Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2021 Aug 26;87(18):e00923-21. doi: 10.1128/AEM.00923-21

Cotinine Hydroxylase CotA Initiates Biodegradation of Wastewater Micropollutant Cotinine in Nocardioides sp. Strain JQ2195

Lingling Zhao a, Zhenyang Zhao a, Kaiyun Zhang a, Xuan Zhang a, Siqiong Xu a, Junwei Liu a, Bin Liu a, Qing Hong a, Jiguo Qiu a,✉, Jian He a
Editor: Alfons J M Stamsb
PMCID: PMC8388815  PMID: 34232707

ABSTRACT

Cotinine is a stable toxic contaminant, produced as a by-product of smoking. It is of emerging concern due to its global distribution in aquatic environments. Microorganisms have the potential to degrade cotinine; however, the genetic mechanisms of this process are unknown. Nocardioides sp. strain JQ2195 is a pure-culture strain that has been reported to degrade cotinine at micropollutant concentrations. This strain utilizes cotinine as its sole carbon and nitrogen source. In this study, a 50-kb gene cluster (designated cot), involved in cotinine degradation, was predicted based on genomic and transcriptomic analyses. A novel three-component cotinine hydroxylase gene (designated cotA1A2A3), which initiated cotinine catabolism, was identified and characterized. CotA from Shinella sp. strain HZN7 was heterologously expressed and purified and was shown to convert cotinine into 6-hydroxycotinine. H218O-labeling and electrospray ionization-mass spectrometry (ESI-MS) analysis confirmed that the hydroxyl group incorporated into 6-hydroxycotinine was derived from water. This study provides new molecular insights into the microbial metabolism of heterocyclic chemical pollutants.

IMPORTANCE In the human body, cotinine is the major metabolite of nicotine, and 10 to 15% of generated cotinine is excreted in urine. Cotinine is a structural analogue of nicotine and is much more stable than nicotine. Increased tobacco consumption has led to high environmental concentrations of cotinine, which may have detrimental effects on aquatic ecosystems and human health. Nocardioides sp. strain JQ2195 is a unique cotinine-degrading bacterium. However, the underlying genetic and biochemical foundations of cotinine degradation are still unknown. In this study, a 50-kb gene cluster (designated cot) was identified by genomic and transcriptomic analyses as being involved in the degradation of cotinine. A novel three-component cotinine hydroxylase gene (designated cotA1A2A3) catalyzed cotinine to 6-hydroxy-cotinine. This study provides new molecular insights into the microbial degradation and enzymatic transformation of cotinine.

KEYWORDS: cotinine, transcriptomic analyses, cot gene cluster, cotinine hydroxylase

INTRODUCTION

Tobacco smoking is a threat not only to human health but also to the environment (1). A number of toxic compounds are produced during the smoking process: cotinine {(5S)-1-methyl-[3-pyridyl]-2-pyrrolidinone} is the major metabolite of nicotine in the human body (1–4). In humans, approximately 70 to 80% of nicotine is metabolized via the cotinine pathway. Cotinine can be further metabolized into six primary urinary metabolites by P450 enzymes or CYP2A6 enzymes, including 3′-hydroxycotinine, 5′-hydroxycotinine (also called allohydroxycotinine), cotinine N-oxide, cotinine methonium ion, and cotinine glucuronide (also called demethylcotinine) (3). Approximately 10 to 15% of unmetabolized cotinine is excreted in urine and can, therefore, enter into aquatic environments via domestic wastewater discharge. Globally, approximately 5.5 trillion cigarettes are consumed annually, resulting in a significant amount of cotinine entering the environment (1, 5). Cotinine can also be generated from the oxidation of nicotine by light or oxygen in wastewater effluent, increasing the amount of cotinine in ecosystems (1, 6). Cotinine has higher water solubility than nicotine and is relatively stable, with an approximate half-life of 30 h under sewer conditions (1, 7, 8). Cotinine has recently been classified as a contaminant of emerging concern (CEC) due to its abundance in aquatic environments, such as surface water, landfill leachates, sewers, and wastewater treatment plants (WWTP) (9, 10). Due to its mobility and persistence in aquatic environments, it has even been found in tap water. Cotinine has been found in 100% of all tested wastewater and fresh leachate from landfills around the world, including the United States, Europe, Australia, and China, in concentrations between 0.06 μg/liter and 51 μg/liter (9, 11, 12).

Biologically, cotinine has persistent developmental consequences, which may have detrimental effects on aquatic ecosystems and human health. Previous reports have shown that cotinine is toxic to frog embryos and rainbow trout hepatocytes (13–15). High doses of cotinine have a toxic effect in humans, but low-level exposure may also pose unrecognized perinatal risks (9, 16–18). The cardiovascular effects of nicotine have been shown, and this may be due to its conversion into cotinine (4, 19). Short-term harmful effects of smoking on neuroendocrine and cardiovascular systems appear to be caused by the effects of nicotine; however, the long-term effects may be due to cotinine (17). Suzuki et al. reported that cotinine was able to induce urothelial cell proliferation, both in vitro and in vivo, and high urinary concentrations may enhance urothelial carcinogenesis (20). It is therefore of great importance to study the environmental behavior of cotinine, for example, its fate and transformation in aquatic ecosystems.

The degradation of nicotine has been identified as an important area of research, and studies into its fate and biological effects have been conducted for over 60 years (8, 21). However, the environmental degradation and transformation of cotinine has only recently attracted attention in the scientific community. Studies have shown that in the environment, cotinine can be gradually degraded through photocatalytic degradation, chemical degradation, and biodegradation (1, 22–24). A number of advanced oxidation processes (AOPs), such as electrochemical advanced oxidation processes (EAOPs), or oxidations using heterogeneous catalysts, such as magnetic double perovskite oxide (e.g., Sr2FeCuO6), have been reported for the mineralization of cotinine (1, 8). Biodegradation is an environmentally and economically important approach for the removal of cotinine and its metabolites. Studies on the removal of cotinine in WWTPs indicate that cotinine is biodegraded by microorganisms (5, 25). However, the culture of cotinine-degrading strains has not been investigated, and there is no information on the metabolic pathways and molecular mechanisms of cotinine degradation. To understand environmental cotinine degradation by microorganisms, Nocardioides sp. strain JQ2195, capable of degrading and utilizing cotinine as a sole carbon and nitrogen source, was isolated, identified, and characterized in our previous study (8). Two degradation intermediates were identified: 6-hydroxy-cotinine (6HC) and 6-hydroxy-3-succinoylpyridine (HSP) (8). However, the molecular mechanism of cotinine degradation by strain JQ2195, especially the key enzyme(s) responsible for the initial hydroxylation of cotinine, was not identified.

In this study, the catabolic mechanism of cotinine in Nocardioides sp. strain JQ2195 was explored further. Using genome sequencing, the key genes involved in the degradation of cotinine were identified, and then the efficiency of Nocardioides species in cotinine degradation was determined. The complete genome sequence and a novel cotinine degradation gene cluster (designated cot) were identified. Furthermore, the key initial hydroxylation reaction catalyzed by cotinine hydroxylase was identified and characterized. This study provides new insights into cotinine degradation at the molecular level and determines that strain JQ2195 is a candidate for basic research and potential bioremediation applications.

RESULTS

Degradation characteristics of cotinine by strain JQ2195.

Our previous work demonstrated that Nocardioides sp. strain JQ2195 utilizes cotinine as its sole carbon source for cell growth, and that the initial cotinine hydroxylase is inducible (8). To measure the cotinine degradation, the glucose-cultured JQ2195 and cotinine-cultured JQ2195 cells were used in this study. As shown in Fig. 1A, with an initial optical density at 600 nm (OD600) of 4, the glucose-cultured strain JQ2195 degraded 100 mg/liter cotinine in 20 h, with a 6-h lag, while cotinine was consumed in 4 h by the cotinine-cultured cells of JQ2195 without any lag. To further confirm that JQ2195 was induced by cotinine during cotinine degradation, a translation-blocking antibiotic experiment was conducted. Gentamicin (Gm), kanamycin (Km), and streptomycin (Sm), which target ribosomes or inhibit protein synthesis, were added to the cells of JQ2195. As shown in Fig. 1B, cotinine was degraded in 20 h by cells of JQ2195 without antibiotics, while the degradation rate was less than 5% by cells of JQ2195 with antibiotics (Gm, Km, and Sm). These results confirmed that cotinine degradation by Nocardioides sp. strain JQ2195 is induced by cotinine. Therefore, it was feasible to use RNA sequencing (RNA-seq) to identify genes involved in cotinine degradation.

FIG 1.

FIG 1

Open in a new tab

Degradation characteristics of cotinine by Nocardioides sp. strain JQ2195. (A) Biotransformation of cotinine by cotinine-cultured and glucose-cultured cells of Nocardioides sp. strain JQ2195. Results show the means from three independent experiments, and error bars show standard deviations. (B) The experiment of destroyed transcription process in Nocardioides sp. strain JQ2195. Gm (gentamicin), Km (kanamycin), and Sm (streptomycin) are aminoglycoside antibiotics that target 30S ribosomes and affect protein synthesis by causing mistranslation. The experiments were performed in triplicate, and error bars show standard deviations.

Genomic features of strain JQ2195.

The complete genome of strain JQ2195 consists of a single circular chromosome (4,076,625 bp) and one small plasmid (1,682 bp; pNOC1). The chromosome has an average GC content of 68.9% and contains 3,777 protein-coding sequences, two rRNA operons, and 45 tRNA genes. Interestingly, the small 1,682-bp plasmid pNOC1 only contains one putative protein-coding sequence: a putative replication initiation protein gene. Therefore, the following studies mainly focused on the chromosome.

RNA sequencing analysis.

RNA-seq was conducted to identify the genes involved in cotinine degradation. JQ2195 cells were grown with cotinine or in a glucose control, and all cultures were subjected to transcriptomic analyses. From RNA-seq, 15,558,157 and 15,670,571 high-quality reads were obtained from strain JQ2195 cultured with cotinine and glucose, respectively (see Table S1 in the supplemental material). Under cotinine and glucose control conditions, 3,733 and 3,756 expressed genes, respectively, were observed (Tables S4 and S5). Between the treatments, 2,308 genes were identified as differentially expressed, with a log2 fold change of >1 or <−1 (reads per kilobases per million reads) (Table S6). Of these, 1,468 genes were upregulated and 2,276 genes were downregulated, respectively (Tables S7 and S8). Genes involved in the degradation of xenobiotics (e.g., oxidoreductase activity), universal stress proteins, two-component signal transduction systems, and membrane transport systems (Table 1) were upregulated in the cotinine-cultured treatment and could be involved in cotinine metabolism.

TABLE 1.

Functional annotations of the hypothetical proteins

Gene ID Proposed product Homologous protein in UniProtKB/Swiss-Prot (accession no.) Identity (%) Fold change Log2 fold change Regulation
ncot_10255 GTP 3′,8-cyclase MoaA Molybdenum cofactor biosynthesis protein A (Q9RJ47.1) 61 19.33 4.26 Up
ncot_10260 Tartrate dehydrogenase d-Malate dehydrogenase (P70792.1) 52 62.53 5.96 Up
ncot_10265 Hypothetical protein Lysine 6-dehydrogenase (Q9AJC6.1) 25 204.52 7.66 Up
ncot_10270 Regulator PucR Transcriptional activator PmfR (Q8GAH9.1) 37 0.59 −0.76 Down
cotA3 (ncot_10275) Xanthine dehydrogenase family protein Caffeine dehydrogenase large subunit (D7REY3.1) 37 49.46 5.63 Up
cotA2 (ncot_10280) (2Fe-2S)-binding protein Caffeine dehydrogenase small subunit (D7REY5.1) 51 63.64 5.98 Up
cotA1 (ncot_10285) Xanthine dehydrogenase family protein subunit M Caffeine dehydrogenase medium subunit (D7REY4.1) 39 50.88 5.67 Up
ncot_10290 ABC transporter permease Ribose import permease protein RbsC (P0AGI1) 38 433.95 8.75 Up
ncot_10295 Sugar ABC transporter ATP-binding protein Ribose import ATP-binding protein RbsA (Q0S9A4.1) 44 385.46 8.59 Up
ncot_10300 Hydantoinase B/oxoprolinase family protein Hydantoin utilization protein B (Q01263.1) 26 1,043.16 10.03 Up
ncot_10310 Sugar ABC transporter substrate-binding protein d-Apiose import binding protein (A6VKQ8.1) 29 1,735.06 10.74 Up
ncot_10320 IS110 family transposase Transposase for insertion sequence element IS1533 (Q48514.1) 30 21.95 4.48 Up
ncot_10325 Molybdopterin-dependent oxidoreductase Dimethyl sulfoxide/trimethylamine N-oxide reductase (Q57366.1) 41 32.45 5.03 Up
ncot_10330 Hydantoinase B/oxoprolinase family protein Hydantoin utilization protein B (Q01263.1) 26 132.46 7.01 Up
ncot_10340 Sugar ABC transporter substrate-binding protein d-Apiose import binding protein (A6VKQ8.1) 28 143.43 7.16 Up
ncot_10350 IS3 family transposase Putative transposase IS986/IS6110 (A5TY79.2) 34 0.29 −1.7 Down
ncot_10360 Xanthine dehydrogenase family protein Ketone dehydrogenase large molybdopterin subunit (Q933N0.1) 57 28.12 4.81 Up
ncot_10365 Amidase 6-Aminohexanoate-cyclic-dimer hydrolase (P13398.2) 35 72.11 6.15 Up
ncot_10370 Hypothetical protein No hitsa 70.77 6.13 Up
ncot_10375 Hypothetical protein No hitsa 7.83 2.97 Up
ncot_10380 Glutamate-1-semialdehyde aminotransferase Glutamate-1-semialdehyde 2,1-aminomutase (A5EXX1.1) 34 105.63 6.71 Up
ncot_10385 Alpha/beta hydrolase 2,6-Dihydropseudooxynicotine hydrolase (Q93NG6.1) 52 381.25 8.56 Up
ncot_10390 (2Fe-2S)-binding protein Ketone dehydrogenase small FeS subunit (O87682.1) 63 204.27 7.66 Up
ncot_10395 Xanthine dehydrogenase family protein subunit M Ketone dehydrogenase medium FAD subunit (O87681.2) 43 233.99 7.87 Up
ncot_10400 Carbon-nitrogen family hydrolase 2-Oxoglutaramate amidase (Q93NG1.1) 46 38.69 5.28 Up
ncot_10405 SRPBCC family protein No hitsa 43.87 5.43 Up
ncot_10410 NAD-binding protein 2,6-Dihydroxypyridine 3-monooxygenase (Q93NG3.1) 54 801.96 9.65 Up
ncot_10415 Cyclase family protein Kynurenine formamidase (A4IT60.1) 27 1,307.72 10.34 Up
ncot_10420 Dabb family protein No hitsa 1,034.83 9.97 Up
ncot_10425 NAD(P)H-dependent oxidoreductase NAD(P)H-dependent FMN reductase LOT6 (Q07923.1) 36 113.10 6.79 Up
ncot_10430 Molybdenum cofactor biosynthesis protein Molybdopterin synthase catalytic subunit 1 (P9WJR2.1) 44 7.97 2.96 Up
ncot_10435 XshC-Cox1 family protein Molybdenum cofactor insertion chaperone PaoD (P77183.1) 26 15.79 3.97 Up
Open in a new tab
a

No homologous protein.

A gene cluster is involved in cotinine biodegradation of strain JQ2195.

From the transcriptome analysis, a 50-kb gene cluster comprising 36 genes (ncot_10255 to ncot_10435) was of significant interest (Table S9). These included 25 functional genes, one transcriptional regulator, four mobile elements/integrases, and two transposases (Table 1). Ten genes were upregulated >23-fold, including three genes up to 210 fold (Table 1): this gene cluster was predicted to be involved in cotinine degradation and was designated cot.

In the cot cluster, two sets of genes, ncot_10275 (5.63 log2 fold change), ncot_10280 (5.98 log2 fold change), and ncot_10285 (5.67 log2 fold change) and ncot_10360 (4.81 log2 fold change), ncot_10390 (7.66 log2 fold change), and ncot_10395 (7.87 log2 fold change), were predicted to encode typical three-component CO/xanthine dehydrogenase (Cox) family proteins (Table 1), which are involved in the oxidation of pyridine derivatives. Downstream of the ncot_10395 gene, a putative FAD-dependent monooxygenase gene (ncot_10410, 9.65 log2 fold change) demonstrated amino acid sequence similarity of 54% with 2,6-dihydroxypyridine hydroxylase (DHPH) from a nicotine-degrading bacterium Paenarthrobacter nicotinovorans pAO1 (Fig. 2) (26). In our previous study, strain JQ2195 cultures turned dark blue when grown on cotinine due to the formation of a pigment known as nicotine blue. Nicotine blue [4,5,4′,5′-tetrahydroxy-3,3′-diazadiphenoquinone-(2,2′)] is formed by the spontaneous condensation of two molecules of trihydroxypyridine (THP) that form from hydroxylation of 2,6-dihydroxypyridine (DHP) by the enzyme DHPH (Fig. 2) (27). Therefore, it was proposed that 2,6-dihydroxypyridine was a catabolic intermediate of cotinine. Based on this, a comparison of the cot gene cluster of Nocardioides sp. strain JQ2195 and the nic gene cluster of Paenarthrobacter nicotinovorans pAO1 was performed (Fig. 2 and Table S2). Several similar gene modules were found between the two clusters: two sets of three-component Cox family proteins, the pkc and dhph genes, and several cox accessory genes. The amino acid sequence similarities ranged from 30% to 60%.

FIG 2.

FIG 2

Open in a new tab

Schematics of cot gene cluster and proposed metabolic pathway for cotinine. (A) Pyridine pathways of nicotine degradation in representative strain P. nicotinovorans pAO1. (B) Proposed cotinine metabolic pathway and corresponding metabolic genes of Nocardioides sp. strain JQ2195. Determined and proposed metabolic pathways are indicated by solid black arrows and dotted black arrows, respectively. (C) Schematics of nic gene cluster in P. nicotinovorans pAO1. mao, monoamine oxidase gene; ssaDH, succinic semialdehyde dehydrogenase gene; nepB, SMR family gene; nepA, SMR family gene; folD, putative methylene-tetrahydrofolate dehydrogenase gene; abo, gamma-N-methylaminobutyrate oxidase gene; purU, putative formyltetrahydrofolate deformylase gene; app, amino acid permease gene; pmfR, transcriptional activator gene; Tn, transposase; mobA, MobA family gene; cox, Cox family genes D, E, F, and G; hpoh, 2,3,6THP hydrolase gene; dhph, 2,6-dihydroxypyridine-3-hydroxylase gene; hpoI, 2-ketoglutaramate amidase gene; kdh, ketone dehydrogenase genes; ponh, 2,6-dihydroxypseudooxynicotine hydrolase gene; put, putative transcriptional regulator genes; 6hlno, 6-hydroxy-l-nicotine oxidase gene; ndh, nicotine dehydrogenase genes; IS, insertion sequence; moaA, MoaA family gene; 6hdno, 6-hydroxy-d-nicotine oxidase gene; hdnoR, transcriptional activator gene. (D) Genetic organization of the cot gene cluster on Nocardioides sp. strain JQ2195 chromosomes compared with similar nicotine degradation-related genes on P. nicotinovorans megaplasmid pAO1. Homologous genes are indicated by the same color. Numbers show the amino acid sequence identities between homologous genes.

cotA1A2A3 genes are responsible for biotransformation of cotinine to 6HC.

Our previous study indicated that the initial step in cotinine degradation was dehydrogenation/hydroxylation, with the formation of 6HC in Nocardioides sp. strain JQ2195 (8). To determine which set of three-component Cox family proteins from the cot cluster is responsible for the initial conversion of cotinine, subclones containing ncot_10275, ncot_10280, and ncot_10285 or ncot_10360, ncot_10390, and ncot_10395 were ligated into the broad-host-range plasmid pBBR1-MCS2 (28) and heterologously expressed in different hosts, such as Escherichia coli DH5α, Pseudomonas putida KT2440 (29), and Alcaligenes faecalis JQ135 (30), but with no success. The nicotine, but not cotinine, degrader (data not shown) Shinella sp. strain HZN7 (31), which might provide similar accessory factors needed for degradation of N-heterocyclic compounds, was chosen as a host. Biotransformation was carried out with 100 mg/liter cotinine as the substrate, using resting cells of HZN7/pBBR1MCS-2 (negative control), HZN7/pBBR-cotA1A2, HZN7/pBBR-cotA2A3, HZN7/pBBR-cotA1A2A3, HZN7/pBBR-10360-10390, HZN7/pBBR-10390-10395, and HZN7/pBBR-10360-10390-10395, with an inoculation cell density of an OD600 of 2. The resting cells of HZN7/pBBR-cotA1A2A3 could convert 100 mg/liter cotinine in 24 h (Fig. 3A), with a maximal absorbance at 260 nm that gradually disappeared, producing a new product peak with a maximal absorbance at 290 nm (Fig. 3B). High-performance liquid chromatography (HPLC) results indicated that cotinine was degraded and transformed to a new product, which had the same retention time as 6HC (12.907 min) (Fig. 3C). The ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) results show that the molecular ion peak [M+H]+ of this product was observed at 193.1 m/z, with a fragment ion peak at 98.06, 69.02, 161.09, and 135.06 m/z (Fig. 3D), which are equal to the theoretical molecular mass of 6HC (8). In contrast, Shinella sp. strain HZN7, containing empty pBBR1MCS-2 (Fig. 3A) and the above-described five other derivatives, did not degrade cotinine, and no product was detected in the HPLC (data not shown). Thus, it could be concluded that ncot_10285 (designated cotA1), ncot_10280 (cotA2), and ncot_10275 (cotA3) are responsible for the conversion of cotinine to 6HC in Nocardioides sp. strain JQ2195, and all three components are essential for cotinine hydroxylation.

FIG 3.

FIG 3

Open in a new tab

Conversion of cotinine into 6HC by recombinant strain HZN7/pBBR-cotA1A2A3. (A) Degradation of cotinine by HZN7/pBBR1MCS-2 (■) and HZN7/pBBR-cotA1A2A3 (●). The cells were suspended to an OD of 600 of 1.0 in MSM containing 100 mg/liter cotinine. The experiments were performed in triplicate. The results are averages from three independent experiments, and the error bars show standard deviations. (B) UV-Vis absorption of cotinine (absorption maximum at 260 nm) and 6HC (absorption maximum at 290 nm). (C) HPLC profiles of cotinine degradation and 6HC accumulation by HZN7/pBBR-cotA1A2A3. The detection wavelength was set at 260 nm (dotted lines) and 290 nm (solid lines). (D) UHPLC-MS/MS profiles of the transformation product 6HC. The inset shows a molecular ion peak [M+H]+ at 193.1 m/z.

CotA is a three-component cotinine hydroxylase.

The activity of CotA was determined by the cell extract of HZN7/pBBR-cotA1A2A3. The cells were collected after 12 h of cotinine conversion by the resting cells of HZN7/pBBR-cotA1A2A3. The hydroxylase activities of cell extract of HZN7/pBBR-cotA1A2A3 were detected when an artificial electron acceptor, 2,6-dichloroindophenol sodium salt (DCIP) (200 μM), was added (data not shown).

To further study the properties of CotA, a 6×His tag was added to the C terminus or N terminus of different subunits. CotA1A2HisA3 (CotA2 containing C-terminal 6×His tag) and CotA1A2A3His (CotA3 containing C-terminal 6×His tag) were partially purified from HZN7 hosts (Table S3). The partially purified CotA proteins were determined by SDS-PAGE, and three bands with molecular masses of approximately 35 kDa (CotA1), 18 kDa (CotA2), and 84 kDa (CotA3) (Fig. S1) were present. The partial purifications of CotA1A2HisA3 and CotA1A2A3His were 27.50-fold, with a yield of 28.47%, and 30.00-fold, with a yield of 31.17%, respectively (Table S3). There were no significant differences between CotA1A2HisA3 and CotA1A2A3His activity. Thus, CotA1A2HisA3 was selected for further experiments.

Hydroxylases of N-heterocyclic aromatic compounds usually incorporate oxygen atoms derived from a water molecule and rapidly deliver electrons to molecular oxygen, generating reducing equivalents (32–34). Thus, H218O labeling experiments by partially purified CotA1A2HisA3 provided direct evidence. The mass spectra of the 6HC produced were shifted by +2 m/z (i.e., the molecular ion changed from 193.10 to 195.10), indicating the incorporation of an oxygen atom from H218O (Fig. 4B). The reaction was further tested under anaerobic conditions. As shown in Fig. 4C, partially purified CotA1A2HisA3 showed activity when DCIP was present under aerobic conditions. In contrast, little or no activity was detected when either O2 or DCIP, or both O2 and DCIP, were absent (Fig. 4C). In addition, when the anaerobic reactions with DCIP were reexposed to O2, the cotinine conversion rate reached aerobic reaction levels (Fig. 4C). These data indicate that the oxygen atom of 6HC was derived from the water molecule, and O2 was the final electron acceptor. Therefore, CotA was considered a three-component cotinine hydroxylase (EC 1.17.3.x). The cell extract or partially purified protein from HZN7/pBBR-cotA1HisA2A3 (CotA1 containing N-terminal 6×His tag) could not convert cotinine. Similarly, the mixtures of three cell extracts or three components purified separately from HZN7/pBBR-cotA1His, HZN7/pBBR-cotA2His, and HZN7/pBBR-cotA3His could not convert cotinine either. This could be because the interactions between the three components were destroyed. In addition, partially purified CotA1A2HisA3 showed no activity toward nicotine or nornicotine (data not shown), which are structural analogs of cotinine, indicating that CotA is cotinine specific.

FIG 4.

FIG 4

Open in a new tab

ESI-MS analysis of H218O-labeling CotA (partially purified CotA1A2HisA3)-catalyzing experiments and O2-dependent experiment of partially purified CotA (partially purified CotA1A2HisA3). (A) ESI-MS analysis of CotA catalyzing reaction mix containing 50 mg/liter cotinine and 0.1 mM DCIP mixed with CotA in 50 mM PBS buffer. (B) H218O was added to the reaction mixture at 50% (vol/vol) instead of 50 mM PBS buffer. The 18O-labeling cotinine is indicated. (C) O2-dependent experiment. E, partially purified CotA1A2HisA3; 200 μg was added to the reaction; 50 mg/liter cotinine was added to the reaction. a, the reaction with DCIP added under aerobic conditions; b, the reaction without DCIP added under aerobic conditions; c, the reaction with DCIP added under anaerobic conditions; d, the reaction without DCIP added under anaerobic conditions; e, the reaction with DCIP added was first reacted under anaerobic conditions for 10 min, reexposed with O2 (*), and continuously reacted under aerobic conditions for 10 min; f, the reaction without DCIP added was first reacted under anaerobic conditions for 10 min, reexposed with O2 (*), and continuously reacted under aerobic conditions for 10 min. The experiments were performed in triplicate. The results are the averages from three independent experiments, and the error bars show standard deviations.

Site-directed mutagenesis.

To assess the key conserved amino acids of CotA, a cysteine residue (CotA2C51) was replaced with alanine (Ala) residues through site-directed mutagenesis. The biotransformation of cotinine of HZN7/pBBR-CotA1A2C51AA3 mutant was not detected by HPLC, and the cell extract of HZN7/pBBR-CotA1A2C51AA3 completely lost hydroxylase activity (data not shown).

DISCUSSION

In this study, a 50-kb gene cluster (cot) involved in the degradation of cotinine, was identified from complete genome sequencing and RNA-seq analyses of Nocardioides sp. strain JQ2195. A three-component molybdenum-containing hydroxylase, CotA, that converts cotinine into 6HC was partially purified and identified. This study provided new insights into the molecular degradation of cotinine by microorganisms. Molybdenum-containing hydroxylases are widespread in microorganisms for the hydroxylation of N-heterocyclic aromatic compounds. Molybdenum-containing enzymes typically contain a redox center, formed by a molybdenum cofactor (MoCo), two [2Fe-2S] clusters, and FAD, which transports electrons from the reducing substrate (N-heterocyclic compound) to the oxidizing substrate (the electron acceptor) (29). The MoCo-containing subunit (e.g., CotA3 in this study) always contains three MoCo-binding domains (Fig. 5A); one arrangement is MPT1-MPT2-MPT3 in most members of the Cox family, and the other arrangement is MPT2-MPT1-MPT3, as in VppA from Ochrobactrum sp. strain SJY1 (29, 32). Sequence analysis showed that CotA3 (large CotA subunit) contained MoCo binding sites in an arrangement (MPT1-MPT2-MPT3) similar to that observed in most members of the xanthine dehydrogenase family (Fig. 5A). The small subunit of CotA (CotA2) harbors the 104-C-G-X-C-X2-G-X28-G-X2-C-X-C-X-G-145 conserved motifs, which are likely involved in the small subunit (two [2Fe-2S] clusters) of other multicomponent xanthine dehydrogenases (see Fig. S1 in the supplemental material). The medium subunit (CotA1), small subunit (CotA2), and large subunit (CotA3) are closely related to KDHM, KDHS, and NDHL in phylogenetic trees, respectively (Fig. 5B). In addition, the three subunits of CotA were arranged in MCD-[2Fe-2S]-FAD clusters that differ from most members of the xanthine dehydrogenase family (MCD-FAD-[2Fe-2S] clusters). These results suggest that CotA was a new member of typical molybdenum-containing hydroxylases.

FIG 5.

FIG 5

Open in a new tab

Molecular architecture of different molybdenum-containing hydroxylases. (A) Molecular architecture of several multicomponent molybdenum-containing hydroxylases. PicA (GenBank locus tags AFA_15100, AFA_15095, and AFA_15090), PA dehydrogenase from Alcaligenes faecalis JQ135; SpmABC (GenBank accession numbers AEJ14617 and AEJ14616), 3-succinoylpyridine dehydrogenase from P. putida; CDHABC (D7REY3, D7REY4, and D7REY5), caffeine dehydrogenase from Pseudomonas sp. strain CBB1; NDHLMS (CAA53088, CAA53087, and CAA53086), nicotine dehydrogenase from Arthrobacter nicotinovorans; KDHLMS (WP_016359451, WP_016359456, and WP_016359457), ketone dehydrogenase from A. nicotinovorans; CODHLMS (P19913, P19914, and P19915), carbon monoxide dehydrogenase from Hydrogenophaga pseudoflava; XDHABC (Q46799, Q46800, and Q46801), xanthine dehydrogenase from E. coli; QoxLMS (CAD61045, CAD61046, and CAD61047), quinaldine 4-oxidase from A. ilicis. The letters depicted below the proteins indicate the subunit names of the corresponding proteins. The conserved domains are the following: MPT, domains for binding to the molybdopterin cytosine dinucleotide cofactor (MoCo); FAD, [FeS], ferredoxin-like [2Fe-2S]-binding domain, FAD-binding domain; SRPBCC, SRPBCC ligand-binding domain. (B) Phylogenetic analysis of CotA and related molybdenum containing hydroxylases. (a) Phylogenetic analysis of CotA1 and the FAD binding subunit of other enzymes; (b) phylogenetic analysis of CotA2 and the [2Fe-2S] binding subunit of other enzymes; (c) phylogenetic analysis of CotA3 and the Moco binding subunit of other enzymes. The phylogenetic trees were constructed by the neighbor-joining method (with a bootstrap of 1,000) with MEGA 6.0. The bar represents amino acid substitutions per site.

The microbial catabolism of nicotine with hydroxylation (so-called pyridine pathway) might facilitate our understanding of the catabolic route of cotinine (35). The pyridine pathway is fully understood in some Gram-positive actinobacteria, such as Paenarthrobacter nicotinovorans pAO1 (36). After comparing the cot gene cluster in Nocardioides sp. strain JQ2195 with nic gene clusters from P. nicotinovorans pAO1, several similar gene modules were found, including the two xanthine dehydrogenase family proteins and genes that catalyze the cleavage of the pyridine ring, such as ponH, dhpH, hpoH, and hpoI (35) (Fig. 2, Table S2). NdhLMS and KdhLMS, the two Cox family proteins in P. nicotinovorans pAO1, catalyze two hydroxylations of the nicotine pyridine ring at C-6 and C-2 (Fig. 2A). CotA was similar to NdhLMS, which is responsible for the hydroxylation of the pyridine ring at C-6. In the cot cluster, another Cox family protein (Ncot_10395, Ncot_10390, and Ncot_10360) that could not transform cotinine to 6HC showed high amino acid sequence similarity (42 to 65%) to KdhLMS. The organization of genes ncot_10360, ncot_10390, and ncot_10395 was analogous with kdhLMS, while the large subunits (Ncot_10360 and KdhL) were separated with another two subunits (Fig. 2C and D). Therefore, Ncot_10395, Ncot_10390, and Ncot_10360 were most likely molybdenum-containing hydroxylases that catalyze hydroxylation of the cotinine pyridine ring at C-2 (Fig. 2B). The proteins PonH, DhpH, HpoH, and HpoI showed the highest similarities (46 to 75%) to Ncot_10385, Ncot_10410, Ncot_10415, and Ncot_10400, respectively. Thus, the lower degradation pathway from 26DHP to the tricarboxylic acid of cotinine could be the same as that for nicotine (Fig. 2B) (35). In P. nicotinovorans pAO1, 6HLNO was responsible for 6-hydroxynicotine degradation (37). However, no homolog of 6HLNO was found in the cot gene cluster, even in the whole genome of strain JQ2195. In contrast, two sets of genes, ncot_10300, ncot_10305, ncot_10330, and ncot_10335, which share almost 100% sequence similarities with each other, were predicted to be hydantoinase B/oxoprolinase family proteins (Table 1). We predicted they were involved in the break of the lactam amide bond of 6HC (Fig. 2B). Interestingly, the GC content of the cot gene cluster was 59.8%, compared to 68.9% in the entire chromosome. Moreover, a BLASTp search against the NCBI database showed that the cot gene cluster was not found in any other bacteria. Considering the appearance of several recombination event-related genes (e.g., ncot_10320, putative transposase), this unique cot gene cluster might be a gene assembly, the elements of which have been obtained by horizontal gene transfer.

In summary, a new cotinine hydroxylase, CotA, that catalyzes the initial degradation step of cotinine in Nocardioides sp. strain JQ2195 was identified. The present study expands our understanding of cotinine metabolic mechanisms and provides a good candidate gene for the removal of cotinine from contaminated environments. Nevertheless, there are still many unknown mechanisms in cotinine degradation, such as the genes or enzymes involved in the transformation of 6HC. Further studies should focus on the detection of new intermediate metabolites and the identification of genes/enzymes involved in cotinine degradation.

MATERIALS AND METHODS

Chemicals, reagents, and media.

Cotinine (>99%) was purchased from Sigma-Aldrich (USA). Chromatographic-grade methanol was purchased from J&K Scientific Ltd. (China).

Luria-Bertani (LB) medium, consisting of 10 g/liter tryptone, 5 g/liter yeast extract, and 10 g/liter NaCl, was used to culture strain JQ2195 at 30°C. Mineral salts medium (MSM) and trace elements medium stock solution were the same as those in previous reports (8). The initial pH of the medium was adjusted to 7.0 by H3PO4 and autoclaved at 121°C for 30 min.

The cotinine concentration used in this study was always 100 mg/liter, and the concentrations of antibiotics (gentamicin [Gm], kanamycin [Km], and streptomycin [Sm]) were also 100 mg/liter.

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 2. The actinobacterium Nocardioides sp. strain JQ2195 is a cotinine-degrading bacterium. Shinella sp. strain HZN7 is a nicotine-degrading alphaproteobacterium (31). Bacteria were cultured in LB medium under aerobic conditions at 37°C (Escherichia coli) or 30°C (Nocardioides, Shinella, and their derivates), and both of them were on a rotary shaker (180 rpm). Antibiotics were added as required (Table 2).

TABLE 2.

Strains and plasmids used in this study

Strains or plasmid Description Reference or source
Strains
    Nocardioides sp. strain JQ2195 Cotinine-degrading strain; Gram positive CCTCC M 2016118
    Shinella sp. strain HZN7 Ampr, nicotine-degrading strain; Gram negative CCTCC M 2013060; 31
    Escherichia coli DH5α Host strain for cloning plasmid Lab stock
        HB101(pRK600) Cmr, conjugation helper strain Lab stock
        HZN7/pBBR1MCS-2 Ampr, Kmr; HZN7 containing plasmid pBBR1-MCS-2 This study
        HZN7/pBBR-cotA1A2A3 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1A2A3 This study
        HZN7/pBBR-cotA1A2 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1A2 This study
        HZN7/pBBR-cotA2A3 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA2A3 This study
        HZN7/pBBR-10360-10390-10395 Ampr, Kmr; HZN7 containing plasmid pBBR-10360-10390-10395 This study
        HZN7/pBBR-10360-10390 Ampr, Kmr; HZN7 containing plasmid pBBR-10360-10390 This study
        HZN7/pBBR-10390-10395 Ampr, Kmr; HZN7 containing plasmid pBBR-10390-10395 This study
        HZN7/pBBR-cotA1His Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1His This study
        HZN7/pBBR-cotA2His Ampr, Kmr; HZN7 containing plasmid pBBR-cotA2His This study
        HZN7/pBBR-cotA3His Ampr, Kmr; HZN7 containing plasmid pBBR-cotA3His This study
        HZN7/pBBR-cotA1HisA2A3 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1HisA2A3 This study
        HZN7/pBBR-cotA1A2HisA3 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1A2HisA3 This study
        HZN7/pBBR-cotA1A2A3His Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1A2A3His This study
        HZN7/pBBR-cotA1A2C51AA3 Ampr, Kmr; HZN7 containing plasmid pBBR-cotA1A2C51AA3 This study
Plasmids
    pBBR1MCS2 Kmr; broad-host-range cloning vector 28
    pBBR-cotA1A2A3 Kmr; the fragment containing the cotA1A2A3 gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1A2 Kmr; the fragment containing the cotA1A2 gene inserted into pBBR1MCS-2 This study
    pBBR-cotA2A3 Kmr; the fragment containing the cotA2A3 gene inserted into pBBR1MCS-2 This study
    pBBR-10360-10390-10395 Kmr; the fragment containing the 10360-10390-10395 gene inserted into pBBR1MCS-2 This study
    pBBR-10360-10390 Kmr; the fragment containing the 10360-10390 gene inserted into pBBR1MCS-2 This study
    pBBR-10390-10395 Kmr; the fragment containing the 10390-10395 gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1His Kmr; the fragment containing the cotA1His gene inserted into pBBR1MCS-2 This study
    pBBR-cotA2His Kmr; the fragment containing the cotA2His gene inserted into pBBR1MCS-2 This study
    pBBR-cotA3His Kmr; the fragment containing the cotA3His gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1HisA2A3 Kmr; the fragment containing the cotA1HisA2A3 gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1A2HisA3 Kmr; the fragment containing the cotA1A2HisA3 gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1A2A3His Kmr; the fragment containing the cotA1A2A3His gene inserted into pBBR1MCS-2 This study
    pBBR-cotA1A2C51AA3 Kmr; the fragment containing the cotA1A2C51AA3 gene inserted into pBBR1MCS-2 This study
Open in a new tab

Genome sequencing and analysis.

Total DNA of strain JQ2195 was extracted using a bacterial genomic DNA isolation kit (Biomiga, Beijing, China) by following the manufacturer’s instructions. To sequence the genomes of JQ2195, 300- to 500-bp shotgun libraries were constructed and sequenced on an Illumina HiSeq system using standard methods, and 8- to 10-kb shotgun libraries were constructed and sequenced on a PacBio RS system using standard methods. The overall levels of sequence coverage were 200.0×. Finally, sequencing reads were assembled using SOAP de novo software (version 2.04) (https://sourceforge.net/projects/soapdenovo2/files/GapCloser/). De novo gene prediction was performed using the Glimmer (version 3.0) system (http://www.cbcb.umd.edu/software/glimmer/). Functional annotation was accomplished by performing BLAST analysis of protein sequences in the UniProtKB/Swiss-Prot, nonredundant protein (NR), KEGG, and COG databases on the National Center for Biotechnology Information (NCBI) and the Rapid Annotation Subsystem Technology (RAST) databases.

Preparation of resting cells and cotinine-cultured and glucose-cultured cells.

Cells were grown in 100 ml LB medium until an OD600 of 2.0. They were then centrifuged at 8,000 rpm for 15 min at 4°C, washed twice with MSM, and resuspended into the MSM. These cells were called resting cells; 100 mg/liter cotinine or glucose (control) was added to the resting cells, and after 24 h, the cells were collected by centrifugation at 8,000 rpm for 15 min, washed twice with MSM, and resuspended in MSM (final OD600 of 4.0). This yielded cotinine-cultured cells and glucose-cultured cells.

Transcriptome analysis.

For transcriptomic analyses, strain JQ2195 was inoculated into 100 ml MSM containing 100 mg/liter cotinine in a 250-ml flask (final OD600 of 4). A flask containing 100 mg/liter glucose was used as the control. Cotinine degradation was measured over 3 days, with incubation at 30°C and shaking at 180 rpm. After 3 days, when the degradation of cotinine was complete, 100 mg/liter cotinine and 100 mg/liter glucose were added for the second induction. After 2 h, when approximately 50% of cotinine was degraded, cells (cotinine-induced and glucose-induced) were collected by centrifugation at 12,000 rpm at 4°C for 10 min. Both cotinine and glucose cultures were performed in triplicate for the transcriptomics. Total RNA was extracted from the harvested cells using an RNA extraction kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol. An Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano kit) and ABI StepOnePlus real-time PCR system were used to detect total RNA concentrations. Transcriptome sequencing of strain JQ2195 was performed on an Illumina HiSeq 2000 system. The raw reads were filtered by SOAPnuke to obtain clean reads (38). Clean reads were mapped to the reference genome of strain JQ2195 using HISAT (Hierarchical Indexing for Spliced Alignment of Transcripts) (39). Fragments per kilobase of transcript per million mapped reads were used to calculate the gene expression level of each sample using RSEM (40).

Cloning of cotinine hydroxylase genes cotA1A2A3 from strain JQ2195.

DNA fragments containing cotA1A2, cotA2A3, cotA1A2A3, ncot10360-ncot10390, ncot10390-ncot10395, and ncot10360-ncot10390-ncot10395 were amplified from the genomic DNA of strain JQ2195 by PCR, using the primers listed in Table 3. The PCR products and plasmid pBBR1MCS-2 were linearized by PCR and then ligated to generate pBBR-cotA1A2, pBBR-cotA2A3, pBBR-cotA1A2A3, pBBR-ncot10360-ncot10390, pBBR-ncot10390-ncot10395, and pBBR-ncot10360-ncot10390-ncot10395 (Table 2). The resulting plasmids and empty plasmid pBBR1MCS-2 were introduced into Shinella sp. strain HZN7 by triparental conjugative transfer to generate HZN7/pBBR1MCS-2 (negative control), HZN7/pBBR-cotA1A2, HZN7/pBBR-cotA2A3, HZN7/pBBR-cotA1A2A3, HZN7/pBBR-ncot10360-ncot10390, HZN7/pBBR-ncot10390-ncot10395, and HZN7/pBBR-ncot10360-ncot10390-ncot10395, respectively. Resting cells were then checked for cotinine transformation ability. Cotinine was added at a final concentration of 100 mg/liter in the resting cells and shaken at 180 rpm at 30°C. Samples were taken at 0 h, 8 h, 12 h, and 24 h. Cells were removed by centrifugation, and the supernatant was subjected to spectrophotometry scanning and HPLC analysis as described below.

TABLE 3.

Primers used in this study

Primer Sequence (5′–3′)a Description
Primer-1-F AGCTGTTTCCTGTGTGAAATTG To get linear plasmid pBBR
Primer-1-R GCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAG
Primer-2-F CAATTTCACACAGGAAACAGCTATGCCCGAGCGCGGCGAG To construct plasmid pBBR-cotA1A2A3
Primer-2-R GAATTTTAACAAAATATTAACGCTCAATTCAATGTCACATCGTTC
Primer-3-F CAATTTCACACAGGAAACAGCTATGACGGACAAAGACATTTC To construct plasmid pBBR-cotA1A2
Primer-3-R GAATTTTAACAAAATATTAACGCTCAATTCAATGTCACATCGTTC
Primer-4-F CAATTTCACACAGGAAACAGCTATGCCCGAGCGCGGCGAG To construct plasmid pBBR-cotA2A3
Primer-4-R GAATTTTAACAAAATATTAACGCTCATTCGCCTTCCCCTTC
Primer-5-F CAAGGGACGGGAGTCCATGAGCGCCGCGAAAGTACCACGAG To overlap clone
Primer-5-R CTCGTGGTACTTTCGCGGCGCTCATGGACTCCCGTCCCTTG
Primer-6-F CAATTTCACACAGGAAACAGCTATGAAACCGCCGCCGTTCG To construct plasmid pBBR-10360-10390-10395
Primer-6-R GAATTTTAACAAAATATTAACGCCTACTTGACCTCAGTGGATTC
Primer-7-F CAATTTCACACAGGAAACAGCTATGAAGACTCGCATCATCGC To construct plasmid pBBR-10360-10390
Primer-7-R GAATTTTAACAAAATATTAACGCCTACTTGACCTCAGTGGATTC
Primer-8-F CAATTTCACACAGGAAACAGCTATGAAACCGCCGCCGTTCG To construct plasmid pBBR-10390-10395
Primer-8-R GAATTTTAACAAAATATTAACGCTCATGGACTCCCGTCCCTTG
Primer-9-R CATCACCATCACCATCACTAGGCGTTAATATTTTG To get linear plasmid pBBRC-His with primer-1-F
Primer-10-R TCAGTGATGGTGATGGTGATGTAACGATCGTCCGTTCGTCG To construct plasmid pBBR-cotA1His with primer-2-F
Primer-11-F CAATTTCACACAGGAAACAGCTATGTGCCGGGATTCCCTCG To construct plasmid pBBR-cotA2His with primer-11-R
Primer-11-R TCAGTGATGGTGATGGTGATGTTGTTTTTCTCCTTCGACAC To get linear cotA2HiscotA3 with Primer-2-R
Primer-12-F CAATTTCACACAGGAAACAGCTATGACTGGGGACCAGGAC To construct plasmid pBBR-cotA3His with primer-12-R
Primer-12-R TCAGTGATGGTGATGGTGATGGGTTTGGGGTGAACTGGCC To construct plasmid pBBR-cotA1A2A3His with primer-2-F
Primer-13-F GTGATGGTGATGGTGATGCATAGCTGTTTCCTGTG To get linear plasmid pBBRN-His6 with pBBR-R
Primer-14-F ATGCATCACCATCACCATCACGTGAAGCCTGATAGTTTCGC To construct plasmid pBBR-cotA1HisA2A3 with primer-2-R
Primer-15-F CAACATCACCATCACCATCACATGACTGGGGACCAGGACATG To overlap extension with linear cotA2HiscotA3 and to construct plasmid pBBR-cotA1A2HisA3
Primer-16-F CGCGCCAGCAACGCCCTGCTCGCATCCCACGTGCGTTC To construct plasmid pBBR-cotA1cotA2C51AcotA3
Primer-16-R GGCGTTGCTGGCGCGTGCACCGTTGTCATCGACGAGAAG
Open in a new tab
a

6×His tag sites are underlined, and mutation sites are in bold.

Cell-free extract preparation and the detection of enzyme activity of CotA1A2A3.

Cotinine hydroxylase assays were performed using cell extracts of HZN7/pBBR-cotA1A2A3. Resting cells of HZN7/pBBR-cotA1A2A3 were added into MSM containing 100 mg/liter cotinine. After 12 h of incubation, the cells were collected by centrifugation at 12,000 rpm for 3 min and resuspended in 15 ml phosphate-buffered saline (PBS; 50 mM, pH 7.0). The cells were then disrupted by sonication (Ultrasonic Cell Crusher XO-900D) for 2 s, with 3-s intervals, in an ice bath. The disrupted cell suspensions were centrifuged at 12,000 rpm at 4°C for 30 min. The supernatant was used as the cell extract for the cotinine hydroxylase activity assay. The cell extracts of strain HZN7/pBBR1MCS-2 grown in MSM containing 100 mg/liter cotinine were prepared as a negative control. Total protein concentrations were determined using the Bradford method (41). The cotinine hydroxylase reaction mixture consisted of 100 μg cell extract, 50 mg/liter cotinine, 0.1 mM 2,6-dichlorophenolindophenol (DCIP), and 50 mM PBS (pH 7.0). The reaction was started by the addition of DCIP. Cotinine hydroxylase activity was measured by a decrease in absorbance at 600 nm of DCIP (ε = 21 mM−1 cm−1). The product 6HC was confirmed via UHPLC-MS/MS analysis as described below. One unit of activity was defined as the amount enzyme that catalyzed the reduction of 1 μmol DCIP per min. Specific activity was expressed as units per microgram of protein.

Expression and purification of His-tagged CotA and its mutation.

The cotA gene was amplified from JQ2195 genomic DNA by PCR, using the primers shown in Table 3. The plasmid (pBBR1MCS-2) was linearized by PCR using corresponding primers (Table 3) and digested with DpnI to eliminate template contamination. PCR products were purified and fused using a ClonExpress MultiS one-step cloning kit (Vazyme Biotech Co. Ltd., Nanjing, China).

Recombinant plasmids were verified by DNA and introduced into Shinella sp. strain HZN7 using the above-described method to generate six strains containing the cotA gene with His tag (Table 2). The resting cells of HZN7 carrying different pBBR-cotAHis plasmids (final OD600 of 4.0) were induced at 30°C with 100 mg/liter cotinine for 12 h. The above-described method was then used to harvest, wash, and rupture the cells. The cell extracts used for recombinant protein purification were loaded onto a Ni-nitrilotriacetic acid (Ni-NTA)–agarose column (Sangon, Shanghai, China). The column (2 ml) was washed with 20 ml PBS (50 mM, pH 7.4) and 4 ml of 10 mM, 50 mM, and 100 mM imidazole dissolved in PBS (50 mM, pH 7.4). Partially purified CotAHis was eluted using 150 mM imidazole, and then the partial purified CotAHis (150 mM imidazole, 2 ml) was reloaded onto the Ni-NTA agarose column for the second purification. The primary and secondary partially purified proteins were dialyzed in PBS (50 mM, pH 7.4) overnight to remove imidazole and Ni2+ and then analyzed using 12.5% SDS-PAGE. The partially purified protein concentrations were determined using the Bradford method (41). Partial purified CotAHis activity was measured at 600 nm using a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan). The reaction mixture consisted of 200 μg total partially purified protein. The activity of partially purified proteins CotA1His, CotA2His, and CotA3His was measured by a mixture (1:1:1, wt/wt/wt) of 50 mg/liter cotinine, 0.1 mM DCIP, and 50 mM PBS (pH 7.0). The reaction was started by the addition of DCIP. The activities of the partial purified protein were detected as described above. The reactions were terminated by boiling for 10 min and removed by centrifugation at 12,000 rpm for 10 min, and the supernatant was filtered with a 0.22-μm filter (Millipore, USA). All the enzyme activities were measured at 25°C. The products of enzyme catalytic reactions were further determined by HPLC.

The cotA gene carrying a site-directed mutation was amplified from pBBR-cotA1A2A3 by overlap extension PCR using the following primers: primer-2-F/primer-16-F, primer-16-R/primer-2-R, and primer-2-F/primer-2-R (Table 3). The biotransformation of cotinine in mutant HZN7 and the activity of the mutant cell extract were detected as described above.

H218O isotope and O2 dependence experiment.

To verify the incorporation of the oxygen atom from a water molecule, H218O (purity, 97%) was added to the reaction mixture at 50% (vol/vol). The reaction mixture contained 50 mg/liter cotinine, 0.1 mM DCIP, 200 μg partial purified protein, and 50 mM PBS buffer. The reaction was initiated with the addition of 0.1 mM DCIP. The samples were boiled for 10 min, and the supernatants were filtered through a 0.22-μm membrane (Millipore, USA). The products were analyzed by electrospray ionization-mass spectrometry (ESI-MS). A reaction performed in H2O was used as the control.

High-purity nitrogen gas (99.999% N2) was pumped into the partially purified protein for 20 min at 0°C to eliminate oxygen. The reaction buffer contained 50 mg/liter cotinine and 0.1 mM DCIP in 50 mM PBS buffer, or just 50 mg/liter cotinine in 50 mM PBS buffer, and was filled into high-purity nitrogen gas for 20 min at 25°C. The reaction was initiated with the addition of the partially purified protein in the anaerobic chamber (95% N2 and 5% H2) at 30°C for 10 min. Reactions e and f (Fig. 4C) were first reacted under anaerobic conditions for 10 min and then were reexposed with O2. The reactions e and f continuously reacted under aerobic conditions for 10 min. Samples were performed as described above, and the products were analyzed by HPLC as before.

Sequence analysis of CotA.

Searches of the nonredundant protein sequence database were performed using BLAST. Multiple-sequence alignment was performed by ClustalW. The phylogenetic tree was constructed using MEGA 6.0.

Analytical methods.

To determine the presence of cotinine and its metabolites, supernatants were analyzed by UV-visible (UV-Vis) spectrophotometry (UV-2450; Shimadzu, Japan). Spectral data were collected at wavelengths from 200 to 400 nm, with an absorption maximum at 260 nm for cotinine. The supernatant then was filtered through a 0.22-μm membrane (Millipore, USA). Cotinine and its metabolites were analyzed using a Thermo UltiMate 3000 titanium system HPLC with a C18 reversed-phase column (5 μm, 4.60 mm by 250 mm) (Thermo Fisher Scientific, MA, USA). The detection wavelength was set to 260 nm (cotinine) and 290 nm (6HC). The mobile phase was a mixture of methanol-water-formic acid (125:875:1, vol/vol/vol) with a flow rate of 1.0 ml/min and a column temperature of 30°C.

UHPLC-MS/MS analysis was performed on an LC-20AD high-performance liquid chromatograph (Shimadzu, Japan) with a Phenomenex Kinetex C18 column (2.6 μm, 2.1 mm by 100 mm). The mobile phase consisted of acetonitrile-water-formic acid (120:880:1, vol/vol/vol) at a flow rate of 0.3 ml/min. The column temperature was maintained at 40°C with an injection volume of 10 μl. Mass spectral data were collected using a TripleTOF 5600-1 (AB SCIEX, Shimadzu, Japan) mass spectrometer. The mass spectral data acquisition mode was a high-resolution spatial time-of-flight mass spectrometry full scan and simultaneous trigger acquisition high-resolution secondary mass spectrometry (TOF-MS IDA MS-MS). The TOF-MS scanning range was 100 m/z to ∼800 m/z, and the IDA MS-MS scanning range was 50 m/z to ∼800 m/z. The ion spray voltage was 5.5 kV, and the ion source temperature was 550°C.

Data availability.

The complete genome sequences of Nocardioides sp. strain JQ2195 and the plasmid were deposited in GenBank under accession numbers CP050902 and CP050903, respectively.

The data supporting transcriptomics are available in the NCBI Sequence Read Archive (SRA) under accession numbers SAMN15356049, SAMN15356050, and SAMN15356051 for glucose-cultured cells and SAMN15356052, SAMN15356053, and SAMN15356054 for cotinine-cultured cells.

ACKNOWLEDGMENTS

The study was financially supported by the National Natural Science Foundation of China (no. 31870092, 32070092, and 31970096).

We have no competing financial interest to declare.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Fig. S1 and S2, Tables S1 to S3. Download AEM.00923-21-s0001.pdf, PDF file, 1.0 MB (1MB, pdf)
Supplemental file 2
Tables S4 to S9. Download AEM.00923-21-s0002.xlsx, XLSX file, 1.6 MB (1.6MB, xlsx)

Contributor Information

Jiguo Qiu, Email: qiujiguo@njau.edu.cn.

Alfons J. M. Stams, Wageningen University

REFERENCES

  • 1.Lian L, Yan S, Yao B, Chan SA, Song W. 2017. Photochemical transformation of nicotine in wastewater effluent. Environ Sci Technol 51:11718–11730. 10.1021/acs.est.7b03223. [DOI] [PubMed] [Google Scholar]
  • 2.Loefroth G, Burton RM, Forehand L, Hammond SK, Seila RL, Zweidinger RB, Lewtas J. 1989. Characterization of environmental tobacco smoke. Environ Sci Technol 23:610–614. 10.1021/es00063a015. [DOI] [Google Scholar]
  • 3.Hukkanen J, Jacob P, Benowitz NL. 2005. Metabolism and disposition kinetics of nicotine. Pharmacol Rev 57:79–115. 10.1124/pr.57.1.3. [DOI] [PubMed] [Google Scholar]
  • 4.Delgado G, Siekmeier R, Krämer BK, März W, Kleber ME. 2015. Cotinine as a marker for risk prediction in the ludwigshafen risk and cardiovascular health study. Respir Physiol Neurobiol 209:17–22. 10.1016/j.resp.2014.10.008. [DOI] [PubMed] [Google Scholar]
  • 5.Buerge IJ, Kahle M, Buser HR, Müller MD, Poiger T. 2008. Nicotine derivatives in wastewater and surface waters: application as chemical markers for domestic wastewater. Environ Sci Technol 42:6354–6360. 10.1021/es800455q. [DOI] [PubMed] [Google Scholar]
  • 6.Destaillats H, Singer BC, Lee SK, Gundel LA. 2006. Effect of ozone on nicotine desorption from model surfaces: evidence for heterogeneous chemistry. Environ Sci Technol 40:1799–1805. 10.1021/es050914r. [DOI] [PubMed] [Google Scholar]
  • 7.Gao J, Li J, Jiang G, Yuan Z, Eaglesham G, Covaci A, Mueller JF, Thai PK. 2018. Stability of alcohol and tobacco consumption biomarkers in a real rising main sewer. Water Res 138:19–26. 10.1016/j.watres.2018.03.036. [DOI] [PubMed] [Google Scholar]
  • 8.Qiu J, Zhang Y, Zhao L, He Q, Jiang J, Hong Q, He J. 2018. Isolation and characterization of the cotinine-degrading bacterium Nocardioides sp. strain JQ2195. J Hazard Mater 353:158–165. 10.1016/j.jhazmat.2018.04.003. [DOI] [PubMed] [Google Scholar]
  • 9.Hammouda SB, Salazar C, Zhao F, Ramasamy DL, Laklova E, Iftekhar S, Babu I, Sillanpää M. 2019. Efficient heterogeneous electro-fenton incineration of a contaminant of emergent concern-cotinine- in aqueous medium using the magnetic double perovskite oxide sr2fecuo6 as a highly stable catalayst: degradation kinetics and oxidation products. Appl Catal B Environ 240:201–214. 10.1016/j.apcatb.2018.09.002. [DOI] [Google Scholar]
  • 10.Schaider LA, Rodgers KM, Rudel RA. 2017. Review of organic wastewater compound concentrations and removal in onsite wastewater treatment systems. Environ Sci Technol 51:7304–7317. 10.1021/acs.est.6b04778. [DOI] [PubMed] [Google Scholar]
  • 11.Yao B, Lian L, Pang W, Yin D, Chan S, Song W. 2016. Determination of illicit drugs in aqueous environmental samples by online solid-phase extraction coupled to liquid chromatography-tandem mass spectrometry. Chemosphere 160:208–215. 10.1016/j.chemosphere.2016.06.092. [DOI] [PubMed] [Google Scholar]
  • 12.Chen J, Venkatesan A, Halden RU. 2019. Alcohol and nicotine consumption trends in three U.S. communities determined by wastewater-based epidemiology. Sci Total Environ 656:174–183. 10.1016/j.scitotenv.2018.11.350. [DOI] [PubMed] [Google Scholar]
  • 13.Gagné F, Blaise C, Fournier M, Hansen PD. 2006. Effects of selected pharmaceutical products on phagocytic activity in Elliptio complanata mussels. Comp Biochem Physiol C Toxicol Pharmacol 143:179–186. 10.1016/j.cbpc.2006.01.008. [DOI] [PubMed] [Google Scholar]
  • 14.Gagne F, Blaise C, Andre C. 2006. Occurrence of pharmaceutical products in a municipal effluent and toxicity to rainbow trout (Oncorhynchus mykiss) hepatocytes. Ecotoxicol Environ Saf 64:329–336. 10.1016/j.ecoenv.2005.04.004. [DOI] [PubMed] [Google Scholar]
  • 15.Dawson DA, Fort DJ, Smith GJ, Newell DL, Bantle JA. 1988. Evaluation of the developmental toxicity of nicotine and cotinine with frog embryo teratogenesis assay: Xenopus. Teratog Carcinog Mutagen 8:329–338. 10.1002/tcm.1770080603. [DOI] [PubMed] [Google Scholar]
  • 16.Jacob T, Clouden N, Hingorani A, Ascher E. 2009. The effect of cotinine on telomerase activity in human vascular smooth muscle cells. J Cardiovasc Surg 50:345–349. [PubMed] [Google Scholar]
  • 17.Carty CS, Huribal M, Marsan BU, Ricotta JJ, Dryjski M. 1997. Nicotine and its metabolite cotinine are mitogenic for human vascular smooth muscle cells. J Vasc Surg 25:682–688. 10.1016/S0741-5214(97)70295-7. [DOI] [PubMed] [Google Scholar]
  • 18.Bastianini S, Martire VL, Silvani A, Zoccoli G, Berteotti C, Lagercrantz H, Arner A, Cohen G. 2018. Long-term cardiovascular reprogramming by short-term perinatal exposure to nicotine's main metabolite cotinine. Acta Paediatr 107:638–646. 10.1111/apa.14181. [DOI] [PubMed] [Google Scholar]
  • 19.Whincup PH, Gilg JA, Emberson JR, Jarvis MJ, Feyerabend C, Bryant A, Walker M, Cook DG. 2004. Passive smoking and risk of coronary heart disease and stroke: prospective study with cotinine measurement. BMJ 329:200–205. 10.1136/bmj.38146.427188.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Suzuki S, Cohen SM, Arnold LL, Pennington KL, Kato H, Naiki T, Naiki-Ito A, Yamashita Y, Takahashi S. 2020. Cotinine, a major nicotine metabolite, induces cell proliferation on urothelium in vitro and in vivo. Toxicology 429:152325. 10.1016/j.tox.2019.152325. [DOI] [PubMed] [Google Scholar]
  • 21.Mu Y, Chen Q, Parales RE, Lu Z, Hong Q, He J, Qiu J, Jiang J. 2020. Bacterial catabolism of nicotine: catabolic strains, pathways and modules. Environ Res 183:109258. 10.1016/j.envres.2020.109258. [DOI] [PubMed] [Google Scholar]
  • 22.Medana C, Santoro V, Bello FD, Sala C, Pazzi M, Sarro M, Calza P. 2016. Mass spectrometric fragmentation and photocatalytic transformation of nicotine and cotinine. Rapid Commun Mass Spectrom 30:2617–2627. 10.1002/rcm.7758. [DOI] [PubMed] [Google Scholar]
  • 23.Klamerth N, Malato S, Maldonado MI, Agüera A, Fernández-Alba AR. 2010. Application of photo-fenton as a tertiary treatment of emerging contaminants in municipal wastewater. Environ Sci Technol 44:1792–1798. 10.1021/es903455p. [DOI] [PubMed] [Google Scholar]
  • 24.Rivas FJ, Solis RR, Beltran FJ, Gimeno O. 2019. Sunlight driven photolytic ozonation as an advanced oxidation process in the oxidation of bezafibrate, cotinine and iopamidol. Water Res 151:226–242. 10.1016/j.watres.2018.12.013. [DOI] [PubMed] [Google Scholar]
  • 25.Bradley PM, Barber LB, Kolpin DW, Mcmahon PB, Chapelle FH. 2007. Biotransformation of caffeine, cotinine, and nicotine in stream sediments: implications for use as wastewater indicators. Environ Toxicol Chem 26:1116–1121. 10.1897/06-483r.1. [DOI] [PubMed] [Google Scholar]
  • 26.Baitsch D, Sandu C, Brandsch R, Igloi GL. 2001. Gene cluster on pAO1 of Arthrobacter nicotinovorans involved in degradation of the plant alkaloid nicotine: cloning, purification, and characterization of 2,6-dihydroxypyridine 3-hydroxylase. J Bacteriol 183:5262–5267. 10.1128/JB.183.18.5262-5267.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mihasan M, Chiribau CB, Friedrich T, Artenie V, Brandsch R. 2007. An NAD(P)H-nicotine blue oxidoreductase is part of the nicotine regulon and may protect Arthrobacter nicotinovorans from oxidative stress during nicotine catabolism. Appl Environ Microbiol 73:2479–2485. 10.1128/AEM.02668-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. 10.1016/0378-1119(95)00584-1. [DOI] [PubMed] [Google Scholar]
  • 29.Jimenez JI, Canales A, Jimenez-Barbero J, Ginalski K, Rychlewski L, Garcia JL, Diaz E. 2008. Deciphering the genetic determinants for aerobic nicotinic acid degradation: the nic cluster from Pseudomonas putida KT2440. Proc Natl Acad Sci U S A 105:11329–11334. 10.1073/pnas.0802273105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Qiu J, Zhao L, Xu S, Chen Q, Chen L, Liu B, Hong Q, Lu Z, He J. 2019. Identification and characterization of a novel pic gene cluster responsible for picolinic acid degradation in Alcaligenes faecalis JQ135. J Bacteriol 201:e00077-19. 10.1128/JB.00077-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ma Y, Wei Y, Qiu J, Wen R, Hong J, Liu W. 2014. Isolation, transposon mutagenesis, and characterization of the novel nicotine-degrading strain Shinella sp. HZN7. Appl Microbiol Biotechnol 98:2625–2636. 10.1007/s00253-013-5207-0. [DOI] [PubMed] [Google Scholar]
  • 32.Yu H, Tang H, Li Y, Xu P. 2015. Molybdenum-containing nicotine hydroxylase genes in a nicotine degradation pathway that is a variant of the pyridine and pyrrolidine pathways. Appl Environ Microbiol 81:8330–8338. 10.1128/AEM.02253-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hille R. 2005. Molybdenum-containing hydroxylases. Arch Biochem Biophys 433:107–116. 10.1016/j.abb.2004.08.012. [DOI] [PubMed] [Google Scholar]
  • 34.Dulchavsky M, Clark CT, Bardwell JCA, Stull F. 2021. A cytochrome c is the natural electron acceptor for nicotine oxidoreductase. Nat Chem Biol 17:344–350. 10.1038/s41589-020-00712-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Brandsch R. 2006. Microbiology and biochemistry of nicotine degradation. Appl Microbiol Biotechnol 69:493–498. 10.1007/s00253-005-0226-0. [DOI] [PubMed] [Google Scholar]
  • 36.Ganas P, Sachelaru P, Mihasan M, Igloi GL, Brandsch R. 2008. Two closely related pathways of nicotine catabolism in Arthrobacter nicotinovorans and Nocardioides sp. strain JS614. Arch Microbiol 189:511–517. 10.1007/s00203-007-0340-8. [DOI] [PubMed] [Google Scholar]
  • 37.Schenk S, Hoelz A, Krauss B, Decker K. 1998. Gene structures and properties of enzymes of the plasmid-encoded nicotine catabolism of Arthrobacter nicotinovorans. J Mol Biol 284:1323–1339. 10.1006/jmbi.1998.2227. [DOI] [PubMed] [Google Scholar]
  • 38.Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. 2010. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res 38:1767–1771. 10.1093/nar/gkp1137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kim D, Langmead B, Salzberg SL. 2015. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12:357–360. 10.1038/nmeth.3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Li B, Dewey CN. 2011. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12:323–323. 10.1186/1471-2105-12-323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. 10.1006/abio.1976.9999. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Fig. S1 and S2, Tables S1 to S3. Download AEM.00923-21-s0001.pdf, PDF file, 1.0 MB (1MB, pdf)

Supplemental file 2

Tables S4 to S9. Download AEM.00923-21-s0002.xlsx, XLSX file, 1.6 MB (1.6MB, xlsx)

Data Availability Statement

The complete genome sequences of Nocardioides sp. strain JQ2195 and the plasmid were deposited in GenBank under accession numbers CP050902 and CP050903, respectively.

The data supporting transcriptomics are available in the NCBI Sequence Read Archive (SRA) under accession numbers SAMN15356049, SAMN15356050, and SAMN15356051 for glucose-cultured cells and SAMN15356052, SAMN15356053, and SAMN15356054 for cotinine-cultured cells.

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES