Abstract
Tumor necrosis factor receptor-1 (TNFR1) signaling, apart from its pleiotropic functions in inflammation, plays a role in embryogenesis as deficiency of varieties of its downstream molecules leads to embryonic lethality in mice. Caspase-8 noncleavable receptor interacting serine/threonine kinase 1 (RIPK1) mutations occur naturally in humans, and the corresponding D325A mutation in murine RIPK1 leads to death at early midgestation. It is known that both the demise of Ripk1D325A/D325A embryos and the death of Casp8−/− mice are initiated by TNFR1, but they are mediated by apoptosis and necroptosis, respectively. Here, we show that the defects in Ripk1D325A/D325A embryos occur at embryonic day 10.5 (E10.5), earlier than that caused by Casp8 knockout. By analyzing a series of genetically mutated mice, we elucidated a mechanism that leads to the lethality of Ripk1D325A/D325A embryos and compared it with that underlies Casp8 deletion-mediated lethality. We revealed that the apoptosis in Ripk1D325A/D325A embryos requires a scaffold function of RIPK3 and enzymatically active caspase-8. Unexpectedly, caspase-1 and caspase-11 are downstream of activated caspase-8, and concurrent depletion of Casp1 and Casp11 postpones the E10.5 lethality to embryonic day 13.5 (E13.5). Moreover, caspase-3 is an executioner of apoptosis at E10.5 in Ripk1D325A/D325A mice as its deletion extends life of Ripk1D325A/D325A mice to embryonic day 11.5 (E11.5). Hence, an unexpected death pathway of TNFR1 controls RIPK1 D325A mutation-induced lethality at E10.5.
A study of mice expressing a caspase-8 non-cleavable RIPK1 mutant during embryonic development reveals an unexpected TNFR1-triggered death pathway involving RIPK3, caspase-8, and caspases -1, -11 and -3.
Introduction
Tumor necrosis factor (TNF) is a pleiotropic cytokine, which, via its receptor TNF receptor-1 (TNFR1), triggers a variety of cellular responses. Its best-studied function in vivo is mediation of inflammatory diseases such as rheumatoid arthritis, inflammatory bowel disease (Crohn disease and ulcerative colitis), and psoriasis. Actually, TNF–TNFR1 signaling also plays a role in embryonic development. Although neither TNF nor TNFR1 is required for embryonic development in mice [1,2], TNFR1 signaling could eliminate defective embryos at different developmental stages. Tnfr1 knockout rescues or delays developmental defects caused by deficiency of its downstream effectors such as receptor interacting serine/threonine kinase 1 (RIPK1), caspase-8, CASP8 and FADD-like apoptosis regulator (cFLIP), FAS-associated death domain protein (FADD), ring finger protein 31 (HOIP), RanBP-type and C3HC4-type zinc finger-containing protein 1 (HOIL-1), TANK-binding kinase 1 (TBK1), RelA/p65, cellular inhibitor of apoptosis protein 1 and 2 (cIAP1 and 2), and inhibitor of nuclear factor kappa-B kinase subunit beta (IKKβ) [3–12]. During development at around embryonic day 10.5 (E10.5), mice seem to become sensitive to perturbation of TNFR1 signaling, and lethality at this stage of development has been observed in many mouse models with genetic defects in this pathway such as Tak1−/−, cIap1−/− cIap2−/−, Hoip−/−, and Hoil-1−/− [6,10,11,13,14]. The level of involvement of TNFR1 signaling at different developmental stages may differ. For example, deletion of Tnfr1 rescues embryonic lethality of Ripk1D325A/D325A mice and allows the mice to survive to around postnatal day 10 (P10), whereas Tnfr1−/− only delayed the lethality of Hoip−/− or Hoil-1−/− embryos to embryonic day 16.5 (E16.5) [6,11,15].
RIPK1 is a protein kinase that plays a key role in regulating TNFR1 signaling pathways. Its recruitment to TNFR1 and ubiquitination allow for assembly of a mitogen-activated protein kinase/nuclear factor-kappa B (MAPK/NF-κB)-activating complex. On the other hand, kinase active RIPK1 can autophosphorylate and interact with RIPK3 and FADD. FADD links RIPK1 to caspase-8, the activation of which can initiate a caspase cascade. Downstream executioner caspases such as caspase-3 are the key effectors of the apoptotic cell death pathway. If, however, caspase-8 activity is inhibited and cellular RIPK3 amount is sufficient, RIPK1 recruits RIPK3 via its RIP homotypic interaction motif (RHIM), thus promoting activation of RIPK3, which, in turn, recruits and phosphorylates mixed lineage kinase domain-like (MLKL). Phosphorylated MLKL then oligomerizes and translocates to the plasma membrane, causing plasma membrane rupture and necroptotic cell death [16,17], which might lead to necroinflammation in vivo [18–20]. Caspase-8 is an aspartate-specific cysteine protease, which can either exert function via its catalytic activity or as a scaffold for complex assembly and signaling transduction. Casp8−/− mice die at midgestation [21]. Mice carrying catalytically inactive caspase-8 (C362A or C362S mutation) also exhibit embryonic lethality reminiscent of Casp8−/− mice [15,22]. Caspase-8 catalytic activity is therefore essential for normal embryogenesis, and the underlying mechanism is its inhibition of RIPK1–RIPK3-mediated necroptosis [5,15,22–27]. RIPK1 is a substrate of caspase-8, and noncleavable mutations of RIPK1 occur naturally in humans. Single allele of such mutation causes an early-onset periodic fever syndrome and severe intermittent lymphadenopathy [28,29]. The cleavage site in murine RIPK1 locates at residue D325 [30], and Ripk1D325A/D325A mice die at an early midgestation day [15,28,31]. Perhaps due to differences in laboratory settings, the lethality was reported to take place at E10.5, E10.5 to 11.5, and embryonic day 12.5 (E12.5), respectively, by different groups [15,28,31]. The death of Ripk1D325A/D325A embryos at this early midgestation day can be prevented by loss of Tnfr1, RIPK1 kinase activity, or Ripk3, although the double mutant mice still died later on [15,28,31], seemingly suggesting that the defects of Ripk1D325A/D325A mice at early midgestation are due to not being able to be cleaved by caspase-8 and that caspase-8 cleavage of RIPK1 inhibits TNFR1–RIPK3-mediated RIPK1 kinase activity-dependent cell death at early midgestation of embryonic development.
Caspase-1 and caspase-11 are inflammatory caspases well studied for their roles in inflammasome activation and are required for IL-1β and IL-18 processing and maturation and for pyroptosis in response to pathogen patterns and endogenous danger stimuli. While there is a large amount of evidence obtained by using genetic knockout mice showing that caspase-1 and/or caspase-11 are indispensable in host responses against certain microbial pathogens [32–35] and in driving sterile inflammation [36–38], mice deficient in Casp1, Casp11, or both Casp1 and Casp11 are developmentally normal, and knowledge on their functions in other biological processes besides inflammation is limited. Their functions in embryonic development are unknown.
Here, with genetic evidence, we show that the effect of caspase-8 noncleavable RIPK1 mutation does not mimic that of Casp8 deletion. This mutation arouses death signaling at E10.5, which is earlier than that caused by Casp8 deletion at embryonic day 11.5 (E11.5). TNFR1 is required for the initiation of both death processes, but RIPK1(D325A)-mediated E10.5 lethality is resulted from RIPK3- and caspase-8–dependent apoptosis, whereas Casp8 knockout-mediated embryonic death is caused by necroptosis. Furthermore, caspase-1 and caspase-11 are found, for the first time to our knowledge, to function during embryogenesis, downstream of caspase-8, leading to caspase-3-dependent apoptosis at E10.5. The death pathway activated by RIPK1 D325A at E10.5 comprises signaling molecules that are known to participate in necroptosis, extrinsic apoptosis, or pyroptosis, making it unique compared to the known signaling pathways of cell death. TNFR1 thus could initiate different death pathways at different embryonic days to eliminate defective embryos caused by distinct genetic errors.
Results
The embryonic lethality caused by D325A mutation in Ripk1 occurs earlier than that triggered by Casp8 knockout in mice
Published studies showed that the D325A mutation in murine Ripk1, which resembles naturally occurring D324 to V, H, N, or Y mutation in humans, resists caspase-8 cleavage and leads to embryonic lethality in mice [15,28,29,31]. An interpretation for this phenomenon is that D325A mutation prevents caspase-8–mediated cleavage of RIPK1 and thus mimics the effect of Casp8 knockout, i.e., promoting RIPK1–RIPK3 necrosome-mediated necroptosis in mouse embryos [31]. But excessive cleaved caspase-3 observed in Ripk1D325A/D325A embryos by previous work challenged this interpretation [15,28], indicating an involvement of apoptosis. The observation by previous studies that Mlkl deletion fails to rescue the lethality of Ripk1D325A/D325A mice while concomitant loss of Mlkl plus Fadd can do further supports the role of apoptosis in the lethality of Ripk1D325A/D325A mice [15,28]. Because deletion of Mlkl did not have any survival benefit on Ripk1D325A/D325A embryos whereas deletion of Ripk3 delayed death of Ripk1D325A/D325A embryos to E16.5 [15,28,31], a necroptosis-independent function of RIPK3 should play a role in E10.5 lethality of Ripk1D325A/D325A mice [15,28]. We had also generated Ripk1D325A/D325A and Casp8−/− mice and analyzed these mice in our laboratory (S1A Fig). Similar to published results [21], Casp8−/− embryos appeared normal at E10.5, the majority of the embryos showed less and thinner yolk sac vessels and signs of hyperemia in the abdominal area at E11.5, and all of them displayed defective yolk sac vascularization and dead embryo proper at E12.5 (Fig 1A and 1B). Different from Casp8−/− embryos, the onset of defects in Ripk1D325A/D325A embryos was significantly earlier, and they were more severe (Fig 1A and 1B). Timed mating analysis revealed that all of Ripk1D325A/D325A progeny exhibited yolk sac vascularization defects at E10.5, approximately 1 to 2 days earlier than Casp8−/− embryos, and displayed severe abdominal hemorrhage in the embryo proper, while Casp8−/− embryos just started to show defects at E11.5. All D325A homozygous embryos were resorbed at E12.5 and could not be detected after this developmental stage (Fig 1B). Furthermore, Ripk1D325A/− offspring from crosses of Ripk1D325A/+ and Ripk1+/− parents were normal at E10.5 and died perinatally between embryonic day 17.5 (E17.5) and postnatal day 1 (P1), a phenotype resembling that of Ripk1−/− mice [5,25,26,39], indicating a dose effect of RIPK1 D325A mutation (S1B–S1D Fig). The above data, together with the published results that Mlkl deletion can rescue the lethality of Casp8−/− mice but not that of Ripk1D325A/D325A mice [15,28], indicate that the mechanism causing the lethality of Ripk1D325A/D325A mice is different from that of Casp8−/− mice.
Fig 1. The embryonic lethality caused by D325A mutation in Ripk1 occurs earlier than that triggered by Casp8 knockout in mice.
(A) Genetic analysis of offspring from intercrosses of Casp8+/− and Ripk1D325A/+ parents, respectively. *: less and thinner YS vessels and signs of hyperemia in the abdominal area in E11.5 embryos; **: severe YS vascularization defect and dead EP in E12.5 embryos; #: defective vascularization in E10.5 YS and normal EP; ##: no vessels in E11.5 YS and severe abdominal hemorrhage in the EP; ###: dead and resorbed embryos at E12.5. (B) Representative images of E10.5, E11.5, and E12.5 embryos described in (A). Scale bars, 1 mm. See also S1 Fig. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E12.5, embryonic day 12.5; EP, embryo proper; Ripk1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
Defect of Ripk1D325A/D325A mice at E10.5 is mediated by TNFR1–RIPK3–caspase-8 signaling axis
Lethality of Casp8−/− embryos at E11.5 appears to be driven by TNFR1-mediated necroptosis as it can be postponed by individual gene deletion of Tnfr1 or Ripk1 and can be fully rescued by loss of Ripk3 or Mlkl [5,23–27]. Similarly, lethality of Ripk1D325A/D325A mice at E10.5 can be rescued by Tnfr1−/− [15] to up to P10 (S2A and S2B Fig). But in sharp contrast to Casp8−/− mice, Mlkl deficiency failed to rescue the defects of Ripk1D325A/D325A embryos [15,28], and deletion of Ripk3 only delayed the death of Ripk1D325A/D325A mice to E16.5 [15,28,31] (S2C, S2D, S3B, and S3C Figs), indicating that although the death of both Casp8−/− and Ripk1D325A/D325A embryos is triggered by TNFR1, one undergoes RIPK3–MLKL-mediated necroptosis, while the other does not. Indeed, we cannot detect MLKL phosphorylation in Ripk1D325A/D325A yolk sacs by immunofluorescence (IF) staining (S2E Fig). In addition, published studies already identified cleaved caspase-3 in E10.5 Ripk1D325A/D325A embryos, indicating an apoptotic phenotype [15,28]. This suggests that the mechanism of TNFR1-mediated lethality of Ripk1D325A/D325A mice at E10.5 should differ from that of TNFR1-mediated E11.5 lethality of Casp8−/− mice.
Since the E10.5 defect of Ripk1D325A/D325A mice is not mediated by necroptosis and possibly by apoptosis, we examined Ripk1D325A/D325A Casp8−/− embryos and surprisingly found that while the Ripk1D325A/D325A littermates were defective in the yolk sac, Ripk1D325A/D325A Casp8−/− embryos were normal at E10.5, indicating the involvement of caspase-8 in the E10.5 lethality (Fig 2A and 2B). As expected, none of the Ripk1D325A/D325A Casp8−/− embryos were alive when they were analyzed at E12.5 (Fig 2A and 2B). Thus, the death of Ripk1D325A/D325A Casp8−/− embryos is likely due to the deficiency of Casp8. Indeed, the lethality of Ripk1D325A/D325A Casp8−/− embryos can be rescued by Mlkl−/− to adulthood, similar to Casp8−/− embryos (Fig 2C), and the resulting Ripk1D325A/D325A Casp8−/− Mlkl−/− mice exhibited similar lpr phenotypes (lymphadenopathy and splenomegaly) to those of Casp8−/− Mlkl−/− mice [27,40] (S3A Fig). Moreover, caspase-8 cleavage was observed in E10.5 Ripk1D325A/D325A yolk sacs by IF staining (Fig 2D). Collectively, our data indicated that E10.5 lethality of Ripk1D325A/D325A embryos requires caspase-8.
Fig 2. Defect of Ripk1D325A/D325A mice at E10.5 is mediated by TNFR1–RIPK3–caspase-8 signaling axis.
(A) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Casp8+/− mice. (B) Representative images of E10.5 and E12.5 embryos analyzed in (A). Scale bars, 1 mm. (C) Genetic analysis of offspring from intercrossing Ripk1D325A/+ Casp8−/− Mlkl−/− parents. (D) IF staining of E10.5 YS with anti-PECAM (red) and anti-Cl.CASP8 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. See also S2 and S3 Figs. Cl.CASP8, cleaved caspase-8; E10.5, embryonic day 10.5; E12.5, embryonic day 12.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; Ripk1, receptor interacting serine/threonine kinase 1; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
The rescue of Ripk1D325A/D325A embryos by Ripk3 deletion to either E12.5 or E16.5 was reported independently [28,31]. We could obtain normal E16.5 embryos with Ripk1D325A/D325ARipk3−/− genotype (S3B and S3C Fig). This rescue is unlikely resulted from blockade of necroptosis because loss of Mlkl had no effect on the lethality of Ripk1D325A/D325A embryos [15,28] (S2C and S2D Fig). Thus, the E10.5 lethality should be mediated by an MLKL-independent function of RIPK3. Since caspase-8 activation was revealed in Ripk1D325A/D325A yolk sacs but cannot be detected in both Ripk1D325A/D325A Tnfr1−/− and Ripk1D325A/D325A Ripk3−/− yolk sacs (Fig 2D), caspase-8 activation in Ripk1D325A/D325A embryos should be downstream of TNFR1 and RIPK3. Thus, the embryonic death of Ripk1D325A/D325A mice is triggered by a signaling from TNFR1 to RIPK3 and then caspase-8.
Enzymatic activity of caspase-8 and RIPK1 but not RIPK3 is required for E10.5 lethality of Ripk1D325A/D325A mice
Caspase-8 could either exert function via its catalytic activity or as a scaffold. To dissect its function of scaffold and protease activity, we generated homozygous Casp8C362S/C362S mice in which caspase-8 catalytic activity is completely lost. As reported earlier, Casp8C362S/C362S embryos phenocopied Casp8−/− embryos, which started to show defects at E11.5 and were all dead at E12.5 (S4A and S4B Fig), and Mlkl−/−postponed the death of Casp8C362S/C362S embryos to birth [15,22]. We crossed Ripk1D325A/+ mice onto the Casp8C362S/+ Mlkl−/− background and surprisingly found that the resulting Ripk1D325A/D325A Casp8C362S/C362S Mlkl−/− embryos were normal at E10.5, E12.5, and E16.5 (Fig 3A and 3B), demonstrating that catalytic activity of caspase-8 is required for the E10.5 lethality of Ripk1D325A/D325A mice. In addition to this genetic evidence, caspase-8 activation in E10.5 Ripk1D325A/D325A and Ripk1D325A/D325A Mlkl−/− yolk sacs was revealed by IF staining of cleaved caspase-8, but not in Ripk1D325A/D325A Casp8C362S/C362S Mlkl−/− yolk sacs (Figs 2D and 3C), suggesting that caspase-8 activation is mediated by its auto-processing.
Fig 3. Enzymatic activity of caspase-8 and RIPK1 but not RIPK3 is required for E10.5 lethality of Ripk1D325A/D325A mice.
(A) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Casp8C362S/+ Mlkl−/− parents. (B) Representative E10.5, E12.5, and E16.5 embryos collected in (A). Scale bars, 1 mm. (C) IF staining of E10.5 YS with anti-PECAM (red) and anti-Cl.CASP8 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. (D) Schematic diagram of the signaling transduction elucidated. See also S4 Fig. Cl.CASP8, cleaved caspase-8; E10.5, embryonic day 10.5; E12.5, embryonic day 12.5; E16.5, embryonic day 16.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; RIPK1, receptor interacting serine/threonine kinase 1; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
It is well known that RIPK1 can function as a kinase and/or a scaffold. Additional kinase inactivation mutation (Ripk1Δ/Δ) [41] of Ripk1 rescued embryonic death of Ripk1D325A/D325A mice to P8 (S4C Fig). Thus, as concluded by others [15,28], RIPK1 kinase activity is required for E10.5 lethality of Ripk1D325A/D325A mice.
RIPK3 likewise plays kinase and scaffold roles. RIPK3 activation is required for necroptosis and auto-phosphorylation on T231 and S232 of murine RIPK3 is a signature of RIPK3 activation [42]. We analyzed E10.5 Ripk1D325A/D325A yolk sacs by IF staining and found no RIPK3 auto-phosphorylation (S4D Fig), indicating that RIPK3 activation is not required for the E10.5 defects of Ripk1D325A/D325A mice. Since RIPK3 cannot interact with caspase-8 directly but can function as a scaffold to activate caspase-8 via interaction with RIPK1 in the presence of a RIPK3 inhibitor GSK-872 [43], RIPK3 here is most likely a scaffold of RIPK1. The idea that it is the scaffold rather than kinase activity of RIPK3 that determines the death of Ripk1D325A/D325A embryos has been proposed [15,28]. Our data support this notion (S2E and S4D Figs), although D325A mutation is known to promote RIPK3 activation and necroptosis in some cell-based systems and perhaps in other biological processes [15,28,44]. In summary, the E10.5 lethality of Ripk1D325A/D325A mice requires caspase-8 activity, RIPK1 kinase activity, and RIPK3 scaffold function (Fig 3D).
Concurrent deficiency of Casp1 and Casp11 is required for prevention of E10.5 lethality of Ripk1D325A/D325A mice
Recent publications suggest that there is crosstalk and sharing of signaling components among death pathways, such as caspase-8 and inflammasome components [45–56]. We were therefore curious whether inflammasome components also participate in Ripk1D325A/D325A lethality. Astonishingly, combined loss of Casp1 and Casp11 (Casp1+11−/−) rescued E10.5 defects of Ripk1D325A/D325A mice, although the mice still died later during embryogenesis (Figs 4A, 4B, and S5A). Ripk1D325A/D325A Casp1+11−/− embryos were normal at E11.5, started to display fewer blood vessels in the yolk sac at E13.5, and were all dead by E16.5 (Fig 4A and 4B). We then generated Casp1−/− mice and Casp11−/− mice (S5A Fig), respectively, to address the roles of caspase-1 and caspase-11. Timed mating analysis showed that neither Casp1−/− nor Casp11−/− can rescue the E10.5 defects of Ripk1D325A/D325A mice (Fig 4C–4F). Therefore, concomitant deletion of Casp1 and Casp11 is required for blocking E10.5 lethality of Ripk1D325A/D325A mice.
Fig 4. Concurrent deficiency of Casp1 and Casp11 is required for prevention of E10.5 lethality of Ripk1D325A/D325A mice.
(A) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Casp1+11−/− parents. ★: YS vascularization defect and normal EP. ★★: YS vascularization defect and smaller and paler EP. (B) Representative E11.5, E13.5, and E16.5 embryos obtained in (A). Scale bars, 1 mm. (C) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Casp1−/− parents. (D) Representative E10.5 and E11.5 embryos collected in (C). Scale bars, 1 mm. (E) Genetic analysis of progeny from intercrosses of Ripk1D325A/+ Casp11−/− mice. (F) Representative E10.5 embryos analyzed in (E). Scale bars, 1 mm. See also S5A Fig. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E13.5, embryonic day 13.5; E16.5, embryonic day 16.5; EP, embryo proper; Ripk1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
Caspase-8 is upstream of caspase-1 in the death pathway of Ripk1D325A/D325A mice at E10.5
We then sought to address the relationship between caspase-1, caspase-11, and the other known signaling components in the E10.5 lethality of Ripk1D325A/D325A mice. Since there is no suitable antibody to detect the activation of caspase-11, we only analyzed caspase-1 cleavage in E10.5 yolk sacs of wild-type (WT), Ripk1D325A/D325A, Ripk1D325A/D325A Tnfr1−/−, Ripk1D325A/D325A Ripk3−/−, and Ripk1D325A/D325A Casp8C362S/C362S Mlkl−/− embryos (Fig 5A and 5B). The yolk sacs of E10.5 Ripk1D325A/D325A embryos and Ripk1D325A/D325A Mlkl−/− embryos were stained positive for cleaved caspase-1, while there was no signal in the WT or Mlkl−/− control (Fig 5A and 5B). Genetic deletion of Tnfr1 or Ripk3, or C362S mutation of Casp8 all blocked caspase-1 activation (Fig 5A and 5B), whereas caspase-8 activation was easily detected in E10.5 yolk sacs of Ripk1D325A/D325A Casp1+11−/−, Ripk1D325A/D325A Casp1−/−, and Ripk1D325A/D325A Casp11−/− embryos (Fig 5C and 5D), indicating that caspase-1 is downstream of caspase-8. Since deficiencies of Casp1 and Casp11 are simultaneously required for prevention of E10.5 lethality of Ripk1D325A/D325A mice, caspase-1 and caspase-11 should function in parallel rather than up or downstream of each other. Provided the fact that caspase-1 is downstream of caspase-8, caspase-11 is likely to be the same. Therefore, we proposed that caspase-1 and caspase-11 were activated in parallel at the downstream of caspase-8 activation in E10.5 Ripk1D325A/D325A embryos (Fig 5E).
Fig 5. Caspase-8 is upstream of caspase-1 in the death pathway of Ripk1D325A/D325A mice at E10.5.
(A and B) IF staining of E10.5 YS with anti-PECAM (red) and anti-Cl.CASP1 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. (C and D) IF staining of E10.5 YS with anti-PECAM (red) and anti-Cl.CASP8 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. (E) Schematic diagram of the signaling transduction. See also S5B–S5G Fig. Cl.CASP1, cleaved caspase-1; Cl.CASP8, cleaved caspase-8; E10.5, embryonic day 10.5; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; RIPK1, receptor interacting serine/threonine kinase 1; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
The capability of caspase-8 to cleave caspase-1 and caspase-11 directly has been documented by in vitro experiments [57]. Due to the technical difficulty in obtaining a sufficient number of endothelial cells from the yolk sacs, we are unable to determine whether caspase-8 can directly activate caspase-1/11 in the yolk sacs. We isolated mouse embryonic fibroblasts (MEFs) and tried to address this issue using TNF-treated MEFs. As previously reported [15,28,31], TNF treatment led to a small amount of cell death in WT MEFs and much more death in Ripk1D325A/D325A MEFs (S5B Fig). Additional deletion of Casp1+11 did not bring any extra effect on TNF-induced cell death on a Ripk1D325A/D325A background (S5B Fig). We analyzed the expression level of proteins related to cell death in these TNF-treated MEFs by western blot and did not detect the expression of caspase-1 or caspase-11 in MEFs; thus, the involvement of caspase-1 and caspase-11 cannot be studied using MEFs (S5C Fig). We performed immunoprecipitation of TNFR1 complex and found increased recruitment of RIPK1 especially shifted RIPK1 in the receptor super complex when D325 was mutated to A (S5D Fig). The recruitment of TNFR1-associated death domain protein (TRADD), A20, and linear ubiquitin chain assembly complex (LUBAC) component SHANK-associated RH domain interacting protein (SHARPIN) was also increased in Ripk1D325A/D325A MEFs. The increase of TNFR1 complex formation may explain at least in part the increased sensitivity of D325A mutant MEFs to TNF-induced cell death. We then performed immunoprecipitation of RIPK1 to evaluate complex II formation. We did not detect coprecipitated FADD, caspase-8, or RIPK3 in TNF− or TNF + SMAC mimetic (TS)-treated WT and Ripk1D325A/D325A MEFs but detected FADD, caspase-8, and RIPK3 in the RIPK1 immunoprecipitates in TNF + SMAC mimetic + zVAD (TSZ)-treated cells (S5E–S5G Fig). D325A mutation did not enhance the formation of necrosome, i.e., RIPK1 immunoprecipitates in TSZ-treated MEFs (S5G Fig). It is possible that the formation of complex II was transient even in TS-treated MEFs, and only zVAD-preserved necrosome was detected in our experiments.
Neither intrinsic apoptosis nor pyroptosis is required for Ripk1D325A/D325A lethality
We then set out to seek for events downstream of caspase-1 and caspase-11. To our surprise, IF staining revealed caspase-9 cleavage in Ripk1D325A/D325A yolk sacs but not in Ripk1D325A/D325A Tnfr1−/−, Ripk1D325A/D325A Ripk3−/−, or Ripk1D325A/D325A Casp1+11−/− yolk sacs, suggesting a possible role of intrinsic apoptotic signaling in the death of Ripk1D325A/D325A mice (Fig 6A). Apoptotic protease activating factor 1 (Apaf-1) is the core component of apoptosome in the intrinsic pathway, the formation of which leads to caspase-9 activation and the subsequent caspase cascade. The majority of Apaf1−/− mice die perinatally, and only 5% of the homozygotes survive this period [58]. To find out the contribution of intrinsic apoptosis in Ripk1D325A/D325A lethality, Ripk1D325A/D325A Apaf1−/− mice were generated (S6A Fig). Surprisingly, although cleaved caspase-9 was detected in Ripk1D325A/D325A embryos, loss of Apaf1 was unable to rescue the E10.5 defects of Ripk1D325A/D325A mice (Fig 6B and 6C). Therefore, activation of the intrinsic apoptotic pathway is not required for the E10.5 lethality of Ripk1D325A/D325A mice.
Fig 6. Neither intrinsic apoptosis nor pyroptosis is required for Ripk1D325A/D325A lethality.
(A) IF staining of E10.5 YS with anti-PECAM (red) and anti-Cl.CASP9 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. (B) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Apaf1+/− parents. (C) Representative E10.5 embryos collected in (B). Scale bars, 1 mm. (D) Genetic analysis of offspring from intercrossing Ripk1D325A/+ Asc−/− parents. (E) Representative E10.5 embryos obtained in (D). Scale bars, 1 mm. (F) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Gsdmd−/− mice. (G) Representative E10.5 embryos collected in (F). Scale bars, 1 mm. See also S6A–S6C Fig. Cl.CASP9, cleaved caspase-9; E10.5, embryonic day 10.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; Ripk1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
Since caspase-1 and caspase-11 can activate GSDMD-mediated pyroptosis and the inflammasome adaptor apoptosis-associated speck-like protein containing a CARD (ASC) was reported to facilitate caspase-8–caspase-1 signaling [45,59], and caspase-8 can also cleave GSDMD under certain conditions [60–63], we wondered whether pyroptosis occurs in Ripk1D325A/D325A embryos. We crossed Ripk1D325A/+ mice onto the Asc−/− or Gsdmd−/− background and found the deletion of neither Asc nor Gsdmd rescued E10.5 lethality of Ripk1D325A/D325A mice (Fig 6D–6G). Accordingly, no ASC or GSDMD activation in E10.5 Ripk1D325A/D325A yolk sacs was detected (S6B Fig). We analyzed expression of the gasdermin family members in yolk sacs and did not detect the expression of GSDMD, GSDMA, GSDMC, or GSDME (DFNB59) (S6C Fig), suggesting that none of them is likely to play a role in E10.5 lethality of Ripk1D325A/D325A embryos. Taken together, these results suggest that neither the intrinsic apoptotic nor the pyroptotic pathway is required for E10.5 lethality of Ripk1D325A/D325A mice.
Caspase-3 participates in the E10.5 lethality of RIPK1 D325A mutant mice
As previously reported, caspase-3 cleavage was easily detected in the yolk sacs of Ripk1D325A/D325A embryos at embryonic day 9.5 (E9.5) and E10.5 (Figs 7A and S6D). Consistently, TUNEL assay also revealed strong signals early in E9.5 Ripk1D325A/D325A yolk sacs (S6D Fig), suggesting a role for caspase-3-dependent apoptosis. To test whether caspase-3 is the bona fide executioner here, we generated Casp3−/− mice (S6E Fig). The same as the Casp3 knockout mice described by the Jackson Laboratory, Casp3−/− female mice have intrinsic defects in reproductive system and suboptimal mothering instincts, resulting in a low success rate in timed mating. However, despite the difficulties in pregnancy, normal Ripk1D325A/D325A Casp3−/− embryos were obtained at E10.5, and vasculature defects started to appear at E11.5 (Fig 7B and 7C), demonstrating that caspase-3 plays a fundamental role in executing E10.5 RIPK1 D325A mutation-caused lethality. In accordance with this genetic evidence, IF staining showed caspase-3 cleavage in E10.5 yolk sacs of Ripk1D325A/D325A, Ripk1D325A/D325A Apaf1−/−, Ripk1D325A/D325A Casp1−/−, Ripk1D325A/D325A Casp11−/−, and Ripk1D325A/D325A Asc−/− embryos (Figs 7A and S6F). In addition, caspase-3 cleavage was largely alleviated by the deficiency of Tnfr1, RIPK1 kinase activity, Ripk3, Casp8, caspase-8 catalytic activity, or Casp1+11 (Fig 7A), indicating that caspase-3 is the downstream executor of the TNFR1-[RIPK1(D325A)-RIPK3-caspase-8]-caspase-1&caspase-11 death signaling at E10.5 in Ripk1D325A/D325A mice. Because caspase-8 is the activator of caspase-3 in apoptosis in many types of cells, we assessed the possibility of caspase-8 directly activating caspase-3 by evaluating the level of blockade of caspase-3 cleavage in Ripk1D325A/D325A Casp8−/− and Ripk1D325A/D325A Casp1+11−/− yolk sacs, respectively. By quantification of cells positive for cleaved caspase-3 staining, we found that there are almost no cleaved caspase-3-positive cells in Ripk1D325A/D325A Casp8−/− yolk sacs, while there is a dramatic reduction but not complete elimination of cleaved caspase-3-positive cells in Ripk1D325A/D325A Casp1+11−/− yolk sacs (Fig 7D). Thus, we propose that activation of caspase-3 in Ripk1D325A/D325A yolk sacs is mediated primarily by caspase-1+11 and that there is still a small amount of caspase-3 that is cleaved by caspase-8, but this small amount of cleaved caspase-3 is insufficient to trigger apoptosis (Fig 7E). Since Casp3 deletion only rescued Ripk1D325A/D325A mice by 1 day and the Ripk1D325A/D325A Casp3−/− embryos still died after E11.5, there might be other executioners compensating the loss of caspase-3. Other executioner caspases such as caspase-6 and caspase-7 might be activated later than caspase-3 in Ripk1D325A/D325A embryos, and it might be that the sum of their involvements determines the fate of the embryos.
Fig 7. Caspase-3 participates in the E10.5 lethality of RIPK1 D325A mutant mice.
(A) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-Cl.CASP3 (green) antibodies. Scale bars, 50 μm. Images are representative of 4 embryos per genotype. (B) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Casp3−/− parents. ♥: YS vascularization defects and smaller EP with hyperaemia. (C) Representative E10.5 and E11.5 embryos obtained in (B). Scale bars, 1 mm. (D) Quantitative analysis of YS cells positive for Cl.CASP3 immunostaining per scanning area. At least 6 areas were analyzed for each genotype. (E) Schematic diagram of the signaling pathway deciphered. Underlying data are available in S1 Data. See also S6D–S6F Fig. Cl.CASP3, cleaved caspase-3; E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; RIPK1, receptor interacting serine/threonine kinase 1; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
Discussion
Noncleavable variants of RIPK1 are detrimental in humans, and heterozygous mutations cause an early-onset periodic fever syndrome and severe intermittent lymphadenopathy [28,29]. Homozygous D325A mutation in murine RIPK1 leads to embryonic lethality [15,28,31]. Currently, there are no data on whether homozygous D324 mutations exist in humans or, if present, whether this mutation might cause embryonic lethality. Due to the presence of caspase-10 in humans but not in mice, whether the conclusions derived from murine studies are applicable to humans is unknown. It was reported that caspase-10 inhibits CD95L-induced cell death via impeding caspase-8 activation in death-inducing signaling complex (DISC) and meanwhile promotes CD95L-mediated NF-κB activation and gene induction [64]. Based on these findings, we would propose that the presence of caspase-10 in humans may cause the D324 mutation to drive inflammatory gene induction rather than cell death. This speculation is in line with the observations that patients carrying a D324 mutation had periodic fever syndrome and intermittent lymphadenopathy, overproduction of inflammatory cytokines and chemokines, splenomegaly, hepatomegaly, lymphocyte count/percentage increase, and/or monocyte percentage increase in PBMCs and that these patients responded to the IL-6 inhibitor tocilizumab but did not respond to TNF inhibitors [28,29]. In contrast, Ripk1D325A/+ mice were apparently normal in the absence of exogenous pathologic stresses [15,28,31] but were more sensitive to TNF-induced death [15]. The latter may be attributed in part to the lack of caspase-10 [64].
The earlier embryonic lethality of Ripk1D325A/D325A mice compared with Casp8−/− mice demonstrates that the effect of RIPK1 D325A mutation in vivo is not simply due to the loss of RIPK1 cleavage (Fig 1). By using genetic and other approaches, we further elucidated the molecular mechanisms underlying RIPK1 D325A-caused E10.5 lethality. In combination with published data [15,28], a previously unanticipated death signaling mechanism is proposed for the lethality of Ripk1D325A/D325A mice at E10.5 (Fig 7E). TNFR1 engages RIPK1 (D325A), the kinase activity of which is required for the signaling transduction [15,28] (S4C Fig). RIPK1 (D325A) on one hand interacts with RIPK3 and on the other hand binds to caspase-8 probably via FADD. Distinct from its classic role in promoting necroptosis, RIPK3 acts as a scaffold of RIPK1(D325A) [15,28] (S2E and S4D Figs), similar to the case of RIPK3 inhibitor GSK-872-induced RIPK1–RIPK3 interaction [43]. The more RIPK1(D325A) in the complex, the more caspase-8 would be recruited which subsequently auto-processes itself (Figs 2 and 3). By an unknown mechanism, apoptotic caspase-8 elicits activation of caspase-1 and/or caspase-11, 2 known regulators of pyroptosis (Figs 3–6). However, caspase-1 and caspase-11 in this scenario do not lead to pyroptosis but rather ultimately activate the apoptosis executioner caspase-3 (Fig 7). Thus, the death pathway leading to the E10.5 lethality of Ripk1D325A/D325A mice features a fusion of components of necroptosis, extrinsic apoptosis, or pyroptosis (Fig 7E). Since the absence of Casp8, caspase-8 enzymatic activity, or Casp3, rather than the loss of Mlkl or Gsdmd, prevented E10.5 lethality of mouse embryos bearing Ripk1D325A/D325A mutation (Figs 2A, 2B, 3A, 3B, 7B, 7C, 6F, 6G, S2C, and S2D), the cause of lethality of Ripk1D325A/D325A embryos at E10.5 is not necroptosis or pyroptosis but apoptosis, which is typically considered nonimmunogenic and would not lead to necroinflammation.
FADD is an adaptor protein bridging caspase-8 and RIPK1 [65–68]. Because of the requirement of caspase-8 in RIPK1(D325A)-initiated cell death, FADD should be the adaptor protein for the interactions between caspase-8 and RIPK1(D325A). This is in agreement with the observation that either Casp8 or Fadd deletion can rescue Ripk1D325A/D325A Mlkl−/− mice to adulthood [15] (Fig 2C). However, a study using “RIPK1D324A/D324AFADD−/− mice” [31] reported that deletion of FADD provides little improvement to the development of RIPK1D324A/D324A embryos. Since the time of death of FADD−/− mice, RIPK1D324A/D324A mice, and RIPK1D324A/D324AFADD−/− mice reported in this study is all at E12.5, whereas the lethality of Ripk1D325A/D325A mice and Fadd−/− mice was reported at E10.5 and E12.5, respectively, by others [15,28,69], the role of FADD in bridging RIPK1(D325A) and caspase-8 requires additional studies.
Under certain conditions, ASC is required for caspase-8 and caspase-1 interaction [45,59]. However, loss of Asc is unable to prevent defects of Ripk1D325A/D325A embryos (Fig 6D and 6E), suggesting that caspase-8 activates caspase-1 in an alternative way at E10.5 in Ripk1D325A/D325A mice. The phenomenon that caspase-1 activation requires caspase-8 but is independent of inflammasome components or the adaptor ASC was also reported in Yersinia infection of bone marrow–derived macrophages (BMDMs) [52]. Similarly, activation of caspase-11 by caspase-8 was observed in BMDMs infected with Citrobacter rodentium or Escherichia coli [50]. Thus, the signal transduction we revealed here from caspase-8 to caspase-1 and/or caspase-11 is not exclusive during embryogenesis and might be a common mechanism occurring in many biological processes.
As intrinsic apoptosis is not required for the death of Ripk1D325A/D325A embryos (Fig 6A–6C), caspase-9 cleavage in Ripk1D325A/D325A embryos might be a by-product of activation of TNFR1 signaling and thus is not pathologically relevant. Since previous report showed that caspase-3 can process caspase-9 and other upstream proteins in WT mice following anti-Fas injection [70], the possibility of caspase-9 being one of the substrates of active caspase-3 in Ripk1D325A/D325A embryos cannot be excluded.
As caspase-1 and caspase-11 are inflammatory caspases usually exerting functions independent of other caspases, it is intriguing to find that caspase-1 and caspase-11 are required for activation of caspase-3 at E10.5 in Ripk1D325A/D325A mice (Figs 4, 7A, and S6F). The fact that caspase-1 and caspase-11 can be upstream of caspase-3 is supported by observations that caspase-1 initiates apoptosis in the absence of GSDMD [71], that caspase-1, independent of caspase-8, activates caspase-3 and caspase-7, leading to apoptotic features of pyroptosis [72], that caspase-11 is a critical initiator for caspase-3 in a mouse stroke model [73], and that loss of Casp1 and Casp11 prevents caspase-3 activation in epidermis in cpdm mice [37].
A substantial number of researches employed Casp1 and Casp11 double knockout mice to investigate their roles in pathogenesis. The additional genetic tools of Casp1−/− mice and Casp11−/− mice help greatly to unravel the overlapping functions and individual contributions of caspase-1 and caspase-11 in vivo. Provided that caspase-1 and caspase-11 can independently process GSDMD for pyroptosis and that caspase-1 can function alone in canonical inflammasomes or downstream of caspase-11 in noncanonical inflammasome activation, it is not surprising to find that caspase-1 and caspase-11 show additive or compensatory effects in some contexts or that one plays a dominant role and is sufficient to exert functions, whereas the other is not required in certain experimental settings [32–35,74–76]. As for the E10.5 lethality of Ripk1D325A/D325A embryos, caspase-1 and caspase-11 should function in parallel in a mutually compensatory way as only concomitant deletion could block the lethality of Ripk1D325A/D325A embryos at E10.5 (Fig 4).
MEFs are frequently used as an in vitro system to elucidate the molecular mechanisms of in vivo events, but MEFs are not suitable in analyzing the pathways in which caspase-1 and/or caspase-11 was involved (S5B and S5C Fig). Although D325A mutation promotes cell death in both MEFs (S5B–S5G Fig) and embryos, the type of cell death and the involvement of RIPK1 kinase activity [15,28] and caspase activity [15,28] are not the same. The immunostaining data on yolk sacs where defects occur are consistent with our genetic rescue results and others’ [15,28] as well, providing further evidence that an unexpected signaling mechanism triggers apoptosis in E10.5 Ripk1D325A/D325A embryos (Fig 7E).
Since strong activation of inflammatory responses was observed in human patients with RIPK1 D324 variants [28,29] and cell death was proposed as the major contributor to cytokine induction in a disease-mimic mouse model [28], one would expect the activation of NF-κB, a major TNFR1-triggered inflammatory signaling regulating inflammatory cytokine production, in human patients. Indeed, increased expression of genes in NF-κB pathway in human patient peripheral blood mononuclear cells (PBMCs) was observed in single-cell RNA sequencing [29]. However, NF-κB signaling was not affected in fibroblasts derived from patient skin biopsies [28] or in certain Ripk1D325A/D325A mouse cells, including MEFs, BMDMs, and mouse dermal fibroblasts (MDFs) [15,28,31]. We crossed Ripk1D325A/+ mice onto p50−/− background and found that loss of p50 brought no effect on RIPK1 D325A mutation-caused lethality (S7A and S7B Fig), suggesting that NF-κB is not required for the E10.5 defect of Ripk1D325A/D325A mice. To address the role of inflammatory cytokine expression in the E10.5 lethality, we performed yolk sac RNA sequencing. We observed a significant difference in expression profiles between WT and Ripk1D325A/D325A yolk sacs. The top hit, CXCL10, is a chemokine (S7C and S7D Fig). Quantitative PCR analysis confirmed the significantly higher expression of CXCL10 in Ripk1D325A/D325A yolk sacs, and this expression is blocked by Tnfr1 deficiency but not by loss of Ripk3 (S7E and S7F Fig), indicating that signal downstream of RIPK3 is not involved in CXCL10 production at E10.5. Genetic loss of Cxcl10 failed to rescue RIPK1 D325A mutation-caused lethality (S7G and S7H Fig), excluding the requirement of CXCL10 in the death of Ripk1D325A/D325A embryos.
The study described in this report specifically focuses on E10.5 lethality of Ripk1D325A/D325A mice. It revealed that different from previously identified pronecroptotic function of RIPK1 D325A mutation in cultured cells, this RIPK1 variant gains a new function to arouse an unexpected signal transduction of TNFR1-[RIPK1(D325A)-RIPK3-caspase-8]-caspase-1&11-caspase-3 at E10.5 during embryogenesis, resulting in E10.5 lethality of Ripk1D325A/D325A mice. Unlike the rescue of Ripk1D325A/D325A mice by genetic deletion of Tnfr1 that extended the survival to P10 (S2A and S2B Fig), the rescue by genetic loss of Ripk3, Casp1+Casp11, or Casp3 did not extend life beyond E16.5 (Figs 4A, 4B, 7B,7C, S3B, and S3C). Hence, there are other checking processes triggered by TNFR1 that function at embryonic days later than E10.5 to surveil embryonic development. The necroptosis that mediates E11.5 lethality of Casp8−/− embryos is one such mechanism. We shall emphasize that the role of TNFR1 signaling in embryonic development is far from fully understood and that the signaling pathway shown in Fig 7E is only applicable to RIPK1 D325A mutation-caused mouse embryonic lethality at E10.5.
It is very intriguing that defect of individual components of TNFR1 pathway may result in lethal outcomes, while the TNFR1 signaling pathway as a whole is dispensable for development. For instance, Casp8−/− or Ripk1−/− mice cannot survive, but additional Ripk3 deletion enables the triple knockout mice to be viable and fertile. The E10.5 lethality of Ripk1D325A/D325A mice is an example that even minor changes can lead to severe outcomes in mice, which can be fully prevented by concomitant loss of Casp8 and Mlkl. On the other hand, these facts also reflect that there is much plasticity in the living organism. It is unclear whether those phenomena are relevant to naturally occurring dysregulations. But given the fact that multiple mechanisms involving TNFR1 signaling exist even within the short time frame of midgestation (E10.5-E13.5), we would believe that TNFR1 functions as a key check mechanism in development, but it is one that is dispensable when there are no major genetic errors.
Materials and methods
Ethics statement
All mice were housed in specific pathogen-free condition with 12-hour light/dark cycle and access to food and water ad libitum at Xiamen University Laboratory Animal Center. Animal husbandry and all mouse experiments were reviewed and approved by Laboratory Animal Management and Ethics Committee of Xiamen University (approval number XMULACC20180126) and were in strict accordance with good animal practice as defined by Xiamen University Laboratory Animal Center. Before the embryos were isolated, the pregnant females were euthanized via CO2 exposure for at least 5 minutes until no breathing was observed. Death was ensured by performing a toe pinch. Cervical dislocation was performed as a secondary method of euthanasia.
Mice
Ripk1D325A/+ mice, Ripk1D325A;△/+ mice, Casp8+/− mice, Casp3−/− mice, Casp1−/− mice, Casp11−/− mice, Casp1+11−/− mice, Asc−/− mice, Apaf1−/− mice, and Cxcl10−/− mice were generated by Xiamen University Laboratory Animal Center as previously described [77]. gRNA targeting sequence was 5′-GTGTACCCTTACCTCCGAGC-3′ for Ripk1 D325A mutation, 5′-CCCGAAGCCTCCGCTGTCT-3′ for Ripk1 △ mutation (F28G29 deletion, exactly the same mutation form as the original publication) [41], 5′-TTCCTAGACTGCAACCGAG-3′ for Casp8 knockout, 5′- AGTGGACTCTGGGATCTATC -3′ for Casp3 knockout, 5′-GGGACAATAAATGGATTGTTGG-3′ for Casp1 knockout in Casp1−/− mice and Casp1+11−/− mice, 5′-GCCAATGGCCGTACACGAAAGG-3′ and 5′-GACTTAGGCTACGATGTGG-3′for Casp11 knockout in Casp11−/− mice and Casp1+11−/− mice, 5′-TATGGGCGCATCCCACGCG-3′ for Asc knockout, 5′-TGGCGTCTTGTCAGTGATAG −3′ for Apaf1 knockout, and 5′-GAGTCCCACTCAGACCCAGC-3′ and 5′-AGCGGACCGTCCTTGCGAGA-3′ for Cxcl10 knockout. Casp8C362S/+ mice, Ripk3−/− mice, Mlkl−/− mice, and Gsdmd−/− mice were generated as described previously [48,78,79]. p50−/− mice [80] and Tnfr1−/− mice [2] were from the Jackson Laboratory (JAX stock #002849 and #002818). All knockout/knockin alleles have been crossed onto the C57BL/6J background, and mice with H19 and DMR mutations were excluded by using PCR as previously reported [77]. Additional information is provided upon request.
Cell culture
All MEFs were harvested from E10.5 embryos. All cells were cultured in Dulbecco’s Modified Eagle Medium (Life Technologies, NY, USA) supplemented with 10% fetal bovine serum (Life Technologies, NSW, Australia), 1% MEM nonessential amino acids solution (Life Technologies, NY, USA), and 100 units/mL penicillin/streptomycin, at 37°C in a humidified incubator containing 5% CO2. All cell lines were well established and frequently checked by monitoring morphology and functionalities. All the cell lines were authenticated by STR analysis and were routinely tested to be mycoplasma free.
Timed mating analysis and imaging
For timed mating experiments, 3- to 4-month-old stud males were housed individually for 1 to 2 weeks prior to mating. Females that are 8 to 15 weeks old were group housed for 10 to 14 days prior to mating and were exposed to soiled bedding from a male’s cage 2 days before mating. One to 2 female(s) in estrus were added into each stud male’s cage at 9:00 PM. Females were examined for vaginal plugs and were separated from male mice at 9:00 AM the next morning. The morning when a vaginal plug was found was set as embryonic day 0.5 (E0.5). At 9:00 AM in the morning of E10.5 or other embryonic stages as indicated, pregnant females were killed. Embryos were isolated, and images of yolk sacs and embryo proper were captured on Leica M165FC microscope (Leica Microsystems GmbH, Germany).
Antibody
Antibodies for IF staining: CD31 (BD Biosciences, 550274); cleaved caspase-3 (Cell Signaling Technology, 9661S); cleaved caspase-8 (Cell Signaling Technology, 9429S); cleaved caspase-1 (Affbiotech, AF4005); cleaved caspase-9 (Cell Signaling Technology, 9509S); cleaved GSDMD (Cell Signaling Technology, 50928S); ASC (Cell Signaling Technology, 67824S); phospho-RIPK3 (2D7) (T231, S232) (Abcam, ab205421); phospho-MLKL (S345) (Abcam, ab196436); Alexa Fluor 488 goat anti-mouse antibody (Invitrogen, A11029); Alexa Fluor 594 goat anti-rat antibody (Invitrogen, A11007); and Alexa Fluor 488 goat anti-rabbit antibody (Invitrogen, A11034). Antibodies for western blot: Apaf-1 (Cell Signaling Technology, 8723S); caspase-3 (Cell Signaling Technology, 9662); caspase-1 (clone 4B4, a kind gift from Dr. Vishva M. Dixit, Genetech, United States of America); caspase-11 (Cell Signaling Technology, 14340S); caspase-8 (Cell Signaling Technology, 4790S); RIPK1 (Cell Signaling Technology, 3493S); TNFR1 (Proteintech, 21514-1-AP); TRADD (Abcam, ab110644-100 uL); A20 (Cell Signaling Technology, 5630S); SHARPIN (Proteintech, 14626-1-AP); RIPK3 (Cell Signaling Technology, 13526); FADD (Proteintech, 14906-1-AP); anti-GSDMA polyclonal antibodies (Immunogen: GST-GSDMA (248-347aa)) and anti-GSDMC polyclonal antibodies (Immunogen: GST-GSDMC2 (367-467aa)) were raised in rabbits; GSDMD (Abcam, ab209845); and GSDME (Abcam, ab215191). Antibodies for immunoprecipitation: RIPK1 (BD Biosciences, 610459).
Immunofluorescence staining and confocal microscopy
Yolk sacs were harvested, mounted on adhesion microscope slides (ZSGB-Bio), and fixed for 4 hours at 4°C using 4% paraformaldehyde in PBS. Cells were permeabilized for 45 minutes in 0.25% Triton X-100 in PBS, blocked for 1 hour in PBS containing 2% goat serum, and then incubated overnight at 4°C with rabbit anti-cleaved caspase-3, rabbit anti-cleaved caspase-1, rabbit anti-cleaved caspase-8, mouse anti-phospho-RIPK3 (2D7), or rabbit anti-phospho-MLKL (S345) along with PECAM (CD31) diluted in blocking buffer. Yolk sacs were washed 3 times with PBS and then incubated for 1 hour at room temperature with Alexa Fluor 488 goat anti-mouse antibody (Invitrogen, A11029), Alexa Fluor 594 goat anti-rat antibody (Invitrogen, A11007), or Alexa Fluor 488 goat anti-rabbit antibody (Invitrogen, A11034). TUNEL assay was performed with commercially available kit (Promega, G3250). DAPI was used as a nuclear (DNA) counter stain. Images were acquired on a Zeiss LSM 780 laser scanning confocal microscope (Carl Zeiss Microscopy GmbH, Germany).
Cell death assay
Cell death was analyzed using CellTiter-Glo luminescent cell viability assay kit (Promega, WI, USA). The luminescent cell viability assays were performed according to the manufacturer’s instructions. In brief, 2.0 × 105 cells were seeded in 96-well plates with white wall. After treatment, an equal volume of CellTiter-Glo reagent was added to the cell culture medium, which had been equilibrated to room temperature for 30 minutes. Cells were shaken for 5 minutes and incubated at room temperature for 15 minutes. Luminescent recording was performed with POLAR star Omega (BMG Labtech, Durham, North Carolina, USA).
Immunoprecipitation
Cell pellets were collected in ice-cold PBS and resuspended in lysis buffer (12.5 mM HEPES (pH7.5), 30 mM NaCl, 90 mM NaSCN, 1% NP40, and protease inhibitor cocktail). The resuspended cell pellets were sonicated and centrifuged at 20,000g for 30 minutes at 4°C. The supernatants were collected for immunoblotting or immunoprecipitation. Commercially available anti-Flag beads were used in the immunoprecipitation. For immunoprecipitation of endogenous proteins, antibody coupled beads were made as follows. Antibodies were crosslinked to A/G agarose beads for 8 hours at 4°C. The cell lysates were then incubated with the antibody-coupled beads overnight at 4°C. The beads were washed with lysis buffer, and the immunoprecipitates of anti-Flag beads were eluted off the beads with 3X FLAG peptide. To minimize the influence of IgG in immunoblotting, the Rabbit TrueBlot was used.
Western blot
Tissues were collected in RIPA buffer (20 mM Tris-HCl (pH7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% NP40, 1% sodium deoxycholate, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 μg/mL leupeptin, and protease inhibitor cocktail) and were mechanically homogenized with a bead mill homogenizer (Scientz-IID, SCIENTZ, Ningbo, China). Insoluble pellet was removed by centrifugation at 20,000g before addition of SDS sample buffer. The supernatants were collected for immunoblotting.
Supporting information
Related to Fig 1. (A) Western blot analysis for caspase-8 expression in E12.5 embryos from intercrosses of Casp8+/− mice and for RIPK1 expression in E10.5 embryos from intercrosses of Ripk1D325A/+ mice. (B) Genetic analysis of offspring from timed mating of Ripk1D325A/+ and Ripk1+/− parents. ♦: paler and likely defective embryos, which are shown in (C). (C) Representative E10.5 and E17.5 embryos in (B). Scale bars, 1 mm. (D) Western blot analysis for RIPK1 expression in E10.5 embryos. Genotypes are as indicated. Uncropped immunoblot for panels A and D can be found in S1 Raw Images. E10.5, embryonic day 10.5; E12.5, embryonic day 12.5; E17.5, embryonic day 17.5; EP, embryo proper; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RIPK1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
(TIF)
Related to Fig 2. (A) Genetic analysis of offspring from timed mating of Ripk1D325A/+ Tnfr1−/− parents. ※: defective and likely dead E19.5 embryos. ♣: the P10 homozygous runts. (B) Representative E19.5 embryos and P10 pups described in (A). (C) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Mlkl−/− mice. #: defective vascularization in YS and normal EP. ##: no vessels in YS and abdominal hemorrhage in the EP. ###: dead embryos, which were about to be resorbed. (D) Representative E10.5, E11.5, and E12.5 embryos in (C). Scale bars, 1 mm. (E) IF staining of E9.5 and E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-p-MLKL (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. E9.5, embryonic day 9.5; E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E12.5, embryonic day 12.5; E19.5, embryonic day 19.5; EP, embryo proper; IF, immunofluorescence; MLKL, mixed lineage kinase domain-like; PECAM, platelet endothelial cell adhesion molecule; p-MLKL, phosphorylated MLKL; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
(TIF)
Related to Fig 2. (A) Representative spleens and lymph nodes isolated from WT mice, Casp8−/− Mlkl−/− mice, and Ripk1D325A/D325A Casp8−/− Mlkl−/− mice at P48 when the mice began to show lpr phenotypes and at 3 months old when symptoms were severe and the mice shall be killed. (B) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Ripk3−/− parents. ✿: YS vascularization defect and normal EP; ✿✿: YS vascularization defect, smaller and paler EP. ✿✿✿: dead embryos being resorbed; ✿✿✿✿: dead embryos. (C) Representative E13.5, E15.5, E16.5, E17.5, and E19.5 embryos summarized in (B). Scale bars, 1 mm. E10.5, embryonic day 10.5; E13.5, embryonic day 13.5; E15.5, embryonic day 15; E16.5, embryonic day 16.5; E17.5, embryonic day 17.5; E19.5, embryonic day 19.5; EP, embryo proper; P48, postnatal day 48; RIPK3, receptor interacting serine/threonine kinase 3; WT, wild-type; YS, yolk sac.
(TIF)
Related to Fig 3. (A) Genetic analysis of offspring from intercrosses of Casp8C362S/+ mice. *: defective YS vessels in E11.5 embryos. **: severe YS vascularization defect and dead EP in E12.5 embryos. (B) Representative E10.5, E11.5, and E12.5 embryos obtained in (A). Scale bars, 1 mm. (C) Genetic analysis of progeny from intercrossing Ripk1D325A; Δ/+ parents. (D) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-p-RIPK3 (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E12.5, embryonic day 12.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; p-RIPK3, phosphorylated RIPK3; RIPK1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
(TIF)
(A) Western blot analysis of caspase-1 and/or caspase-11 expression in tissues from the respective knockout mice. Related to Fig 4. (B) MEFs of indicated genotypes were treated with TNF (10 ng/mL) for different periods of time, and cell death was measured. Data are represented as mean ± SD of triplicates. (C) MEFs of indicated genotypes were treated with TNF (10 ng/mL) for different periods of time. Expression levels of caspase-8, caspase-3, RIPK1, RIPK3, caspase-1, and caspase-11 were analyzed by western blot. (D) Ripk1+/+ and Ripk1D325A/D325A MEFs were treated with 3*FLAG-tagged TNF (3*FLAG-TNF, 200 ng/mL) for different periods of time. Cell lysates were subjected to immunoprecipitation with mouse anti-FLAG M2 beads and then western blotting with anti-RIPK1, anti-TNFR1, anti-TRADD, anti-A20, and anti-SHARPIN antibodies as indicated. (E–G) Ripk1+/+ and Ripk1D325A/D325A MEFs were treated with TNF (10 ng/mL), TS (10 μM), or TSZ (20 μM) for indicated periods of time. Cell lysates were subjected to IP with anti-RIPK1 antibody and then western blotting with anti-RIPK1, anti-caspase-8, anti-RIPK3, and anti-FADD antibodies. *: nonspecific band. Panels B–G are related to Fig 5. Uncropped immunoblot for panels A and C–G can be found in S1 Raw Images. Underlying data are available in S1 Data. E10.5, embryonic day 10.5; FADD, FAS-associated death domain protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IP, immunoprecipitation; MEF, mouse embryonic fibroblast; RIPK1, receptor interacting serine/threonine kinase 1; SHARPIN, SHANK-associated RH domain interacting protein; TNF, tumor necrosis factor; TNFR1, tumor necrosis factor receptor-1; TRADD, TNFR1-associated death domain protein; TS, TNF + SMAC mimetic; TSZ, TNF + SMAC mimetic + zVAD; WT, wild-type.
(TIF)
(A) Western blot analysis for Apaf-1 expression in embryos of indicated genotypes. (B) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-ASC (green) or anti-Cl.GSDMD (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. (C) Western blot analysis for expression of gasdermins in E10.5 WT mouse embryos. Antibodies against the conserved region of 3 GSDMAs and conserved region of 4 GSDMCs, GSDMD, and GSDME were used. Anti-RIPK1, anti-caspase-8, and anti-caspase-3 antibodies were included as controls. *: nonspecific band. Panels A–C are related to Fig 6. (D) TUNEL assay of E9.5 YS and IF staining of E9.5 YS with anti-PECAM (red) and anti-Cl.CASP3 (green) antibodies. DAPI, a DNA stain. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. (E) Western blot analysis for caspase-3 expression in different tissues from mice of indicated genotypes. (F) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-Cl.CASP3 (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. Panels D–F are related to Fig 7. Uncropped immunoblot for panels A, C, and E can be found in S1 Raw Images. Apaf-1, apoptotic protease activating factor 1; ASC, apoptosis-associated speck-like protein containing a CARD; BMDM, bone marrow–derived macrophage; Cl.CASP3, cleaved caspase-3; Cl.GSDMD, cleaved GSDMD; E10.5, embryonic day 10.5; EP, embryo proper; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; RIPK1, receptor interacting serine/threonine kinase 1; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling; WT, wild-type; YS, yolk sac.
(TIF)
(A) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ p50−/− parents. (B) Representative E10.5 embryos collected in (A). Scale bars, 1 mm. (C) RNA sequencing of YS RNA from WT and Ripk1D325A/D325A mice, both with biological triplicates. Heat map shows differentially expressed genes. (D) A list of top 10 high expression genes along with their parameters and values analyzed in (C). (E and F) Quantitative PCR analysis of CXCL10 expression in E10.5 YS. Data from 3 independent experiments are analyzed, 3 embryos per genotype per experiment. Data are represented as mean ± SEM. ns, no significance; ****: p < 0.0001; **: p < 0.01; *: p < 0.05. (G) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Cxcl10−/− mice. (H) Representative images of E11.5 embryos obtained in (G). Scale bars, 1 mm. Underlying data are available in S1 Data. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; EP, embryo proper; HM Ripk1D325A/D325A homozygotes; NF-κB, nuclear factor-kappa B; WT, wild-type; YS, yolk sac.
(TIF)
(XLSX)
(PDF)
Acknowledgments
We thank John Silke for helpful discussion and critically reading the manuscript.
Abbreviations
- Apaf-1
apoptotic protease activating factor 1
- ASC
apoptosis-associated speck-like protein containing a CARD
- BMDM
bone marrow–derived macrophage
- cFLIP
CASP8 and FADD-like apoptosis regulator
- cIAP1 and 2
cellular inhibitor of apoptosis protein 1 and 2
- DISC
death-inducing signaling complex
- E9.5
embryonic day 9.5
- E10.5
embryonic day 10.5
- E11.5
embryonic day 11.5
- E12.5
embryonic day 12.5
- E13.5
embryonic day 13.5
- E16.5
embryonic day 16.5
- E17.5
embryonic day 17.5
- FADD
FAS-associated death domain protein
- HOIL-1
RanBP-type and C3HC4-type zinc finger-containing protein 1
- HOIP
ring finger protein 31
- IF
immunofluorescence
- IKKβ
inhibitor of nuclear factor kappa-B kinase subunit beta
- LUBAC
linear ubiquitin chain assembly complex
- MAPK
mitogen-activated protein kinase
- MDF
mouse dermal fibroblast
- MEF
mouse embryonic fibroblast
- MLKL
mixed lineage kinase domain-like
- NF-κB
nuclear factor-kappa B
- P1
postnatal day 1
- P10
postnatal day 10
- PBMC
peripheral blood mononuclear cell
- RHIM
RIP homotypic interaction motif
- RIPK1
receptor interacting serine/threonine kinase 1
- SHARPIN
SHANK-associated RH domain interacting protein
- TBK1
TANK-binding kinase 1
- TNF
tumor necrosis factor
- TNFR1
tumor necrosis factor receptor-1
- TRADD
TNFR1-associated death domain protein
- TS
TNF + SMAC mimetic
- TSZ
TNF + SMAC mimetic + zVAD
- WT
wild-type
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by the National Natural Science Foundation of China (81788101 and 81630042 to J.H; 31801158 to Y.Z.), the National Key R&D program (2020YFA0803500 to J.H.), the 111 Project (B12001 to J.H.), the CAMS Innovation Found for Medical Science (CIFMS) (2019-I2M-5-062 to J.H.), and the Funds for Social Development in Fujian Province (2013Y0091 to J.L.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Pasparakis M, Alexopoulou L, Episkopou V, Kollias G. Immune and inflammatory responses in TNF alpha-deficient mice: a critical requirement for TNF alpha in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J Exp Med. 1996;184:1397–411. doi: 10.1084/jem.184.4.1397 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Pfeffer K, Matsuyama T, Kündig TM, Wakeham A, Kishihara K, Shahinian A, et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell. 1993;73:457–67. doi: 10.1016/0092-8674(93)90134-c [DOI] [PubMed] [Google Scholar]
- 3.Bonnard M, Mirtsos C, Suzuki S, Graham K, Huang J, Ng M, et al. Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-κB-dependent gene transcription. EMBO J. 2000;19:4976–85. doi: 10.1093/emboj/19.18.4976 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Alcamo E, Mizgerd JP, Horwitz BH, Bronson R, Beg AA, Scott M, et al. Targeted Mutation of TNF Receptor I Rescues the RelA-Deficient Mouse and Reveals a Critical Role for NF-κB in Leukocyte Recruitment. J Immunol. 2001;167:1592 LP–1600. doi: 10.4049/jimmunol.167.3.1592 [DOI] [PubMed] [Google Scholar]
- 5.Dillon CP, Weinlich R, Rodriguez DA, Cripps JG, Quarato G, Gurung P, et al. RIPK1 blocks early postnatal lethality mediated by caspase-8 and RIPK3. Cell. 2014;157:1189–202. doi: 10.1016/j.cell.2014.04.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Peltzer N, Darding M, Montinaro A, Draber P, Draberova H, Kupka S, et al. LUBAC is essential for embryogenesis by preventing cell death and enabling haematopoiesis. Nature. 2018;557:112–7. doi: 10.1038/s41586-018-0064-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Verma IM. Severe Liver Degeneration in Mice Lacking the IκB Kinase 2 Gene. Science. 1999;284:321–5. doi: 10.1126/science.284.5412.321 [DOI] [PubMed] [Google Scholar]
- 8.Cusson N, Oikemus S, Kilpatrick ED, Cunningham L, Kelliher M. The death domain kinase RIP protects thymocytes from tumor necrosis factor receptor type 2-induced cell death. J Exp Med. 2002;196:15–26. doi: 10.1084/jem.20011470 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Silke J. The regulation of TNF signalling: What a tangled web we weave. Curr Opin Immunol. 2011;23:620–6. doi: 10.1016/j.coi.2011.08.002 [DOI] [PubMed] [Google Scholar]
- 10.Moulin M, Anderton H, Voss AK, Thomas T, Wong WWL, Bankovacki A, et al. IAPs limit activation of RIP kinases by TNF receptor 1 during development. EMBO J. 2012;31:1679–91. doi: 10.1038/emboj.2012.18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Peltzer N, Rieser E, Taraborrelli L, Draber P, Darding M, Pernaute B, et al. HOIP deficiency causes embryonic lethality by aberrant TNFR1-mediated endothelial cell death. Cell Rep. 2014;9:153–65. doi: 10.1016/j.celrep.2014.08.066 [DOI] [PubMed] [Google Scholar]
- 12.Silke J, Rickard JA, Gerlic M. The diverse role of RIP kinases in necroptosis and inflammation. Nat Immunol. 2015;16:689–97. doi: 10.1038/ni.3206 [DOI] [PubMed] [Google Scholar]
- 13.Shim JH, Xiao C, Paschal AE, Bailey ST, Rao P, Hayden MS, et al. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev. 2005;19:2668–81. doi: 10.1101/gad.1360605 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sato S, Sanjo H, Takeda K, Ninomiya-Tsuji J, Yamamoto M, Kawai T, et al. Essential function for the kinase TAK1 in innate and adaptive immune responses. Nat Immunol. 2005;6:1087–95. doi: 10.1038/ni1255 [DOI] [PubMed] [Google Scholar]
- 15.Newton K, Wickliffe KE, Dugger DL, Maltzman A, Roose-Girma M, Dohse M, et al. Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature. 2019;574:428–31. doi: 10.1038/s41586-019-1548-x [DOI] [PubMed] [Google Scholar]
- 16.Grootjans S, Vanden Berghe T, Vandenabeele P. Initiation and execution mechanisms of necroptosis: An overview. Cell Death Differ. 2017;24:1184–95. doi: 10.1038/cdd.2017.65 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhang Y, Chen X, Gueydan C, Han J. Plasma membrane changes during programmed cell deaths. Cell Res. 2018;28:9–21. doi: 10.1038/cr.2017.133 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wang R, Li H, Wu J, Cai ZY, Li B, Ni H, et al. Gut stem cell necroptosis by genome instability triggers bowel inflammation. Nature. 2020;580:386–90. doi: 10.1038/s41586-020-2127-x [DOI] [PubMed] [Google Scholar]
- 19.Jiao H, Wachsmuth L, Kumari S, Schwarzer R, Lin J, Eren RO, et al. Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature. 2020;580:391–5. doi: 10.1038/s41586-020-2129-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Juznić L, Peuker K, Strigli A, Brosch M, Herrmann A, Häsler R, et al. SETDB1 is required for intestinal epithelial differentiation and the prevention of intestinal inflammation. Gut. 2021;70:485–98. doi: 10.1136/gutjnl-2020-321339 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Varfolomeev EE, Schuchmann M, Luria V, Chiannilkulchai N, Beckmann JS, Mett IL, et al. Targeted disruption of the mouse Caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity. 1998;9:267–76. doi: 10.1016/s1074-7613(00)80609-3 [DOI] [PubMed] [Google Scholar]
- 22.Fritsch M, Günther SD, Schwarzer R, Albert MC, Schorn F, Werthenbach JP, et al. Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature. 2019;575:683–7. doi: 10.1038/s41586-019-1770-6 [DOI] [PubMed] [Google Scholar]
- 23.Oberst A, Dillon CP, Weinlich R, McCormick LL, Fitzgerald P, Pop C, et al. Catalytic activity of the caspase-8–FLIPL complex inhibits RIPK3-dependent necrosis. Nature. 2011;471:363–7. doi: 10.1038/nature09852 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kaiser WJ, Upton JW, Long AB, Livingston-Rosanoff D, Daley-Bauer LP, Hakem R, et al. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature. 2011;471:368–72. doi: 10.1038/nature09857 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Rickard JA, O’Donnell JA, Evans JM, Lalaoui N, Poh AR, Rogers T, et al. RIPK1 regulates RIPK3-MLKL-driven systemic inflammation and emergency hematopoiesis. Cell. 2014;157:1175–88. doi: 10.1016/j.cell.2014.04.019 [DOI] [PubMed] [Google Scholar]
- 26.Kaiser WJ, Daley-Bauer LP, Thapa RJ, Mandal P, Berger SB, Huang C, et al. RIP1 suppresses innate immune necrotic as well as apoptotic cell death during mammalian parturition. Proc Natl Acad Sci U S A. 2014;111:7753–8. doi: 10.1073/pnas.1401857111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Alvarez-Diaz S, Dillon CP, Lalaoui N, Tanzer MC, Rodriguez DA, Lin A, et al. The Pseudokinase MLKL and the Kinase RIPK3 Have Distinct Roles in Autoimmune Disease Caused by Loss of Death-Receptor-Induced Apoptosis. Immunity. 2016;45:513–26. doi: 10.1016/j.immuni.2016.07.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lalaoui N, Boyden SE, Oda H, Wood GM, Stone DL, Chau D, et al. Mutations that prevent caspase cleavage of RIPK1 cause autoinflammatory disease. Nature. 2020;577:103–8. doi: 10.1038/s41586-019-1828-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tao P, Sun J, Wu Z, Wang S, Wang J, Li W, et al. A dominant autoinflammatory disease caused by non-cleavable variants of RIPK1. Nature. 2020;577:109–14. doi: 10.1038/s41586-019-1830-y [DOI] [PubMed] [Google Scholar]
- 30.Lin Y, Devin A, Rodriguez Y, Liu ZG. Cleavage of the death domain kinase RIP by Caspase-8 prompts TNF-induced apoptosis. Genes Dev. 1999;13:2514–26. doi: 10.1101/gad.13.19.2514 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zhang X, Dowling JP, Zhang J. RIPK1 can mediate apoptosis in addition to necroptosis during embryonic development. Cell Death Dis. 2019;10. doi: 10.1038/s41419-019-1490-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kayagaki N, Warming S, Lamkanfi M, Vande WL, Louie S, Dong J, et al. Non-canonical inflammasome activation targets caspase-11. Nature. 2011;479:117–21. doi: 10.1038/nature10558 [DOI] [PubMed] [Google Scholar]
- 33.Broz P, Ruby T, Belhocine K, Bouley DM, Kayagaki N, Dixit VM, et al. Caspase-11 increases susceptibility to Salmonella infection in the absence of caspase-1. Nature. 2012;490:288–91. doi: 10.1038/nature11419 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Aachoui Y, Leaf IA, Hagar JA, Fontana MF, Campos CG, Zak DE, et al. Caspase-11 protects against bacteria that escape the vacuole. Science. 2013;339:975–8. doi: 10.1126/science.1230751 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Cerqueira DM, Pereira MSF, Silva ALN, Cunha LD, Zamboni DS. Caspase-1 but Not Caspase-11 Is Required for NLRC4-Mediated Pyroptosis and Restriction of Infection by Flagellated Legionella Species in Mouse Macrophages and In Vivo. J Immunol. 2015;195:2303–11. doi: 10.4049/jimmunol.1501223 [DOI] [PubMed] [Google Scholar]
- 36.Huang H, Chen H-W, Evankovich J, Yan W, Rosborough BR, Nace GW, et al. Histones Activate the NLRP3 Inflammasome in Kupffer Cells during Sterile Inflammatory Liver Injury. J Immunol. 2013;191:2665–79. doi: 10.4049/jimmunol.1202733 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Douglas T, Champagne C, Morizot A, Lapointe J-M, Saleh M. The Inflammatory Caspases-1 and -11 Mediate the Pathogenesis of Dermatitis in Sharpin-Deficient Mice. J Immunol. 2015;195:2365–73. doi: 10.4049/jimmunol.1500542 [DOI] [PubMed] [Google Scholar]
- 38.Caution K, Young N, Robledo-Avila F, Krause K, Abu Khweek A, Hamilton K, et al. Caspase-11 Mediates Neutrophil Chemotaxis and Extracellular Trap Formation During Acute Gouty Arthritis Through Alteration of Cofilin Phosphorylation. Front Immunol. 2019;10. doi: 10.3389/fimmu.2019.02519 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kelliher MA, Grimm S, Ishida Y, Kuo F, Stanger BZ, Leder P. The death domain kinase RIP mediates the TNF-induced NF-κB signal. Immunity. 1998;8:297–303. doi: 10.1016/s1074-7613(00)80535-x [DOI] [PubMed] [Google Scholar]
- 40.Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature. 1992;356:314–7. doi: 10.1038/356314a0 [DOI] [PubMed] [Google Scholar]
- 41.Liu Y, Fan C, Zhang Y, Yu X, Wu X, Zhang X, et al. RIP1 kinase activity-dependent roles in embryonic development of Fadd-deficient mice. Cell Death Differ. 2017;24:1459–69. doi: 10.1038/cdd.2017.78 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Chen W, Zhou Z, Li L, Zhong C-Q, Zheng X, Wu X, et al. Diverse Sequence Determinants Control Human and Mouse Receptor Interacting Protein 3 (RIP3) and Mixed Lineage Kinase domain-Like (MLKL) Interaction in Necroptotic Signaling*. J Biol Chem. 2013;288: 16247–16261. doi: 10.1074/jbc.M112.435545 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Mandal P, Berger SB, Pillay S, Moriwaki K, Huang C, Guo H, et al. RIP3 Induces Apoptosis Independent of Pronecrotic Kinase Activity. Mol Cell. 2014;56:481–95. doi: 10.1016/j.molcel.2014.10.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Lu JV, Weist BM, Van Raam BJ, Marro BS, Nguyen LV, Srinivas P, et al. Complementary roles of Fas-associated death domain (FADD) and receptor interacting protein kinase-3 (RIPK3) in T-cell homeostasis and antiviral immunity. Proc Natl Acad Sci U S A. 2011;108:15312–7. doi: 10.1073/pnas.1102779108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Sagulenko V, Thygesen SJ, Sester DP, Idris A, Cridland JA, Vajjhala PR, et al. AIM2 and NLRP3 inflammasomes activate both apoptotic and pyroptotic death pathways via ASC. Cell Death Differ. 2013;20:1149–60. doi: 10.1038/cdd.2013.37 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Kang TB, Yang SH, Toth B, Kovalenko A, Wallach D. Caspase-8 Blocks Kinase RIPK3-Mediated Activation of the NLRP3 Inflammasome. Immunity. 2013;38:27–40. doi: 10.1016/j.immuni.2012.09.015 [DOI] [PubMed] [Google Scholar]
- 47.Zhang DW, Shao J, Lin J, Zhang N, Lu BJ, Lin SC, et al. RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis. Science. 2009;325:332–6. doi: 10.1126/science.1172308 [DOI] [PubMed] [Google Scholar]
- 48.He WT, Wan H, Hu L, Chen P, Wang X, Huang Z, et al. Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion. Cell Res. 2015;25:1285–98. doi: 10.1038/cr.2015.139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Man SM, Tourlomousis P, Hopkins L, Monie TP, Fitzgerald KA, Bryant CE. Salmonella Infection Induces Recruitment of Caspase-8 to the Inflammasome To Modulate IL-1β Production. J Immunol. 2013;191:5239–46. doi: 10.4049/jimmunol.1301581 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Gurung P, Anand PK, Malireddi RKS, Vande Walle L, Van Opdenbosch N, Dillon CP, et al. FADD and Caspase-8 Mediate Priming and Activation of the Canonical and Noncanonical Nlrp3 Inflammasomes. J Immunol. 2014;192:1835–46. doi: 10.4049/jimmunol.1302839 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Weng D, Marty-Roix R, Ganesan S, Proulx MK, Vladimer GI, Kaiser WJ, et al. Caspase-8 and RIP kinases regulate bacteria-induced innate immune responses and cell death. Proc Natl Acad Sci U S A. 2014;111:7391–6. doi: 10.1073/pnas.1403477111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Philip NH, Dillon CP, Snyder AG, Fitzgerald P, Wynosky-Dolfi MA, Zwack EE, et al. Caspase-8 mediates caspase-1 processing and innate immune defense in response to bacterial blockade of NF- B and MAPK signaling. Proc Natl Acad Sci. 2014;111:7385–90. doi: 10.1073/pnas.1403252111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Moriwaki K, Bertin J, Gough PJ. Chan FK-M. A RIPK3–Caspase 8 Complex Mediates Atypical Pro–IL-1β Processing. J Immunol. 2015;194:1938–44. doi: 10.4049/jimmunol.1402167 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Kang S, Fernandes-Alnemri T, Rogers C, Mayes L, Wang Y, Dillon C, et al. Caspase-8 scaffolding function and MLKL regulate NLRP3 inflammasome activation downstream of TLR3. Nat Commun. 2015;6:1–15. doi: 10.1038/ncomms8515 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Lawlor KE, Khan N, Mildenhall A, Gerlic M, Croker BA, D’Cruz AA, et al. RIPK3 promotes cell death and NLRP3 inflammasome activation in the absence of MLKL. Nat Commun. 2015;6. doi: 10.1038/ncomms7282 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Van Opdenbosch N, Van Gorp H, Verdonckt M, Saavedra PHV, de Vasconcelos NM, Gonçalves A, et al. Caspase-1 Engagement and TLR-Induced c-FLIP Expression Suppress ASC/Caspase-8-Dependent Apoptosis by Inflammasome Sensors NLRP1b and NLRC4. Cell Rep. 2017;21:3427–44. doi: 10.1016/j.celrep.2017.11.088 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Van de Craen M, Declercq W. Van den brande I, Fiers W, Vandenabeele P. The proteolytic procaspase activation network: an in vitro analysis. Cell Death Differ. 1999;6:1117–24. doi: 10.1038/sj.cdd.4400589 [DOI] [PubMed] [Google Scholar]
- 58.Honarpour N, Du C, Richardson JA, Hammer RE, Wang X, Herz J. Adult Apaf-1-deficient mice exhibit male infertility. Dev Biol. 2000;218:248–58. doi: 10.1006/dbio.1999.9585 [DOI] [PubMed] [Google Scholar]
- 59.Newton K, Wickliffe KE, Maltzman A, Dugger DL, Reja R, Zhang Y, et al. Activity of caspase-8 determines plasticity between cell death pathways. Nature. 2019;575:679–82. doi: 10.1038/s41586-019-1752-8 [DOI] [PubMed] [Google Scholar]
- 60.Orning P, Weng D, Starheim K, Ratner D, Best Z, Lee B, et al. Pathogen blockade of TAK1 triggers caspase-8–dependent cleavage of gasdermin D and cell death. Science. 2018;362:1064 LP–1069. doi: 10.1126/science.aau2818 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Sarhan J, Liu BC, Muendlein HI, Li P, Nilson R, Tang AY, et al. Caspase-8 induces cleavage of gasdermin D to elicit pyroptosis during Yersinia infection. Proc Natl Acad Sci. 2018;115:E10888 LP–E10897. doi: 10.1073/pnas.1809548115 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Chen KW, Demarco B, Heilig R, Shkarina K, Boettcher A, Farady CJ, et al. Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J. 2019;38:e101638. doi: 10.15252/embj.2019101638 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Demarco B, Grayczyk JP, Bjanes E, Le Roy D, Tonnus W, Assenmacher C-A, et al. Caspase-8–dependent gasdermin D cleavage promotes antimicrobial defense but confers susceptibility to TNF-induced lethality. Sci Adv. 2020;6:eabc3465. doi: 10.1126/sciadv.abc3465 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Horn S, Hughes MA, Schilling R, Sticht C, Tenev T, Ploesser M, et al. Caspase-10 Negatively Regulates Caspase-8-Mediated Cell Death, Switching the Response to CD95L in Favor of NF-κB Activation and Cell Survival. Cell Rep. 2017;19:785–97. doi: 10.1016/j.celrep.2017.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Lavrik IN, Krammer PH. Regulation of CD95/Fas signaling at the DISC. Cell Death Differ. 2012;19:36–41. doi: 10.1038/cdd.2011.155 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Micheau O, Tschopp J. Induction of TNF Receptor I-Mediated Apoptosis via Two Sequential Signaling Complexes. Cell. 2003;114:181–90. doi: 10.1016/s0092-8674(03)00521-x [DOI] [PubMed] [Google Scholar]
- 67.Muzio M, Chinnaiyan AM, Kischkel FC, O’Rourke K, Shevchenko A, Ni J, et al. FLICE, A Novel FADD-Homologous ICE/CED-3–like Protease, Is Recruited to the CD95 (Fas/APO-1) Death-Inducing Signaling Complex. Cell. 1996;85:817–27. doi: 10.1016/s0092-8674(00)81266-0 [DOI] [PubMed] [Google Scholar]
- 68.Kataoka T, Budd RC, Holler N, Thome M, Martinon F, Irmler M, et al. The caspase-8 inhibitor FLIP promotes activation of NF-κB and Erk signaling pathways. Curr Biol. 2000;10:640–8. doi: 10.1016/s0960-9822(00)00512-1 [DOI] [PubMed] [Google Scholar]
- 69.Yeh WC, De La Pompa JL, McCurrach ME, Shu HB, Elia AJ, Shahinian A, et al. FADD: Essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science. 1998;279:1954–8. doi: 10.1126/science.279.5358.1954 [DOI] [PubMed] [Google Scholar]
- 70.Woo M, Hakem A, Elia AJ, Hakem R, Duncan GS, Patterson BJ, et al. In vivo evidence that caspase-3 is required for Fas-mediated apoptosis of hepatocytes. J Immunol. 1999;163:4909–16. [PubMed] [Google Scholar]
- 71.Tsuchiya K, Nakajima S, Hosojima S, Thi Nguyen D, Hattori T, Manh Le T, et al. Caspase-1 initiates apoptosis in the absence of gasdermin D. Nat Commun. 2019;10. doi: 10.1038/s41467-019-09753-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.de Vasconcelos NM, Van Opdenbosch N, Van Gorp H, Martín-Pérez R, Zecchin A, Vandenabeele P, et al. An Apoptotic Caspase Network Safeguards Cell Death Induction in Pyroptotic Macrophages. Cell Rep. 2020;32. doi: 10.1016/j.celrep.2020.107959 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Kang SJ, Wang S, Hara H, Peterson EP, Namura S, Amin-Hanjani S, et al. Dual role of caspase-11 in mediating activation of caspase-1 and caspase-3 under pathological conditions. J Cell Biol. 2000;149:613–22. doi: 10.1083/jcb.149.3.613 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Ming Man S, Karki R, Briard B, Burton A, Gingras S, Pelletier S, et al. Differential roles of caspase-1 and caspase-11 in infection and inflammation. Sci Rep. 2017;7:1–11. doi: 10.1038/s41598-016-0028-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Lacey CA, Mitchell WJ, Dadelahi AS, Skyberg JA. Caspase-1 and Caspase-11 Mediate Pyroptosis, Inflammation, and Control of Brucella Joint Infection. Palmer GH, editor. Infect Immun 2018;86: e00361–18. doi: 10.1128/IAI.00361-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Crowley SM, Han X, Allaire JM, Stahl M, Rauch I, Knodler LA, et al. Intestinal restriction of Salmonella Typhimurium requires caspase-1 and caspase-11 epithelial intrinsic inflammasomes. PLoS Pathog. 2020;16:1–20. doi: 10.1371/journal.ppat.1008498 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Zhong C, Yin Q, Xie Z, Bai M, Dong R, Tang W, et al. CRISPR-Cas9-Mediated Genetic Screening in Mice with Haploid Embryonic Stem Cells Carrying a Guide RNA Library. Cell Stem Cell. 2015;17:221–32. doi: 10.1016/j.stem.2015.06.005 [DOI] [PubMed] [Google Scholar]
- 78.Wu J, Huang Z, Ren J, Zhang Z, He P, Li Y, et al. Mlkl knockout mice demonstrate the indispensable role of Mlkl in necroptosis. Cell Res. 2013;23:994–1006. doi: 10.1038/cr.2013.91 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Yang Z-H, Wu X-N, He P, Wang X, Wu J, Ai T, et al. A Non-canonical PDK1-RSK Signal Diminishes Pro-caspase-8- Mediated Necroptosis Blockade. Mol Cell. 2020;80: 296–310.e6. doi: 10.1016/j.molcel.2020.09.004 [DOI] [PubMed] [Google Scholar]
- 80.Sha WC, Liou H-C, Tuomanen EI, Baltimore D. Targeted disruption of the p50 subunit of NF-κB leads to multifocal defects in immune responses. Cell. 1995;80:321–30. doi: 10.1016/0092-8674(95)90415-8 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Related to Fig 1. (A) Western blot analysis for caspase-8 expression in E12.5 embryos from intercrosses of Casp8+/− mice and for RIPK1 expression in E10.5 embryos from intercrosses of Ripk1D325A/+ mice. (B) Genetic analysis of offspring from timed mating of Ripk1D325A/+ and Ripk1+/− parents. ♦: paler and likely defective embryos, which are shown in (C). (C) Representative E10.5 and E17.5 embryos in (B). Scale bars, 1 mm. (D) Western blot analysis for RIPK1 expression in E10.5 embryos. Genotypes are as indicated. Uncropped immunoblot for panels A and D can be found in S1 Raw Images. E10.5, embryonic day 10.5; E12.5, embryonic day 12.5; E17.5, embryonic day 17.5; EP, embryo proper; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RIPK1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
(TIF)
Related to Fig 2. (A) Genetic analysis of offspring from timed mating of Ripk1D325A/+ Tnfr1−/− parents. ※: defective and likely dead E19.5 embryos. ♣: the P10 homozygous runts. (B) Representative E19.5 embryos and P10 pups described in (A). (C) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Mlkl−/− mice. #: defective vascularization in YS and normal EP. ##: no vessels in YS and abdominal hemorrhage in the EP. ###: dead embryos, which were about to be resorbed. (D) Representative E10.5, E11.5, and E12.5 embryos in (C). Scale bars, 1 mm. (E) IF staining of E9.5 and E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-p-MLKL (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. E9.5, embryonic day 9.5; E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E12.5, embryonic day 12.5; E19.5, embryonic day 19.5; EP, embryo proper; IF, immunofluorescence; MLKL, mixed lineage kinase domain-like; PECAM, platelet endothelial cell adhesion molecule; p-MLKL, phosphorylated MLKL; TNFR1, tumor necrosis factor receptor-1; YS, yolk sac.
(TIF)
Related to Fig 2. (A) Representative spleens and lymph nodes isolated from WT mice, Casp8−/− Mlkl−/− mice, and Ripk1D325A/D325A Casp8−/− Mlkl−/− mice at P48 when the mice began to show lpr phenotypes and at 3 months old when symptoms were severe and the mice shall be killed. (B) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ Ripk3−/− parents. ✿: YS vascularization defect and normal EP; ✿✿: YS vascularization defect, smaller and paler EP. ✿✿✿: dead embryos being resorbed; ✿✿✿✿: dead embryos. (C) Representative E13.5, E15.5, E16.5, E17.5, and E19.5 embryos summarized in (B). Scale bars, 1 mm. E10.5, embryonic day 10.5; E13.5, embryonic day 13.5; E15.5, embryonic day 15; E16.5, embryonic day 16.5; E17.5, embryonic day 17.5; E19.5, embryonic day 19.5; EP, embryo proper; P48, postnatal day 48; RIPK3, receptor interacting serine/threonine kinase 3; WT, wild-type; YS, yolk sac.
(TIF)
Related to Fig 3. (A) Genetic analysis of offspring from intercrosses of Casp8C362S/+ mice. *: defective YS vessels in E11.5 embryos. **: severe YS vascularization defect and dead EP in E12.5 embryos. (B) Representative E10.5, E11.5, and E12.5 embryos obtained in (A). Scale bars, 1 mm. (C) Genetic analysis of progeny from intercrossing Ripk1D325A; Δ/+ parents. (D) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-p-RIPK3 (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; E12.5, embryonic day 12.5; EP, embryo proper; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; p-RIPK3, phosphorylated RIPK3; RIPK1, receptor interacting serine/threonine kinase 1; YS, yolk sac.
(TIF)
(A) Western blot analysis of caspase-1 and/or caspase-11 expression in tissues from the respective knockout mice. Related to Fig 4. (B) MEFs of indicated genotypes were treated with TNF (10 ng/mL) for different periods of time, and cell death was measured. Data are represented as mean ± SD of triplicates. (C) MEFs of indicated genotypes were treated with TNF (10 ng/mL) for different periods of time. Expression levels of caspase-8, caspase-3, RIPK1, RIPK3, caspase-1, and caspase-11 were analyzed by western blot. (D) Ripk1+/+ and Ripk1D325A/D325A MEFs were treated with 3*FLAG-tagged TNF (3*FLAG-TNF, 200 ng/mL) for different periods of time. Cell lysates were subjected to immunoprecipitation with mouse anti-FLAG M2 beads and then western blotting with anti-RIPK1, anti-TNFR1, anti-TRADD, anti-A20, and anti-SHARPIN antibodies as indicated. (E–G) Ripk1+/+ and Ripk1D325A/D325A MEFs were treated with TNF (10 ng/mL), TS (10 μM), or TSZ (20 μM) for indicated periods of time. Cell lysates were subjected to IP with anti-RIPK1 antibody and then western blotting with anti-RIPK1, anti-caspase-8, anti-RIPK3, and anti-FADD antibodies. *: nonspecific band. Panels B–G are related to Fig 5. Uncropped immunoblot for panels A and C–G can be found in S1 Raw Images. Underlying data are available in S1 Data. E10.5, embryonic day 10.5; FADD, FAS-associated death domain protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IP, immunoprecipitation; MEF, mouse embryonic fibroblast; RIPK1, receptor interacting serine/threonine kinase 1; SHARPIN, SHANK-associated RH domain interacting protein; TNF, tumor necrosis factor; TNFR1, tumor necrosis factor receptor-1; TRADD, TNFR1-associated death domain protein; TS, TNF + SMAC mimetic; TSZ, TNF + SMAC mimetic + zVAD; WT, wild-type.
(TIF)
(A) Western blot analysis for Apaf-1 expression in embryos of indicated genotypes. (B) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-ASC (green) or anti-Cl.GSDMD (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. (C) Western blot analysis for expression of gasdermins in E10.5 WT mouse embryos. Antibodies against the conserved region of 3 GSDMAs and conserved region of 4 GSDMCs, GSDMD, and GSDME were used. Anti-RIPK1, anti-caspase-8, and anti-caspase-3 antibodies were included as controls. *: nonspecific band. Panels A–C are related to Fig 6. (D) TUNEL assay of E9.5 YS and IF staining of E9.5 YS with anti-PECAM (red) and anti-Cl.CASP3 (green) antibodies. DAPI, a DNA stain. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. (E) Western blot analysis for caspase-3 expression in different tissues from mice of indicated genotypes. (F) IF staining of E10.5 YS of indicated genotypes with anti-PECAM (red) and anti-Cl.CASP3 (green) antibodies. Scale bars, 50 μm. Images are representative of 3 embryos per genotype. Panels D–F are related to Fig 7. Uncropped immunoblot for panels A, C, and E can be found in S1 Raw Images. Apaf-1, apoptotic protease activating factor 1; ASC, apoptosis-associated speck-like protein containing a CARD; BMDM, bone marrow–derived macrophage; Cl.CASP3, cleaved caspase-3; Cl.GSDMD, cleaved GSDMD; E10.5, embryonic day 10.5; EP, embryo proper; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IF, immunofluorescence; PECAM, platelet endothelial cell adhesion molecule; RIPK1, receptor interacting serine/threonine kinase 1; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling; WT, wild-type; YS, yolk sac.
(TIF)
(A) Genetic analysis of offspring from intercrosses of Ripk1D325A/+ p50−/− parents. (B) Representative E10.5 embryos collected in (A). Scale bars, 1 mm. (C) RNA sequencing of YS RNA from WT and Ripk1D325A/D325A mice, both with biological triplicates. Heat map shows differentially expressed genes. (D) A list of top 10 high expression genes along with their parameters and values analyzed in (C). (E and F) Quantitative PCR analysis of CXCL10 expression in E10.5 YS. Data from 3 independent experiments are analyzed, 3 embryos per genotype per experiment. Data are represented as mean ± SEM. ns, no significance; ****: p < 0.0001; **: p < 0.01; *: p < 0.05. (G) Genetic analysis of progeny from intercrossing Ripk1D325A/+ Cxcl10−/− mice. (H) Representative images of E11.5 embryos obtained in (G). Scale bars, 1 mm. Underlying data are available in S1 Data. E10.5, embryonic day 10.5; E11.5, embryonic day 11.5; EP, embryo proper; HM Ripk1D325A/D325A homozygotes; NF-κB, nuclear factor-kappa B; WT, wild-type; YS, yolk sac.
(TIF)
(XLSX)
(PDF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.







