and fetus. Endocrinology 2007;148:800–805. [DOI] [PubMed] [Google Scholar]
  • [47].Forhead AJ, Curtis K, Kaptein E, Visser TJ, Fowden AL. Developmental control of iodothyronine deiodinases by cortisol in the ovine fetus and placenta near term. Endocrinology 2006;147:5988–5994. [DOI] [PubMed] [Google Scholar]

RESOURCES