ABSTRACT
We present the genome sequence of equid alphaherpesvirus 1 (EHV-1) sequenced directly from the nasal swab of a Swiss horse that attended an international equestrian event in Valencia, Spain, the origin of an outbreak of neurological disorders in horses in several European countries in February 2021.
ANNOUNCEMENT
In February 2021 during the CES Valencia Spring Tour, an outbreak of equid alphaherpesvirus 1 (EHV-1) was reported. Since then, 18 horses have died, and cases of EHV-1 linked to the outbreak have been confirmed in 10 countries (https://inside.fei.org/fei/ehv-1).
An 11-year-old gelding presented with fever but without neurological signs after returning from Valencia, Spain, and a nasal swab was collected (25 February) by a private veterinarian. The DNA was isolated using the QIAamp DNA minikit (Qiagen) and eluted in 100 μl of elution buffer. An EHV-1/4 multiplex real-time PCR (1, 2) showed the sample to be positive for EHV-1 (threshold cycle [CT] value, 23) but not EHV-4. A sequencing library of the same DNA was prepared using the NEBNext Ultra II DNA library prep kit and the NEBNext multiplex oligos for Illumina (96 unique dual index primer pairs; New England BioLabs) and sequenced on the Illumina NovaSeq system in a paired-end 2 × 150-nucleotide (nt) run at the Functional Genomics Centre Zurich (FGCZ; Zurich, Switzerland). In total, 144 million raw reads were generated and analyzed using default settings of two in-house pipelines. Sequencing adaptors and low-quality ends were trimmed from quality-controlled reads (FastQC v0.11.17) (average quality lower than 20 within a 4-nt window) using Trimmomatic v0.36 (3). Then, reads were de novo assembled using MEGAHIT v1.1.3 and metaSPAdes v3.12 (4, 5). Subsequently, de novo assembled contigs and quality-controlled reads were realigned to all available full-length EHV-1 GenBank references, including the five EHV-1 strains sequenced from Belgian and French horses that attended the same event in Valencia, Spain (6), using a metagenomic pipeline of the SeqMan NGen v17 (Lasergene; DNAStar, USA). Sanger sequencing of three 500- to 800-nt-long fragments was performed to bridge selected gaps and confirm the Illumina-based sequence (Table 1).
TABLE 1.
Overview of the primer pairs used to bridge selected sequence gaps by Sanger sequencing
| Primer | Sequence 5′–3′ | Starta | Enda | Product length (nt) |
|---|---|---|---|---|
| EHV1_A2_f | TTTCGGCCTCGCGACGGCCTCGAAG | 41 | 65 | 739 |
| EHV1_A2_r | TGTCGCGGAGCGGGTTGAACG | 760 | 780 | |
| EHV1_C_f | CCTCGTCGGACGACATTGTG | 41255 | 41274 | 581 |
| EHV1_C_r | GGTCAAACGACGCCAAGAGG | 41817 | 41836 | |
| EHV1_N_f | ACTCGGCTGATGCGCAATG | 131791 | 131815 | 811 |
| EHV1_N_r | TATCCTGGCGTCCTCGAAC | 132585 | 132602 |
a Position relative to MZ357402.
A near-complete genome sequence of EHV-1 with a length of 151,306 nt (GC content, 56.6%; average depth, 3.92×) covering 96% (SeqMan) of the NCBI reference sequence (GenBank accession number NC_001491.2) was generated from 3,961 reads. With 99.8% nucleotide identity (Blastn v2.12), the sequence is most closely related to strains from Belgium and France (MW855958.1, MW855959.1, MW855960.1, MW855961.1, and MW855962.1) and, as expected, also belongs to clade 10 (6, 7). Like the other strains from the outbreak, it lacks the point mutation at amino acid position 752 of the polymerase, frequently associated with neuropathogenicity (8). Remarkably, while other strains from this outbreak were sequenced after virus isolation and using the Oxford Nanopore technology, sequencing directly from extracted DNA of a nasal swab sample using the Illumina system was successful. While this may have contributed to the differences observed between this sequence and the Belgian and French strains, it shows that even without prior virus isolation, it is possible to generate a near-full-length EHV-1 genome sequence, allowing in-depth phylogenetic analysis and molecular tracing also in cases where virus isolation is not possible or not successful.
Data availability.
The sequence has been deposited in GenBank under the accession number MZ357402. The raw data have been deposited in the NCBI Sequence Read Archive under the accession number SRX11352325.
Contributor Information
Jakub Kubacki, Email: jakub.kubacki@uzh.ch.
Claudia Bachofen, Email: claudia.bachofen@uzh.ch.
Kenneth M. Stedman, Portland State University
REFERENCES
- 1.Diallo IS, Hewitson G, Wright L, Rodwell BJ, Corney BG. 2006. Detection of equine herpesvirus type 1 using a real-time polymerase chain reaction. J Virol Methods 131:92–98. doi: 10.1016/j.jviromet.2005.07.010. [DOI] [PubMed] [Google Scholar]
- 2.Diallo IS, Hewitson G, Wright LL, Kelly MA, Rodwell BJ, Corney BG. 2007. Multiplex real-time PCR for the detection and differentiation of equid herpesvirus 1 (EHV-1) and equid herpesvirus 4 (EHV-4). Vet Microbiol 123:93–103. doi: 10.1016/j.vetmic.2007.02.004. [DOI] [PubMed] [Google Scholar]
- 3.Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Li D, Liu CM, Luo R, Sadakane K, Lam TW. 2015. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31:1674–1676. doi: 10.1093/bioinformatics/btv033. [DOI] [PubMed] [Google Scholar]
- 5.Nurk S, Meleshko D, Korobeynikov A, Pevzner PA. 2017. metaSPAdes: a new versatile metagenomic assembler. Genome Res 27:824–834. doi: 10.1101/gr.213959.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Vereecke N, Carnet F, Pronost S, Vanschandevijl K, Theuns S, Nauwynck H. 2021. Genome sequences of equine herpesvirus 1 strains from a European outbreak of neurological disorders linked to a horse gathering in Valencia, Spain, in 2021. Microbiol Resour Announc 10:e00333-21. doi: 10.1128/MRA.00333-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bryant NA, Wilkie GS, Russell CA, Compston L, Grafham D, Clissold L, McLay K, Medcalf L, Newton R, Davison AJ, Elton DM. 2018. Genetic diversity of equine herpesvirus 1 isolated from neurological, abortigenic and respiratory disease outbreaks. Transbound Emerg Dis 65:817–832. doi: 10.1111/tbed.12809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Goodman LB, Loregian A, Perkins GA, Nugent J, Buckles EL, Mercorelli B, Kydd JH, Palù G, Smith KC, Osterrieder N, Davis-Poynter N. 2007. A point mutation in a herpesvirus polymerase determines neuropathogenicity. PLoS Pathog 3:e160. doi: 10.1371/journal.ppat.0030160. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The sequence has been deposited in GenBank under the accession number MZ357402. The raw data have been deposited in the NCBI Sequence Read Archive under the accession number SRX11352325.