Skip to main content
NCBI home page
Animal Nutrition logoLink to Animal Nutrition
. 2021 May 13;7(3):779–786. doi: 10.1016/j.aninu.2021.03.002

Adding polyethylene glycol to steer ration containing sorghum tannins increases crude protein digestibility and shifts nitrogen excretion from feces to urine

Biao Xie a, Xiao Yang a, Ling Yang b, Xianjiang Wen b, Guangyong Zhao a,∗
PMCID: PMC8384769  PMID: 34466682

Abstract

The objectives of the experiment were to study the effects of adding polyethylene glycol (PEG) to steer ration containing high sorghum tannins on rumen fermentation, nutrient digestion, nitrogen (N) balance and plasma biochemical parameters. Eight growing steers at 16 months of age were allotted to a replicated 4 × 4 Latin square design with 4 treatments and 4 periods (19 d each). Polyethylene glycol at 0, 1.75, 3.50 and 7.00 g/kg dry matter (DM) were added to a basal ration containing 27.82% DM of sorghum grain (total tannins 3.3 g/kg DM) as the treatments. The results indicated that adding PEG quadratically increased the ruminal pH (P = 0.049), tended to linearly increase the ruminal concentration of total volatile fatty acids (P = 0.070), increased the molar proportion of acetate (P = 0.016), linearly decreased the molar proportion of butyrate (P = 0.015), and tended to increase the molar proportion of iso-valerate (P = 0.061) and the ruminal concentration of ammonia N (P = 0.092). Adding PEG tended to quadratically decrease the relative abundance of methanogenic archaea (P = 0.082), linearly decreased the relative abundance of Fibrobacter succinogenes (P = 0.008) and decreased the relative abundance of Butyrivibrio fibrisolvens (P = 0.048) at 7.00 g/kg DM. Dietary addition with PEG increased the crude protein (CP) digestibility (P < 0.001) and tended to increase the neutral detergent fiber digestibility (P = 0.066) in a linear manner. Adding PEG to basal ration also increased the plasma globulin concentration (P = 0.029) and tended to linearly increase the plasma total protein concentration (P = 0.069). Adding PEG linearly decreased the fecal N excretion (P < 0.001) and the fecal N-to-total N excretion ratio (P = 0.004) and increased the urinary N-to-total N excretion ratio (P = 0.004) and urinary urea excretion (P = 0.010) without affecting the urinary N and total N excretions (P > 0.05). It was concluded that adding PEG effectively improved the CP digestibility of the ration containing high sorghum tannins but increased the urinary urea excretion without improving the N retention and N retention rate in steers.

Keywords: Sorghum tannin, Polyethylene glycol, Cattle, Rumen fermentation, Nutrient digestibility, Nitrogen retention

1. Introduction

Sorghum (Sorghum bicolor L. Moench) is the fifth most important cereal crop in the world after wheat, rice, maize and barley and has been widely grown in semi-arid and tropical regions of Africa and Asia because of its advantages in tolerating drought, flood and salt (Olukoya et al., 2015). Sorghum grain has been widely used as the feed for animals (Wang et al., 2019) and the food for humans (Irondi et al., 2019). The crude protein (CP) content of sorghum grain is 71 to 118 g/kg dry matter (DM) which is close to corn, and the content of essential amino acids is higher than that of corn (Pan et al., 2017). Replacing 25% to 100% of corn in lamb ration by sorghum grain improved meat quality but it did not affect daily liveweight gain (Zhong et al., 2016). However, the feeding value of sorghum grain for livestock is generally 85% to 95% of corn (Waniska et al., 2016) because of its high content of condensed tannins (CT) (Nyachoti et al., 1997) which was usually more than 10 g/kg DM (Dykes and Rooney, 2006). Many studies have shown that tannins can bind with feed protein to form tannin-protein complexes in rumen to prevent microbial degradation of protein and increase undegradable protein supply to the hindgut (Getachew et al., 2008; Min et al., 2002). However, some studies also indicated that dietary CT decreased CP digestibility in beef cattle (Stewart et al., 2019). The reason for the results could be that tannin-protein complexes were not fully decomposed in the lower digestive tract, resulting in low CP digestibility.

Polyethylene glycol (PEG) is an inert and synthetic polymer with a high molecular weight which is poorly digested and absorbed in the intestine of animals (Grosell and Genz, 2006). Polyethylene glycol has been widely used as a raw material in food and medicine industries (He et al., 2019; Knop et al., 2010). Because of its high affinity with tannins, PEG can bind with tannins to form tannin-PEG complex (Makkar et al., 1995). Therefore, adding PEG to rations containing high tannins improved feed intake and CP digestibility in sheep (Peng et al., 2016).

Many studies have shown that dietary inclusion of tannins shifts nitrogen (N) excretion from urine to feces in cattle without affecting total N excretion. It is unclear whether adding PEG to ration containing sorghum tannins would improve N retention and N retention rate (NRR) in cattle. The objectives of the experiment were to investigate effects of dietary PEG addition on rumen fermentation, nutrient digestibility, N balance and plasma biochemical parameters in steers fed a ration containing high sorghum tannins.

2. Materials and methods

2.1. Animals, experimental design and the basal ration

The experiment was carried out between April, 2019 and June, 2019 on a commercial beef cattle farm (N 37°53′; E 117°45′) in Shandong province, China. Eight castrated Simmental steers at 16 months of age with an initial liveweight of 357.4 ± 15.6 kg were used. The animals were assigned to a replicated 4 × 4 Latin square design. Four levels of PEG (molecular weight 4,000 kDa, purity ≥ 99.9%, Sinopharm Chemical Reagent Co., Ltd., Shanghai, China), i.e., 0, 1.75, 3.50 or 7.00 g/kg DM, were added to a basal ration containing high sorghum tannins (Table 1) as experimental treatments. The ration was formulated according to the Nutrient Requirements and Feeding Standards of Beef Cattle (Feng, 2000). Each experimental period lasted 19 d. The first 14 d were for adaptation and the last 5 d for sampling.

Table 1.

Ingredients and chemical composition of the basal ration (g/kg, DM basis).

Item Content
Ingredients
 Corn silage 483.6
 Sorghum grain 278.2
 Wheat bran 5.8
 Corn grain 15.1
 Soybean meal 186.7
 Sodium bicarbonate 10.2
 Sodium chloride 10.2
 Calcium carbonate 10.2
Chemical composition
 CP 143.1
 OM 932.4
 NDF 384.8
 ADF 214.6
 Tannins 3.3
 NEmf1, MJ/kg 5.9
Open in a new tab

DM = dry matter; CP = crude protein; OM = organic matter; NDF = neutral detergent fiber; ADF = acid detergent fiber.

1

NEmf refers to the net energy for maintenance and fattening of beef cattle, calculated based on gross energy, OM, and NDF according to the Nutrient Requirements and Feeding Standards of Beef Cattle (Feng, 2000).

Each animal was supplied with 5.70 kg DM of total mixed ration (TMR) (Table 1) which was about 90% of ad libitum feed intake. The designed amount of PEG was completely mixed with the TMR before feeding. The daily allowance of TMR was divided into 2 equal meals which were provided to each steer at 07:00 and 17:00, respectively. No feed residuals were left during the experiment. The cattle were housed indoors in individual tie stalls (1.5 m × 2.5 m) and had free access to fresh drinking water.

2.2. Sampling

The liveweight of each steer was recorded before feeding in the morning on the first day and the last day of each experimental period. During each sampling period, the feces and urine were totally collected daily at 07:00. The feces were collected using plastic buckets, and the urine was collected using a rubber funnel connected by a polyvinyl chloride pipe to a plastic bucket surrounded with ice packs to keep low temperature. The daily output of feces from each steer was recorded and 2% of the total feces was sampled and a volume of 20 mL of H2SO4 (10%, vol/vol) was added to keep pH < 3.0 for preserving N. The daily output of urine from each animal was measured using a volumetric cylinder and 2% of the total urine was sampled and H2SO4 (10%, vol/vol) was added to keep pH < 3.0 for preserving N. The feeds were also sampled during each experimental period. On the second day of each sampling period, 2 h after morning feeding, 10 mL of blood was taken through the jugular vein of each steer using an evacuated K2EDTA tube (Greiner Bio-one, Frickenhausen, Germany). The blood samples were centrifuged at 2,000 × g for 15 min at 4 °C to obtain plasma samples. On the third day of each sampling period, rumen fluid was taken using an esophageal stomach tube 2 h after feeding in the morning (Brito et al., 2014). The first tube of rumen fluid was discarded to avoid saliva contamination. Then, a volume of 100 mL of rumen fluid was taken and filtered through 4 layers of cheesecloth. The pH of rumen fluid was immediately measured using a portable pH meter (pH-HJ90; Aerospace Computer Company, Beijing, China). All samples were kept in a freezer at −20 °C for subsequent analysis.

2.3. Chemical analysis

The samples of corn silage and feces were lyophilized for 72 h using a freeze dryer (LGJ-12; Beijing Songyuan Huaxing Technology Development Co., Ltd, Beijing, China). The fecal samples were ground in a mortar and the feed samples were ground using a grinder (FW177, Tianjin Taisite Instrument Co., Ltd., Tianjin, China) through a sieve with pore size of 1 mm. The DM and ash contents of feeds and feces were determined according to AOAC (2005) using methods No. 930.15 and 942.05, respectively. The organic matter (OM) content was calculated by DM content minus ash content. The acid detergent fiber (ADF) and neutral detergent fiber (NDF) contents were analyzed on a fiber analyzer (A200i, ANKOM Technology Co., New York, USA) using the methods of Van Soest et al. (1991) with sodium sulfite and heat-stable α-amylase for analyzing NDF. The N contents of feeds and feces were analyzed using the Kjeldahl method of AOAC (2005) No. 981.13 and the CP content was calculated as N × 6.25. The N concentration of urine was analyzed using the Kjeldahl method of AOAC (2005) No.973.48. The gross energy (GE) of feed samples was determined by complete combustion on a calorimeter (Parr 6300, Parr Instrument Company, Moline, IL, USA). The tannins of sorghum grain were analyzed according to the procedures described by Price et al. (1978).

The volatile fatty acids (VFA) of rumen fluid were determined by gas chromatography (TP-2060F; Beijing Beifen Tianpu Instrument Technology Co. Ltd, Beijing, China) equipped with a flame ionization detector (FID) and a glass column filled with PEG 20 M + H3PO4. The ammonia N (NH3–N) of rumen fluid was determined on a UV–Vis spectrophotometer (UV-1801; Beijing Beifen Ruili Analytical Instrument Co. Ltd, Beijing, China) using the colorimetric method described by Broderick and Kang (1980). The ruminal microbial crude protein (MCP) was determined using the method of Makkar et al. (1982). The genomic DNA of ruminal microorganisms was extracted by the QIAamp DNA Stool Mini Kit (No.51604; Hilden, Germany) according to the manufacturer's instructions except that the samples were incubated at 95 °C for 5 min to ensure the lysis of microbial cells. The final elution volume was 100 μL. The concentration and the purity of DNA were detected using a spectrophotometry (Nanodrop ND-1000; Thermo Scientific, Wilmington, DE, USA).

The two-step real-time PCR was performed using an FTC-3000 Real-time PCR system (Funglyn Biotech, Toronto, Canada) with fluorescence detection of SYBR green dye for initial denaturation at 95 °C for 30 s, followed by 45 cycles of 5 s at 95 °C and 30 s at 60 °C. The total volume of PCR mixture was 25 μL consisting of 12.5-μL SYBR Premix Ex Taq (No. RR420A; Takara, Dalian, China), 0.5-μL forward primer (10.0 μmol/L; Sangon, Shanghai, China), 0.5-μL reverse primer (10.0 μmol/L; Sangon, Shanghai, China), 2.0 μL of DNA template and 9.5 μL of sterile distilled water. The specific real-time PCR primers are listed in Table 2. After the PCR reaction, the dissociation curve analysis was performed to reveal the purity of the amplicon produced.

Table 2.

Real-time PCR primers used in the quantification of rumen micro-organisms.

Target microflora Primer sequences (5′ to 3′) References
Total bacteria F: CGGCAACGAGCGCAACCC Denman and McSweeney (2006)
R: CCATTGTAGCACGTGTGTAGCC
Protozoa F: GCTTTCGWTGGTAGTGTATT Sylvester et al. (2004)
R: CTTGCCCTCYAATCGTWCT
Methanogenic archaea F: TTCGGTGGATCDCARAGRGC Denman et al. (2007)
R: GBARGTCGWAWCCGTAGAATCC
Fungi F: AGGAAGTAAAAGTCGTAACAAGGTTTC Denman and McSweeney (2006)
R: CAAATTCACAAAGGGTAGGATGATT
Ruminococcus albus F: CCCTAAAAGCAGTCTTAGTTCG Stevenson and Weimer (2009)
R: CCTCCTTGCGGTTAGAACA
Ruminococcus flavefaciens F: CGAACGGAGATAATTTGAGTTTACTTAGG Denman and McSweeney (2006)
R: CGGTCTCTGTATGTTATGAGGTATTACC
Fibrobacter succinogenes F: GTTCGGAATTACTGGGCGTAAA Denman and McSweeney (2006)
R: CGCCTGCCCCTGAACTATC
Butyrivibrio fibrisolvens F: ACCGCATAAGCGCACGGA Stevenson and Weimer (2009)
R: CGGGTCCATCTTGTACCGATAAAT
Prevotella F: GGTTCTGAGAGGAAGGTCCCC Stevenson and Weimer (2009)
R: TCCTGCACGCTACTTGGCTG
Open in a new tab

F = forward; R = reverse.

The plasma concentrations of total protein (TP) (the biuret method), albumin (ALB) (the bromocresol green method), urea (the urease-berthelot method), uric acid (the uricase-peroxidase method) and creatinine (Jaffe's method) were analyzed using an automatic biochemical analyzer (BS-420; 615 Shenzhen Mindray Biomedical Electronic Co., Ltd, Shenzhen, China). The plasma concentration of globulin was calculated by ALB subtracted from TP. The plasma concentrations of growth hormone and insulin-like growth factor-1 (IGF-1) were analyzed using enzyme-linked immunosorbent assay (ELISA) kits (BioSino Bio-Technology and Science Inc., Beijing, China) on a microplate reader (DR-200BS, Wuxi Hiwell-Diatek Instruments Co., Ltd, Jiangsu, China). The plasma concentration of total amino acids, allantoin and hippuric acid were analyzed using colorimetric methods on a semi-automatic biochemical analyzer (A6; 621 Beijing Shining Sun Technology Co., Ltd, Beijing, China).

The urinary concentrations of urea and creatinine were analyzed using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) based on the diacetyl monoxime method and the Jaffe's assay using a spectrophotometer (UV-1801; Beijing Beifen Ruili Analytical Instrument Co. Ltd, Beijing, China), respectively. The urinary concentrations of uric acid and allantoin were analyzed using a spectrophotometer (UV-1801; Beijing Beifen Ruili Analytical Instrument Co. Ltd, Beijing, China) according to the methods of Chen and Gomes (1992). The urinary concentration of hippuric acid was analyzed according to China Hygienic Standard (WS/T 52-1996) using a spectrophotometer (UV-1801; Beijing Beifen Ruili Analytical Instrument Co. Ltd, Beijing, China).

2.4. Calculations and statistical analysis

The PCR efficiency (E) for each primer pair was determined from the slope of the external calibration curve using the equation: E = [10 (-1/s) - 1] × 100, where s is the slope of standard curve. The relative abundance of the microbial 16S rDNA gene copy number was expressed relative to the copy number of total rumen bacterial 16S rDNA and calculated as:

Relative abundance = 2-(Ct target-Ct total bacteria) × 100

where Ct is the threshold cycle.

The total urinary excretion of purine derivatives (PD) was calculated and the rumen microbial N supply to steers was predicted using the methods of Chen and Gomes (1992):

PD (mmol/d) = Allantoin (mmol/d) + Uric acid (mmol/d)
Y = 0.85X + 0.385BW0.75

where Y refers to the total urinary PD; X, the absorbed PD excretion; BW0.75, the metabolic body weight of steers (kg); 0.85, the recovery rate of absorbed purines as PD in urine; 0.385, the endogenous excretion of PD (mmol/kg BW0.75 per d).

Microbial N (mg/d) = (X × 70)/(0.116 × 0.83 × 1,000) = 0.727X,

where X refers to the absorbed PD excretion (mmol/d); 70, the N content of purines (mg N/mmol); 0.116, the ratio of purine N to total N in mixed rumen microbes; 0.83, the digestibility of microbial purines.

Statistical analysis was performed using the general linear model procedures of SAS (version 9.4; SAS Inst. Inc., Cary, NC, USA) for a replicated Latin square design using the model:

Yijk = μ + Ti + Pj + Ck + εijk,

where Yijk refers to the dependent variable; μ, overall mean; Ti, PEG effect (i = 1, 2, 3 and 4); Pj, period effect (j = 1, 2, 3 and 4); Ck, steer effect (k = 1, 2, 3, 4, 5, 6, 7 and 8); εijk, residual error. All differences among experimental diets were compared by Duncan's multiple range test. Polynomial contrasts were conducted to determine the linear and quadratic effects of PEG levels. Differences among treatments were considered significant at P < 0.05 and a trend towards significance at 0.05 < P < 0.10.

3. Results

3.1. Rumen fermentation

The results in Table 3 showed that dietary addition with PEG quadratically increased the ruminal pH (P = 0.049), tended to linearly increase the ruminal concentrations of total VFA (P = 0.070) and NH3–N (P = 0.092). Adding PEG up to 7.00 g/kg DM increased the molar proportion of acetate (P = 0.016), linearly decreased the molar proportion of butyrate (P = 0.015), and tended to increase the molar proportion of iso-valerate (P = 0.061) whereas it did not affect the ruminal concentrations of MCP and other VFA (P > 0.05).

Table 3.

Effects of adding polyethylene glycol (PEG) to a steer ration containing high sorghum tannins on rumen fermentation.

Item PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
pH 6.64b 6.80a 6.81a 6.76ab 0.045 0.038 0.114 0.049
NH3–N, mmol/L 9.97 8.48 10.34 11.02 0.721 0.092 0.166 0.178
TVFA, mmol/L 75.18 81.22 87.12 86.26 4.542 0.248 0.070 0.465
VFA, mmol/100 mmol
 Acetate 56.79b 58.59a 59.69a 59.40a 0.666 0.016 0.144 0.436
 Propionate 22.81 23.06 22.79 22.79 0.264 0.890 0.957 0.871
 Butyrate 15.11a 13.46b 12.79b 12.92b 0.529 0.005 0.015 0.164
 Iso-butyrate 2.42 1.46 1.43 1.48 0.333 0.109 0.121 0.215
 Valerate 1.02 1.20 1.03 1.22 0.107 0.333 0.360 0.973
 Iso-valerate 1.85 2.25 2.19 2.20 0.107 0.061 0.989 0.149
Acetate-to-propionate ratio 2.56 2.57 2.67 2.64 0.049 0.378 0.661 0.917
MCP, μg/mL 134.7 133.0 137.6 129.8 3.69 0.517 0.600 0.498
Open in a new tab

SEM = standard error of the mean; NH3–N = ammonia nitrogen; TVFA = total volatile fatty acids; VFA = volatile fatty acids; MCP = microbial crude protein; T = treatment; L = linear; Q = quadratic.

a, b Within a row, means without a common superscript differ significantly (P < 0.05).

3.2. Rumen microflora

Adding PEG to the basal ration did not affect the relative abundances of protozoa and fungi but it quadratically decreased the relative abundance of methanogenic archaea (P = 0.082). Adding PEG also linearly decreased the relative abundance of Fibrobacter succinogenes (P = 0.008) and decreased the relative abundance of Butyrivibrio fibrisolvens at 7.00 g/kg DM (P = 0.048) whereas it did not affect Ruminococcus albus, Ruminococcus flavefaciens and Prevotella (P > 0.05) (Table 4).

Table 4.

Effects of adding polyethylene glycol (PEG) to a steer ration containing high sorghum tannins on the relative abundance of rumen microorganisms (% total bacterial 16S rDNA).

Item PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
Protozoa 6.78 4.39 2.47 3.52 0.023 0.629 0.322 0.511
Methanogenic archaea, × 10−3 7.95 5.70 4.12 6.68 0.001 0.193 0.370 0.082
Fungi, × 10−2 8.64 6.96 5.34 6.65 0.002 0.713 0.417 0.565
R. albus, × 10−2 2.56 2.15 2.91 1.75 0.004 0.319 0.531 0.528
R. flavefaciens, × 10−2 2.70 2.49 3.68 2.98 0.001 0.621 0.565 0.758
F. succinogenes, × 10−1 7.45a 7.98a 3.56b 3.43b 0.104 0.002 0.008 0.802
B. fibrisolvens, × 10−2 6.46a 4.82ab 4.03ab 2.70b 0.104 0.048 0.142 0.865
Prevotella 5.20 5.25 5.08 5.24 3.130 0.977 0.979 0.892
Open in a new tab

SEM = standard error of the mean; T = treatment; L = linear; Q = quadratic.

a, b Within a row, means without a common superscript differ significantly (P < 0.05).

3.3. Nutrient digestibility

The results in Table 5 indicated that adding PEG linearly increased the CP digestibility (P < 0.001) and tended to increase the NDF digestibility (P = 0.066) whereas it did not affect the digestibility of DM, OM or ADF (P > 0.05).

Table 5.

Effects of adding polyethylene glycol (PEG) to a steer ration containing high sorghum tannins on nutrient digestibility (%).

Item PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
DM 67.3 67.7 67.9 68.8 0.48 0.179 0.140 0.735
OM 69.3 69.4 69.8 70.7 0.45 0.111 0.107 0.528
CP 66.2c 68.2b 70.1a 71.1a 0.62 <0.001 <0.001 0.555
NDF 63.5 64.2 64.1 65.8 0.59 0.070 0.066 0.533
ADF 54.0 55.0 55.3 56.5 1.14 0.890 0.191 0.945
Open in a new tab

SEM = standard error of the mean; DM = dry matter; OM = organic matter; CP = crude protein; NDF = neutral detergent fiber; ADF = acid detergent fiber; T = treatment; L = linear; Q = quadratic.

a, b, c Within a row, means without a common superscript differ significantly (P < 0.05).

3.4. N metabolism

Addition with PEG to the basal ration linearly decreased the fecal N excretion (P < 0.001) whereas it did not affect the urinary N and total N excretions (P > 0.05). Adding PEG linearly decreased the fecal N-to-total N excretion ratio (P = 0.004) and the fecal N-to-N intake ratio (P < 0.001), and linearly increased the urinary N-to-total N excretion ratio (P = 0.004) whereas it did not affect the urinary N-to-N intake ratio, N retention, NRR and the average daily gain (ADG) (P > 0.05) (Table 6).

Table 6.

Effects of adding polyethylene glycol (PEG) to steer ration containing high sorghum tannins on N metabolism.

Item PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
N intake, g/d 130.7 130.7 130.7 130.7 – – – –
N excretion, g/d
 Fecal N 44.1a 41.6b 39.1c 37.8c 0.81 <0.001 <0.001 0.555
 Urinary N 63.0 65.4 65.1 66.4 1.25 0.304 0.299 0.805
 Total 107.2 107.0 104.1 104.2 1.21 0.159 0.1682 0.956
Total N excretion, %
 Fecal N 41.2a 40.0b 37.6bc 36.3c 0.78 0.002 0.004 0.677
 Urinary N 58.8c 61.1b 62.4ab 63.7a 0.78 0.002 0.004 0.677
N intake, %
 Fecal N 33.8a 31.8b 29.9c 28.9c 0.62 <0.001 <0.001 0.555
 Urinary N 48.2 50.0 49.8 50.8 0.95 0.304 0.299 0.805
 N retention, g/d 23.5 23.7 26.6 26.5 1.21 0.159 0.168 0.956
 NRR, % 18.0 18.2 20.3 20.3 0.93 0.159 0.168 0.956
ADG, kg/d 0.65 0.65 0.68 0.68 0.454 0.881 0.540 0.945
Open in a new tab

SEM = standard error of the mean; N = nitrogen; NRR = N retention rate; ADG = average daily gain; T = treatment; L = linear; Q = quadratic.

a, b, c Within a row, means without a common superscript differ significantly (P < 0.05).

3.5. Urinary nitrogenous components

Dietary addition with PEG linearly increased the urinary urea excretion (P = 0.010) and the urea-N-to-urinary N ratio (P = 0.028) whereas it did not affect the urinary excretions of uric acid, allantoin, creatinine and hippuric acid, and the ratios of hippuric acid N to urinary N, creatinine N to urinary N, allantoin N to urinary N, uric acid N to urinary N (P > 0.05), the urinary PD excretion and the estimated rumen microbial N (P > 0.05) (Table 7).

Table 7.

Effects of adding polyethylene glycol (PEG) to steer ration containing high sorghum tannins on urinary nitrogenous components.

Item PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
Urea, mmol/d 1,333.7b 1,399.5ab 1,620.4a 1,635.4a 84.35 0.044 0.010 0.783
Urea N:urinary N ratio, % 59.0 60.6 70.1 68.9 3.57 0.073 0.028 0.723
Uric acid, mmol/d 2.5 2.7 2.7 3.3 0.36 0.501 0.407 0.698
Uric acid N:urinary N ratio, % 0.2 0.2 0.2 0.3 0.03 0.664 0.514 0.751
Allantoin, mmol/d 66.3 73.2 65.1 78.5 4.54 0.163 0.249 0.557
Allantoin N/urinary N ratio, % 5.9 6.3 5.7 6.6 0.40 0.343 0.469 0.517
Creatinine, mmol/d 78.5 87.8 77.4 91.3 5.21 0.176 0.242 0.664
Creatinine N/urinary N ratio 5.2 5.7 5.0 5.8 0.35 0.353 0.540 0.684
Hippuric acid, mmol/d 144.3 145.8 147.7 146.7 20.46 0.999 0.927 0.955
Hippuric acid N:urinary N ratio, % 3.2 3.1 3.2 3.1 0.43 0.999 0.969 0.997
PD, mmol/d 68.8 75.9 67.7 81.8 4.70 0.158 0.217 0.531
Estimated rumen microbial N, g/d 29.6 35.7 28.5 36.9 3.68 0.299 0.446 0.786
Open in a new tab

SEM = standard error of the mean; N = nitrogen; PD = purine derivatives; T = treatment; L = linear; Q = quadratic.

a, b Within a row, means without a common superscript differ significantly (P < 0.05).

3.6. Plasma biochemical indices

Adding PEG to the basal ration tended to linearly increase the plasma concentration of TP (P = 0.069), linearly increased the plasma concentration of globulin (P = 0.029), tended to quadratically increase the plasma concentration of allantoin (P = 0.079) whereas it did not affect the plasma concentrations of ALB, urea, total amino acids, growth hormone, IGF-1, uric acid, creatinine and hippuric acid (P > 0.05) (Table 8).

Table 8.

Effects of adding polyethylene glycol (PEG) to a steer ration containing high sorghum tannins on plasma parameters.

Items PEG, g/kg DM
 SEM P-value
0.00 1.75 3.50 7.00 T L Q
Nutrients
 TP, g/L 68.73b 70.29a 70.26a 70.86a 0.539 0.043 0.069 0.530
 ALB, g/L 27.58 27.53 27.73 28.04 0.311 0.659 0.514 0.745
 Globulin, g/L 41.15b 42.76a 42.52a 42.82a 0.243 0.050 0.029 0.169
 Urea, μmol/L 3.96 3.89 3.99 3.79 0.083 0.351 0.487 0.632
 TAA, μmol/L 4.28 4.19 3.96 4.29 0.197 0.620 0.917 0.606
Hormones
 GH, ng/mL 5.21 5.97 6.80 6.82 0.595 0.207 0.148 0.664
 IGF-1, ng/mL 193.10 199.45 188.85 183.95 6.182 0.281 0.436 0.606
Purine derivatives
 Uric acid, mg/L 12.76 14.03 11.79 14.79 1.335 0.418 0.762 0.760
 Allantoin, mmol/L 1.05 0.87 0.87 0.98 0.061 0.096 0.549 0.079
Other metabolites
 Creatinine, μmol/L 137.44 143.36 139.34 140.95 2.836 0.519 0.720 0.593
 Hippuric acid, μmol/L 37.61 35.38 36.54 37.06 1.578 0.763 0.947 0.403
Open in a new tab

SEM = standard error of the mean; TP = total protein; ALB = albumin; TAA = total amino acids; GH = growth hormone; IGF-1 = insulin-like growth factor-1; T = treatment; L = linear; Q = quadratic.

a, b, c Within a row, means without a common superscript differ significantly (P < 0.05).

4. Discussion

Tannins can combine with dietary protein through hydrogen bonds to form protein–tannin complexes which can prevent protein degradation by rumen microorganisms (Patra and Saxena, 2011). Tannins are also able to inhibit dietary protein degradation in rumen by reducing the activity of endogenous enzymes and rumen microorganisms (Alonso-Díaz et al., 2010). Polyethylene glycol that has high affinity for tannins can form PEG-tannin complexes to deactivate tannins. Thus, PEG can improve the ruminal CP degradation (Mkhize et al., 2018) and the CP digestibility (Alipanahi et al., 2019) of rations containing tannins.

In the present experiment, dietary addition with PEG tended to increase ruminal concentration of NH3–N and increased CP digestibility, suggesting that PEG inhibited the condensed tannins (CT) activity in rumen. Similar results were also reported by Alipanahi et al. (2019) that adding PEG improved CP digestibility in goats fed with an oak acorn ration containing hydrolysable tannins and by Huang et al. (2015) that adding PEG increased CP digestibility in lambs fed with purple prairie clover containing CT. The increased plasma concentration of TP and globulin in the present experiment could be attributed to the increased CP digestibility.

Tannins can inhibit the activities of ruminal bacteria and anaerobic fungi (Alonso-Díaz et al., 2010) and bind to fiber (Makkar et al., 1995). Thus intake of plants containing CT reduced the ruminal digestibility of fiber (Hassan et al., 2020). In the present experiment, dietary addition with PEG increased the ruminal concentration of acetate and tended to improve NDF digestibility, suggesting that PEG neutralized the negative effects of sorghum CT on fiber digestion. Dietary addition with PEG also tended to increase the molar proportion of ruminal isovaleric acid. Because isovaleric acid is mainly derived from the deamination of amino acids in rumen (Patra and Saxena, 2011), sorghum tannins should inhibit the ruminal fermentation of both carbohydrates and protein.

Previous studies indicated that dietary addition of CT or tannic acid decreased the relative abundances of ruminal protozoa and methanogenic bacteria (Jayanegara et al., 2015; Yang et al., 2016). However, the results of the present experiment showed that adding PEG to the ration containing high sorghum tannins did not affect the relative abundances of protozoa and methanogens. The results indicated that sorghum tannins did not affect ruminal protozoa and methanogenic bacteria. F. succinogenes are predominant cellulolytic bacteria in rumen and can digest fibrous plant particles (Cotta, 1988). It was reported that adding CT from ascophyllum nodosum to rumen bacterial cultures inhibited the growth of F. succinogenes (Wang et al., 2009). In the present experiment, dietary addition with PEG did not increase but decreased the relative abundance of F. succinogenes, suggesting that PEG also has an inhibitory effect on F. succinogenes. B. fibrisolvens are also involved in the ruminal degradation of cellulose and other polysaccharides with butyric acid as the major end-product (Kohno et al., 2009). The decreased molar proportion of butyric acid by adding PEG in the present experiment could be attributed to the decreased relative abundances of F. succinogenes and B. fibrisolvens. Prevotella are predominant ruminal bacteria which can utilize NH3 for MCP synthesis (Stevenson and Weimer, 2009; Wallace et al., 1997). Adding PEG did not affect the relative abundance of Prevotella in the present experiment. This could explain the results that adding PEG did not affect ruminal concentration of MCP.

Previous studies have shown that inclusion of tannins in ruminant rations shift N excretions from urine to feces (Theodoridou et al., 2010) because tannins–protein complexes formed in rumen could not be completely decomposed in the hindgut (Wang et al., 1996). In the present experiment, adding PEG decreased fecal N excretion, but did not affect urinary N excretion, and decreased fecal N-to-total N excretion ratio and increased urinary N-to-total N excretion ratio. The results showed that adding PEG to the ration containing high sorghum tannins shifted N excretions from feces to urine.

The results of the present experiment also showed that adding PEG increased the urinary urea excretion in steers. The reason for the results could be that PEG tended to increase the ruminal concentration of NH3 by inactivating sorghum CT, resulting in increasing NH3 absorption and urea synthesis in liver. Because urinary urea accounts for the major part of urinary nitrogenous compounds and can be rapidly transformed to NH4+ in manure and utilized as the precursor to produce the potent greenhouse gas nitrous oxide (N2O) (Oenema et al., 2005; Sakadevan and Nguyen, 2017), adding PEG to the rations containing high sorghum tannins had a potential to increase the N2O emissions from steer excreta to the environment.

Previous studies indicated that adding CT to the rations of growing lambs and calves did not affect urinary PD excretions (Sharma et al., 2008). The results of the present experiment showed that adding PEG did not affect the urinary excretions of PD and the estimated rumen microbial N supply in steers, suggesting that sorghum tannins had no effect on the ruminal microbial N synthesis. The results agreed with the unaffected ruminal concentration of MCP by adding PEG.

5. Conclusions

Adding PEG to the ration containing high sorghum tannins improved ruminal fermentation of carbohydrates, increased CP digestibility, and tended to increase NDF digestibility, but did not improve N retention and NRR in steers. It shifted N excretions from feces to urine and increased urinary urea excretion in steers. Hence it had a potential to increase the N2O emissions from steer excreta. Adding PEG to the ration containing high sorghum tannins had only a minor effect on nutrient utilization in steers and a potentially negative effect on the environment. It is necessary to investigate new approaches to improve both nutrient digestibility and NRR in steers fed rations containing high sorghum tannins.

Author contributions

Biao Xie: Investigation, Data curation, Software, Writing – original draft. Xiao Yang: Investigation. Ling Yang: Investigation. Xianjiang Wen: Investigation. Guangyong Zhao: Conceptualization, Methodology, Supervision, Writing – review & editing.

Conflict of interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgements

The experiment was supported by National Natural Science Foundation of China (grant No. 31572428).

Footnotes

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.

References

  1. Alipanahi Z., Fatahnia F., Jafari H., Taasoli G., Mirzaei-Alamouti H., Barrett D., Pormalekshahi A.J.L.S. Effect of oak acorn with or without polyethylene glycol in diets containing extruded soybean on milk fatty acid profile, ruminal fermentation and plasma metabolites of lactating goats. Livest Sci. 2019;221:57–62. [Google Scholar]
  2. Alonso-Díaz M.A., Torres-Acosta J.F.J., Sandoval-Castro C.A., Hoste H. Tannins in tropical tree fodders fed to small ruminants: a friendly foe? Small Rumin Res. 2010;89:164–173. [Google Scholar]
  3. AOAC . 18th ed. Association of Official Analytical Chemists; Arlington, VA, USA: 2005. Official Methods of Analysis. [Google Scholar]
  4. Brito A.F., Tremblay G.F., Bertrand A., Castonguay Y., Bélanger G., Michaud R., Lafrenière C., Martineau R., Berthiaume R. Alfalfa baleage with increased concentration of nonstructural carbohydrates supplemented with a corn-based concentrate did not improve production and nitrogen utilization in early lactation dairy cows. J Dairy Sci. 2014;97:6970–6990. doi: 10.3168/jds.2013-7305. [DOI] [PubMed] [Google Scholar]
  5. Broderick G.A., Kang J.H. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci. 1980;63:64–75. doi: 10.3168/jds.S0022-0302(80)82888-8. [DOI] [PubMed] [Google Scholar]
  6. Chen X.B., Gomes M.J. International Feed Resources Unit, Rowett Research Institute; Aberdeen, UK: 1992. Estimation of microbial protein supply to sheep and cattle based on purine derivatives: an overview of technical details; pp. 1–21. [Google Scholar]
  7. Cotta M.A. Amylolytic activity of selected species of ruminal bacteria. Appl Environ Microbiol. 1988;54:772–776. doi: 10.1128/aem.54.3.772-776.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Denman S.E., McSweeney C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol. 2006;58:572–582. doi: 10.1111/j.1574-6941.2006.00190.x. [DOI] [PubMed] [Google Scholar]
  9. Denman S.E., Tomkins N.W., McSweeney C.S. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol Ecol. 2007;62:313–322. doi: 10.1111/j.1574-6941.2007.00394.x. [DOI] [PubMed] [Google Scholar]
  10. Dykes L., Rooney L.W. Sorghum and millet phenols and antioxidants. J Cereal Sci. 2006;44:236–251. [Google Scholar]
  11. Feng Y.L. China Agricultural University Press; Beijing: 2000. The Nutrient Requirements and Feeding Standards of Beef Cattle; pp. 22–23. [Google Scholar]
  12. Getachew G., Pittroff W., Putnam D.H., Dandekar A., Goyal S., DePeters E.J. The influence of addition of gallic acid, tannic acid, or quebracho tannins to alfalfa hay on in vitro rumen fermentation and microbial protein synthesis. Anim Feed Sci Technol. 2008;140:444–461. [Google Scholar]
  13. Grosell M., Genz J. Ouabain-sensitive bicarbonate secretion and acid absorption by the marine teleost fish intestine play a role in osmoregulation. Am J Physiol Regul Integr Comp Physiol. 2006;291:1145–1156. doi: 10.1152/ajpregu.00818.2005. [DOI] [PubMed] [Google Scholar]
  14. Hassan A., Abu Hafsa S.H., Elghandour M.M.Y., Ravi Kanth Reddy P., Salem M.Z.M., Anele U.Y., Pandu Ranga Reddy P., Salem A.Z.M. Influence of Corymbia citriodora leaf extract on growth performance, ruminal fermentation, nutrient digestibility, plasma antioxidant activity and faecal bacteria in young calves. Anim Feed Sci Technol. 2020;261:114394. [Google Scholar]
  15. He Y.Z., Li Z., Tan F., Liu H., Zhu M., Yang H.B., Bi G.G., Wan H.L., Wang J.Q., Xu R.W. Fatty acid metabolic flux and lipid peroxidation homeostasis maintain the biomembrane stability to improve citrus fruit storage performance. Food Chem. 2019;292:314–324. doi: 10.1016/j.foodchem.2019.04.009. [DOI] [PubMed] [Google Scholar]
  16. Huang Q.Q., Jin L., Xu Z., Barbieri L.R., Acharya S., Hu T.M., McAllister T.A., Stanford K., Wang Y. Effects of purple prairie clover (Dalea purpurea Vent.) on feed intake, nutrient digestibility and faecal shedding of Escherichia coli O157:H7 in lambs. Anim Feed Sci Technol. 2015;207:51–61. [Google Scholar]
  17. Irondi E.A., Adegoke B.M., Effion E.S., Oyewo S.O., Alamu E.O., Boligon A.A. Enzymes inhibitory property, antioxidant activity and phenolics profile of raw and roasted red sorghum grains in vitro. Food Sci Hum Well. 2019;8:142–148. [Google Scholar]
  18. Jayanegara A., Goel G., Makkar H.P.S., Becker K. Divergence between purified hydrolysable and condensed tannin effects on methane emission, rumen fermentation and microbial population in vitro. Anim Feed Sci Technol. 2015;209:60–68. [Google Scholar]
  19. Kohno M., Suzuki S., Kanaya T., Yoshino T., Matsuura Y., Asada M., Kitamura S. Structural characterization of the extracellular polysaccharide produced by Bifidobacterium longum JBL05. Carbohydr Polym. 2009;77:351–357. [Google Scholar]
  20. Knop K., Hoogenboom R., Fischer D., Schubert S.U. Poly(ethylene glycol) in drug delivery: pros and cons as well as potential alternatives. Drug Deliv. 2010;49:6288–6308. doi: 10.1002/anie.200902672. [DOI] [PubMed] [Google Scholar]
  21. Makkar H.P., Blümmel M., Becker K. Formation of complexes between polyvinyl pyrrolidones or polyethylene glycols and tannins, and their implication in gas production and true digestibility in vitro techniques. Br J Nutr. 1995;73:897–913. doi: 10.1079/bjn19950095. [DOI] [PubMed] [Google Scholar]
  22. Makkar H.P., Sharma O.P., Dawra R.K., Negi S.S. Simple determination of microbial protein in rumen liquor. J Dairy Sci. 1982;65:2170–2173. doi: 10.3168/jds.S0022-0302(82)82477-6. [DOI] [PubMed] [Google Scholar]
  23. Min B.R., Attwood G.T., Reilly K., Sun W., Peters J.S., Barry T.N., Mcnabb W.C. Lotus corniculatus condensed tannins decrease in vivo populations of proteolytic bacteria and affect nitrogen metabolism in the rumen of sheep. Can J Microbiol. 2002;48:911–921. doi: 10.1139/w02-087. [DOI] [PubMed] [Google Scholar]
  24. Mkhize N.R., Heitkӧnig I.M.A., Scogings P.F., Dzibad L.E., Prinsa H.H.T., De Boer W.F. Effects of condensed tannins on live weight, faecal nitrogen and blood metabolites of free-ranging female goats in a semi-arid African savanna. Small Rumin Res. 2018;166:28–34. [Google Scholar]
  25. Nyachoti C.M., Atkinson J.L., Leeson S. Sorghum tannins: a review. Poultry Sci. 1997;53:5–21. [Google Scholar]
  26. Oenema O., Wrage N., Velthof G.L., Van Groenigen J.W., Dolfing J., Kuikman P.J. Trends in global nitrous oxide emissions from animal production systems. Nutr Cycl Agroecosyst. 2005;72:51–65. [Google Scholar]
  27. Olukoya I.A., Bellmer D., Whiteley J.R., Aichele C.P. Evaluation of the environmental impacts of ethanol production from sweet sorghum. Energy Sustaina Dev. 2015;24:1–8. [Google Scholar]
  28. Pan L., Shang Q.H., Wu Y., Ma X.K., Long S.F., Liu L., Li D.F., Piao X.S. Concentration of digestible and metabolizable energy, standardized ileal digestibility, and growth performance of pigs fed diets containing sorghum produced in the United States or corn produced in China. J Anim Sci. 2017;95:4880–4892. doi: 10.2527/jas2017.1859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Patra A.K., Saxena J. Exploitation of dietary tannins to improve rumen metabolism and ruminant nutrition. J Sci Food Agric. 2011;91:24–37. doi: 10.1002/jsfa.4152. [DOI] [PubMed] [Google Scholar]
  30. Peng K., Shirley D.C., Xu Z.J., Huang Q.Q., McAllister T.A., Chaves A.V., Acharya S., Liu C.L., Wang S.X., Wang Y.X. Effect of purple prairie clover (Dalea purpurea Vent.) hay and its condensed tannins on growth performance, wool growth, nutrient digestibility, blood metabolites and ruminal fermentation in lambs fed total mixed rations. Anim Feed Sci Technol. 2016;222:100–110. [Google Scholar]
  31. Price M.L., Van Scoyoc S., Butler L.G. A critical evaluation of the vanillin reaction as an assay for tannin in sorghum grain. J Agric Food Chem. 1978;26:1214–1218. [Google Scholar]
  32. Sakadevan K., Nguyen M.L. Livestock production and its impact on nutrient pollution and greenhouse gas emissions. Adv Agron. 2017;141:147–184. [Google Scholar]
  33. Sharma R.K., Singh B., Sahoo A. Exploring feeding value of oak (Quercus incana) leaves: nutrient intake and utilization in calves. Livest Sci. 2008;118:157–165. [Google Scholar]
  34. Stevenson D.M., Weimer P.J. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl Microbiol Biotechnol. 2009;75:165–174. doi: 10.1007/s00253-006-0802-y. [DOI] [PubMed] [Google Scholar]
  35. Stewart E.K., Beauchemin K.A., Dai X., MacAdam J.W., Christensen R.G., Villalba J.J. Effect of tannin-containing hays on enteric methane emissions and nitrogen partitioning in beef cattle. J Anim Sci. 2019;97:3286–3299. doi: 10.1093/jas/skz206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sylvester J.T., Karnati S.K., Yu Z.T., Morrison M., Firkins J.L. Development of an assay to quantify rumen ciliate protozoal biomass in cows using real-time PCR. J Nutr. 2004;134:3378–3384. doi: 10.1093/jn/134.12.3378. [DOI] [PubMed] [Google Scholar]
  37. Theodoridou K., Aufrère J., Andueza D., Pourrat J., Le Morvan A., Stringano E., Mueller-Harvey I., Baumont R. Effects of condensed tannins in fresh sainfoin (Onobrychis viciifolia) on in vivo and in situ digestion in sheep. Anim Feed Sci Technol. 2010;160:23–38. doi: 10.1017/S1751731111001510. [DOI] [PubMed] [Google Scholar]
  38. Van Soest P.J., Robertson J.B., Lewis B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74:3583–3597. doi: 10.3168/jds.S0022-0302(91)78551-2. [DOI] [PubMed] [Google Scholar]
  39. Wallace R.J., McKain N., Broderick G.A., Rode L.M., Walker N.D., Newbold J.C. Peptidases of the rumen bacterium, Prevotella ruminicola. Anaerobe. 1997;3:35–42. doi: 10.1006/anae.1996.0065. [DOI] [PubMed] [Google Scholar]
  40. Wang T., Huang Y., Yao W., He Q., Shao Y., Li H., Li Y., Huang F. Effect of conditioning temperature on pelleting characteristics, nutrient digestibility and gut microbiota of sorghum-based diets for growing pigs. Anim Feed Sci Technol. 2019;254:114227. [Google Scholar]
  41. Wang Y., Alexander T.W., McAllister T.A. In vitro effects of phlorotannins from Ascophyllum nodosum (brown seaweed) on rumen bacterial populations and fermentation. J Sci Food Agric. 2009;89:2252–2260. [Google Scholar]
  42. Wang Y., Waghorn G.C., Mcnabb W.C., Barry T.N., Hedley M.J., Shelton I.D. Effect of condensed tannins in Lotus corniculatus upon the digestion of methionine and cysteine in the small intestine of sheep. J Agric Sci. 1996;127:413–421. [Google Scholar]
  43. Yang K., Wei C., Zhao G.Y., Xu Z.W., Lin S.X. Effects of dietary supplementing tannic acid in the ration of beef cattle on rumen fermentation, methane emission, microbial flora and nutrient digestibility. J Anim Physiol Anim Nutr. 2016;101:302–310. doi: 10.1111/jpn.12531. [DOI] [PubMed] [Google Scholar]
  44. Zhong R.Z., Fang Y., Wang Y.Q., Sun H.X., Zhou D.W. Effects of substituting finely ground sorghum for finely ground corn on feed digestion and meat quality in lambs infected with Haemonchus contortus. Anim Feed Sci Technol. 2016;211:31–40. [Google Scholar]

Articles from Animal Nutrition are provided here courtesy of KeAi Publishing

RESOURCES