Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Aug 1.
Published in final edited form as: Nanomedicine. 2021 Jun 24;36:102418. doi: 10.1016/j.nano.2021.102418

Simultaneous Silencing of Lysophosphatidylcholine Acyltransferases 1–4 by Nucleic Acid Nanoparticles (NANPs) Improves Radiation Response of Melanoma Cells

Renata F Saito 1, Maria Cristina Rangel 1, Justin R Halman 2, Morgan Chandler 2, Luciana Nogueira de Sousa Andrade 1, Silvina Odete-Bustos 1, Tatiane Katsue Furuya 1, Alexis Germán Murillo Carrasco 1, Adriano B Chaves-Filho 3, Marcos Y Yoshinaga 3, Sayuri Miyamoto 3, Kirill A Afonin 2,*, Roger Chammas 1,2,*
PMCID: PMC8403145  NIHMSID: NIHMS1717640  PMID: 34171470

Abstract

Radiation induces the generation of Platelet-activating factor receptor (PAF-R) ligands, including PAF and oxidized phospholipids. Alternatively, PAF is also synthesized by the biosynthetic enzymes lysophosphatidylcholine acyltransferases (LPCATs) which are expressed by tumor cells including melanoma. The activation of PAF-R by PAF and oxidized lipids triggers a survival response protecting tumor cells from radiation-induced cell death, suggesting the involvement of the PAF/PAF-R axis in radioresistance. Here, we investigated the role of LPCATs in the melanoma cell radiotherapy response. LPCAT is a family of four enzymes, LPCAT1–4, and modular nucleic acid nanoparticles (NANPs) allowed for the simultaneous silencing of all four LPCATs. We found that the in vitro simultaneous silencing of all four LPCAT transcripts by NANPs enhanced the therapeutic effects of radiation in melanoma cells by increasing cell death, reducing long-term cell survival, and activating apoptosis. Thus, we propose that NANPs are an effective strategy for improving radiotherapy efficacy in melanomas.

Keywords: Radiotherapy, Platelet-activating factor, lysophosphatidylcholine acyltransferase, nucleic acid nanoparticles (NANPs), RNA nanotechnology

Graphical Abstract

graphic file with name nihms-1717640-f0001.jpg

The membrane phospholipid phosphatidylcholine (PC) is remodeled by phospholipase A2 activity, which removes fatty acids (typically arachidonic acid) from the sn-2 position of PC, resulting in Lyso-PAF. The reverse reaction is catalyzed by LPCAT1–4 acyltransferase activity. The intermediate Lyso-PAF can be converted to PAF by LPCAT1 and LPCAT2 acetyltransferase activity and once produced, PAF is rapidly degraded to lyso-PAF by PAF acetylhydrolases (PAF-AH). With PAF playing a critical role in cancer cells’ survival, we explored in the present work a modular nucleic acid nanoparticle (NANP)-based strategy for interference in PAF production by the simultaneous silencing of all four LPCAT enzymes. Our results show that in vitro silencing of LPCAT1–4 radiosensitizes melanoma cells and they encourage further investigation for the future translation of this strategy into the clinic.

Introduction

Radiotherapy is a standard practice in cancer treatment initially designed to induce cell death of tumor cells as a primary consequence of the DNA double-strand breaks produced by radiation (1). However, radiation-induced cell death can also produce mediators that accelerate the growth of surviving cells and induce an anti-inflammatory microenvironment that favors tumor repopulation (2). One of these mediators is the platelet-activating factor (PAF), a bioactive phospholipid released into the injured sites early in the inflammatory response (3) and is also directly induced by radiotherapy (4). PAF acts via its membrane-associated receptor, PAF-R, a G-protein coupled receptor that is widely expressed in immune cells, non-tumor cell types (e.g., keratinocytes, fibroblasts, platelets), and also in tumor cells (5). Besides PAF, a series of oxidized phospholipids can also bind to PAF-R, activating the downstream signaling pathway. This lipid mediator has a range of physiological effects, participating in wound healing, physiological inflammation, angiogenesis, apoptosis, and reproduction (5). In tumors, the PAF/PAF-R pathway is involved in inflammation, oncogenic transformation, tumor growth, angiogenesis, and metastasis (6).

Previous studies have linked the PAF/PAF-R axis with cellular responses to irradiation. PAF-R expression is elevated after irradiation exposure in cervical and prostate (7, 8) cancer cells. In both studies, PAF-R inhibition by an antagonist enhanced the sensitivity of cancer cells to radiotherapy. As mentioned above, radiation also generates PAF-R agonists, including PAF and multiple oxidized glycerophosphocholines (ox-GPC), that are related to systemic immunosuppressive effects (4, 9). This evidence suggests that interfering in the PAF/PAF-R pathway could represent a potential therapeutic strategy to improve the antitumoral effectiveness of radiotherapy. The main focus of research interfering in the PAF/PAF-R axis has specifically been on blocking PAF-R using antagonists; however, despite the previous development of several PAF-R antagonists, none have been approved for safe clinical use in cancer patients (10). Another way to interfere in the PAF/PAF-R axis is through inhibiting PAF-R agonists’ production. Irradiation-derived ox-GPC are in part generated non-enzymatically due to reactive oxygen species from irradiation which can be blocked by antioxidants. Nevertheless, PAF can still be produced enzymatically by the remodeling pathway. This biosynthesis route involves the remodeling of cell membrane phospholipids by phospholipase A2 (PLA2), generating arachidonic acid (AA) and lyso-PAF that can be converted into PAF through the activity of lysophosphatidylcholine acyltransferase (LPCAT) enzymes (11, 12). LPCATs have been presumed to be potential biomarkers of cancer, although the exact role of LPCATs implicated in this pathological condition remains unknown (13).

Four enzymes—LPCAT1, LPCAT2, LPCAT3, and LPCAT4—constitute the LPCAT family. Among them, LPCAT1 and LPCAT2 are known to be involved in PAF remodeling production (14, 15). LPCAT3 and LPCAT4 mediate the biosynthesis of phosphatidylcholine (PC), a major component of cellular membranes that plays an important role as a PAF precursor (16). Considering that all LPCAT members are involved direct or indirectly in PAF enzymatic biosynthesis, the development of a strategy to inhibit all LPCATs simultaneously to avoid an eventual compensation among these enzymes seems promising to enhance radio-sensitization. Based on this, the aim of the present study was to investigate the role of LPCAT in the anti-tumoral responses of radiotherapy in melanoma cells.

As a means of precisely controlling the simultaneous silencing of all four LPCATs, modular nucleic acid nanoparticles (NANPs) were used in the present study. NANPs composed of either DNA or RNA have been designed and demonstrated to assemble into various shapes and sizes of scaffolds for the coordinated delivery of multiple therapeutic nucleic acids (17–23). With high programmability, NANPs can also be tailored for control over their intended immunostimulation (24, 25) and can be designed to interact with specific targets in the biological environment for decreased off-target toxicity (26, 27). While NANPs still encounter barriers such as degradation in blood serum and need for a delivery vehicle which deter progress towards their further clinical translation, their increasing use for a variety of therapeutic applications has been demonstrated by more systematic studies in vivo (19, 28–30). Here, by extension of the sequences in the NANP’s composition, planar RNA rings (31, 32) were functionalized with Dicer Substrate (DS) RNAs designed to undergo intracellular Dicer-assisted release of four different siRNAs for the simultaneous targeting of all four LPCAT mRNAs via RNA interference (RNAi).

Our results showed that the in vitro simultaneous delivery of siRNAs against all four LPCATs by functional NANPs in irradiated melanoma cells was able to improve the anti-tumoral response of melanoma cells to radiotherapy by increasing cell death, blocking long-term cell survival, and activating apoptosis.

Methods

Synthesis of RNA rings.

All sequences for the assembly of RNA rings are available in the Supporting Information. Sense RNA strands were purchased from Integrated DNA Technologies (IDT, Inc.). Monomers of the RNA ring were prepared via in vitro run-off transcription. For this, the DNA template and primer strands (IDT, Inc.) corresponding to each RNA ring monomer were PCR-amplified using 2X MyTaq Mix (Bioline) to net double-stranded DNA templates containing T7 RNA promotor sequences. These templates were further purified using DNA Clean & Concentrator kits (Zymo Research) prior to undergoing in vitro transcription with T7 RNA polymerase in the presence of 5 mM rNTPs, 50 mM DTT, 25 mM MgCl2, 2.5 mM spermidine, 80 mM HEPES-KOH (pH 7.5) for 3.5 hours at 37 °C. Transcription reactions were stopped with the addition of RQ1 RNase-Free DNase (Promega) for 30 minutes (min) at 37 °C. Afterwards, the RNA was purified using denaturing polyacrylamide gel electrophoresis (PAGE) with 8 M urea which was run in 89 mM tris-borate (pH 8.20) buffer with 2 mM EDTA (1X TBE) for 1.5 hours at 75 mA. RNA samples were visualized in the gel using a UV-lamp to be cut and eluted in 300 mM NaCl, 1X TBE buffer overnight prior to precipitation in two volumes of 100% ethanol. Samples were centrifuged for 30 min at 10.0 G, rinsed with 90% ethanol and centrifuged twice for 10 min at 10.0 G, and vacuum-dried. All RNA ring strands were resuspended in endotoxin-free water (HyClone).

Hexameric RNA rings were assembled one-pot using equimolar amounts of the synthesized RNA ring strands and sense RNA strands. For GFP rings, four equivalents of the GFP sense RNA strand were added. Concentrations of each RNA strand were calculated based on the absorbance at 260 nm measured using a NanoDrop 2000 (Thermo Fisher Scientific). Once equimolar amounts were added in endotoxin-free water (HyClone), the sample was heated to 95 °C for 2 min and snap-cooled on ice for 2 min. Assembly buffer (final concentration of 89 mM tris-borate (pH 8.20), 2 mM MgCl2, 50 mM KCl) was added to the sample, which was then incubated at 30 °C for 30 min.

Characterization of RNA rings.

To confirm their assembly, RNA rings were visualized using 8% non-denaturing native-PAGE (37.5:1). Samples were loaded and run for 20 min (Mini-PROTEAN® Tetra Cell, Bio-Rad) at 4 ° C and 300 V in 89 mM tris-borate (pH 8.20), 2 mM MgCl2. Ethidium bromide total staining was used to visualize on a ChemiDoc MP System (Bio-Rad). Atomic force microscopy (AFM) was performed as previously described (23) using a MultiMode AFM Nanoscope IV system in tapping mode with freshly cleaved mica treated with 1-(2-aminopropyl) silatrane.

In silico analysis of LPCATs gene expression between tumor and non-tumor samples.

Processed RNA-seq data of malignant melanoma samples from the TCGA repository and skin (non-tumoral) samples from the GTEx database were downloaded using the Xena browser from the University of California Santa Cruz (33). Normalized data were filtered to select information for LPCAT1, LPCAT2, LPCAT3, and LPCAT4 genes. All data was plotted as log2(counts+1) values according to tumor (from TCGA) or non-tumor (from GTEx) groups. Statistical analyses were performed using the Mann-Whitney test with Bonferroni correction.

In silico analysis of LPCATs gene expression among samples from E-GEOD-46517 study.

Processed microarray data from E-GEOD-46517 were used to analyze the expression of LPCATs genes in a different cohort of patients (34). These data were produced with the human Affymetrix U133A microarray chip, and downloaded from the ArrayExpress server (https://www.ebi.ac.uk/arrayexpress). Here, we compared clinical data with normalized expression values by the Robust Multi-Array Average (RMA) method of the next probes: 201818_at for LPCAT1, 202793_at for LPCAT3, and 40472_at for LPCAT4. No probes for LPCAT2 were included in this microarray panel. We compared LPCATs expression among different stages of melanoma progression (nevus, primary and metastatic melanoma). Additionally, we also compared LPCATs gene expression levels between early (stages I-II) and advanced (stages III-IV) disease for primary and metastatic melanoma samples, when this information was available. All values were plotted in a violin format and statistical comparisons were performed using the Mann-Whitney test with Bonferroni correction.

Cell lines and culture conditions.

Human melanoma cells A375 were purchased from ATCC and SK-MEL-05 were kindly donated by Lloyd J. Old, Ludwig Institute for Cancer Research and Memorial Sloan Kettering Cancer Center. A375 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (FBS, Gibco) and SK-MEL-05 were cultured in DMEM supplemented with 10% FBS and pyrurate (1 mM). All cell cultures were maintained at 37 °C under a humidified atmosphere of air containing 5% CO2. Cells were regularly tested and were free of Mycoplasma contamination.

Functional RNA rings and control siRNA transfection experiments.

RNA rings (10 nM final) or free siRNA (10 nM final) and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fischer Scientific) were complexed in Opti-MEM® Medium (Thermo Fisher Scientific) and added to 24 multiwell plates. Following this, melanoma cells were added to be 60–80% confluent and were incubated for 48 hours. After reverse transfection, culture medium was changed and cells were irradiated with one single dose of X-radiation (2.5Gy) and incubated at different time-points. RNA ring functionalized with siRNA against green fluorescence protein (Ring GFP), rings without any siRNA (Ring CTL), siRNA scramble, or non-transfected cells (CTL) were used as controls.

Cell irradiation.

Cell irradiation studies were conducted using an IBL136 cell with single 2.5 Gy dose of X-ray irradiation performed in R2000 small animal irradiator (©Rad Source Technologies |©Quastar™). The machine has a 0.3 mm copper filter and X-ray tube settings were 160 kVp and 25 mA (Rad Source Technologies).

Total RNA extraction and quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR).

Total RNA was extracted using TRIzol™ Reagent (Thermo Fisher Scientific) from 1×106 melanoma cells according to the manufacturer’s protocol. RNA purity and integrity were determined by spectrophotometry (NanoDrop™ 1000 Spectrophotometer, Thermo Fisher Scientific) and gel electrophoresis, respectively. Total RNA was reverse transcribed to cDNA using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). The expression levels of LPCAT genes were quantified using SYBR Green fluorescence (Thermo Fisher Scientific) in the StepOnePlus Real-Time PCR system (Thermo Fisher Scientific), using the default cycling conditions recommended by the manufacturer. Each sample was run in triplicate and GAPDH gene was used as endogenous control. Fold Change was calculated using the comparative CT method (2−ΔΔCT). The primer sequences for LPCAT and GAPDH genes are described in Table 1.

Table 1.

Primer sequences for the analysis of gene expression by quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR).

Gene Product length (bp) Primer sequences

LPCAT1 144 Forward 5’- TCAGACCAGGATTCTCGCAG -3’

Reverse 5’- GAATGCACCAGGTTTGAAGGT -3’

LPCAT2 138 Forward 5’- GTCCTCCTCAGATACCCAAACA -3’

Reverse 5’- TGGTACTTGAACTGGCATAAACTCA -3’

LPCAT3 168 Forward 5’- TCCTCATCCTTCGACTAATGGG -3’

Reverse 5’- CAGCCAAACCAATCAGCTTCAA -3’

LPCAT4 125 Forward 5’- TCAAACCAGGAGCCTTCATCG -3’

Reverse 5’- TGTGAGCCAGAGGACTTTGAG -3’

GAPDH 87 Forward 5’-TGCACCACCAACTGCTTAGC -3’
Reverse 5’-GGCATGGACTGTGGTCATGAG -3’

bp: base pair

DNA content analysis by propidium iodide staining (PI).

All cells were cultured in triplicates in 24-well plates (2×104 cells), transfected with RNA rings, and exposed to irradiation. After 48 hours, cells were analyzed for their DNA content by PI staining for the evaluation of sub-G1 population. Cells were harvested by trypsinization, fixed in 70% ethanol, and analyzed by flow cytometry (Attune™ Acoustic Focusing Cytometer, Thermo Fischer Scientific). Next, cells were washed with phosphate-buffered saline (PBS), centrifuged for 4 min at 2000 rpm, and incubated in PI solution (20 μg/mL of propidium iodide, 200 μg/mL of RNAse A, and 0.1% of Triton X-100 in PBS) for 30 min protected from light. The cellular DNA content was analyzed using the Attune software.

Caspase 3/7 activation assay.

LPCAT1–4 or control rings were transfected in melanoma cells and irradiated (2.5 Gy). After different time-points (15 min, 30 min and 24 h) post-irradiation the medium was removed from the cells, then CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fischer Scientific) was added and diluted into complete medium (2–10 μM). Melanoma cells were incubated at 37 °C for at least 30 min. Following this, fluorescence emission (502/530 nm) was acquired in flow cytometry (Attune™ Acoustic Focusing Cytometer, Thermo Fisher Scientific) and mean fluorescence intensity (MFI) was calculated using FlowJo software.

Lipid extraction.

Lipid extraction was performed according to the method established by Yoshida et al. (2008) with modifications (35). A375 melanoma cells were transfected in complete medium with RNA rings and then irradiated (2.5 Gy) in FBS-free culture medium. After 15 min of being exposed to irradiation, cells were pelleted and 1.1 mL of PBS pH 7.4 (Thermo Fisher Scientific) was added and cells were homogenized. Next, 500 μL of cell homogenate was mixed with 500 μL of ice-cold methanol containing 10 μM butyl hydroxytoluene (BHT) and 20 μL of 5 μg mL−1 Lyso-PAF 17:0, used as internal standard. After that, 1.5 mL of chloroform/ethyl acetate (4:1) was added to the mixture, which was thoroughly vortexed for 30 s. After centrifugation at 1500 g for 5 min at 4 °C, the lower phase containing the total lipid extract was transferred to a new tube and dried under nitrogen gas. Dried lipid extracts were redissolved in 70 μL of isopropanol and the injection volume for mass spectrometry was set at 3 μL.

Mass spectrometry (MS) studies for Lyso-PAF analysis and data processing.

Samples were analyzed by ultra-high performance liquid chromatography (UHPLC Nexera, Shimadzu, Kyoto, Japan) coupled to electrospray ionization time-of-flight mass spectrometer (ESI-Q-TOFMS, Triple TOF® 6600, Sciex, Concord, US). Chromatographic conditions were followed exactly as described by Chaves-Filho et al. (2019) (36). The MS was operated in both positive and negative ionization modes, and the scan range set at a mass-to-charge ratio of 50–2000 Da. Data acquisition using Analyst® 1.7.1 was performed with a cycle time of 0.270 s with 20 ms acquisition time for precursor (MS1) and fragment (MS2) ions scan. An ion spray voltage of 5.5 kV and −4.5 kV, cone voltage at +/−80 V, and collision energy at +/−45 eV were set for positive and negative ionization modes, respectively. Additional parameters included curtain gas set at 25 psi, nebulizer and heater gases at 45 psi and interface heater of 450 °C. The Liquid chromatography-tandem mass spectrometry (LC-MS/MS) data were analyzed with PeakView®. Data for lipid identification was obtained by targeted MS/MS analysis of precursor ions corresponding to PAFs in negative ionization mode (see Table 2 and Figure S2). Analytes were identified based on their exact masses and fragments. To improve sensitivity, quantification of identified PAFs was performed in positive ionization mode by using the high-resolution m/z of precursor ions and retention time (see Table 2 and Figure S2). Also, a maximum error of 5 mDa was defined for the attribution of the precursor ion. For semi-quantification, the area ratio of Lyso-PAFs was calculated by dividing their peak area by the internal standard (Lyso-PAF 17:0) using MultiQuant® software. The concentration of PAF species was calculated by multiplying the area ratio by the concentration of the internal standard and expressed in pmol/106 cells. Data from one experiment in duplicate (n = 2) are presented as mean ± standard deviation (SD).

Table 2.

Theoretical m/z of PAFs searched in positive and negative ionization modes.

PAFs Negative ionization mode [M+OAc]− Positive ionization mode [M+H]+
Lyso-PAF (16:0) 540.3671 482.3605
PAF (16:0/2:0) 582.3776 524.3711
PAF (16:0/4:0) 610.4089 552.4024
PAF (16:0/4:1) 608.3933 550.3867
Lyso-PAF (18:0) 568.3984 510.3918
PAF (18:0/2:0) 610.4089 552.4024
PAF (18:0/4:0) 638.4402 580.4337
PAF (18:0/4:1) 636.4246 578.418
Lyso-PAF (18:1) 566.3827 508.3761
PAF (18:1/2:0) 608.3933 550.3867
PAF (18:1/4:0) 636.4246 578.418
PAF (18:1/4:1) 634.4089 576.4024
Lyso-PAF (17:0) (Internal standard) 554.3827 496.3762

Statistical analysis.

All statistical analyses were performed with the GraphPad Prism 5.0 software. One-way ANOVA test was used for multi-group comparisons followed by Bonferroni post-hoc analysis. Differences were considered statistically significant if the probability value was less than 0.05 and a representative of three independent experiments data are presented as mean (± SD).

Results

Characterization of NANPs designed for LPCAT1–4 silencing.

The specific NANPs used in this study have a distinct and strategic design that confer the delivery of siRNAs against all four LPCATs on a planar RNA ring. Assembly of these RNA rings initially requires intramolecular Watson-Crick base pairing to further facilitate magnesium-dependent intermolecular kissing loop interactions (Figure 1A, upper panel). Rationally designed NANPs can be further decorated with cocktails of therapeutic nucleic acids and, in this study, NANPs were functionalized with four different DS RNAs that, upon intracellular dicing, release siRNAs designed to silence LPCAT1–4 mRNAs through RNAi (Figure 1A, lower panel). We will refer to these NANPs as LPCAT rings further in text. All assembled LPCAT rings were analyzed by native-PAGE and AFM, as shown in Figure 1B, to confirm the correct assembly. A lipid-based transfection agent was used throughout all subsequent studies for the delivery of LPCAT rings into cells.

Figure 1. Characterization of RNA rings functionalized with LPCATs siRNAs.

Figure 1.

(A) Schematic representation of assemblies leading to the formation of RNA rings functionalized with LPCAT1–4 Dicer Substrate (DS) RNAs and summary of LPCAT1–4 genes silencing mechanism by functional RNA rings. Rings’ delivery inside the cells in the cytosol is required for Dicer-assisted release of siRNAs, by which the RNAi pathway is activated. (B) Structural characterization by AFM and native-PAGE of RNA rings functionalized with different numbers of DS RNAs designed to silence LPCAT1–4 genes.

In silico analyses of LPCATs gene expression in human melanoma samples.

Our in silico analysis showed that the LPCAT gene family is involved in melanoma malignance and progression. Processed RNA-seq data of melanoma samples showed higher levels of LPCAT1 and LPCAT2, whereas in these samples, LPCAT3 and LPCAT4 were sub-expressed in melanoma samples as compared to non-tumor samples (Figure 2A). Additionally, we performed another in silico analysis based on the available data in a microarray study (E-GEOD-46517). LPCAT1 expression was significantly higher in metastatic melanoma compared with primary melanoma or non-tumor samples. Conversely, LPCAT3 expression was decreased in metastatic and primary melanoma compared with non-tumor samples (Figure 2B). Additionally, LPCAT1 was also overexpressed in late stages of melanoma (III and IV) (Figure 2C). Of note, LPCAT2 was not investigated in this microarray study.

Figure 2. Gene expression levels of LPCATs genes in human samples.

Figure 2.

(A) In silico analyses of RNA-seq data show that melanoma samples presented higher levels of LPCAT1 and LPCAT2, whereas they expressed lower levels of LPCAT3 and LPCAT4 when compared with non-tumor samples. (B) Analysis of microarray data reveals that LPCAT1 is overexpressed in metastatic melanoma when compared with primary melanoma or non-tumor samples, contrasting to lower levels of LPCAT3 according to disease progress. (C) Patients with primary or metastatic melanoma show higher levels of LPCAT1 gene in advanced stages of their disease. All p-values were estimated with the Mann-Whitney test, and adjusted with the Bonferroni correction. n.s.: non-significant; *: p-adj<0.05; **: p-adj<0.01; ***: p-adj<0.001. Legend: RMA (Robust Multi-Array Average).

LPCAT1–4 rings are efficient in silencing LPCAT1–4 and generate Lyso-PAF accumulation.

LPCAT1–4 rings were shown to successfully silence the expression of all four LPCATs with approximately 70% reduction in each LPCAT gene expression (Figure 3C). Interestingly, it was also observed that a compensatory effect could occur when less than four LPCATs were targeted. In particular, an upregulation of LPCAT1 was observed when only LPCAT2, 3, and 4 were silenced (Figure 3B). However, this was not the case for the other combinations of LPCAT rings described below (Figure 4A). These findings additionally demonstrate that it is crucial to simultaneously target all four LPCATs in order to avoid the possibility of compensatory effects of individual LPCATs.

Figure 3. Compensatory effect of LPCAT1 mRNA increase upon the simultaneous silencing of LPCAT2, LPCAT3, and LPCAT4 by RNA ring.

Figure 3.

Metabolic pathway mediated by acyltransferase and acetyltransferase activity of LPCATs enzymes (A). Melanoma cells (A375) were transfected with RNA rings functionalized with siRNAs targeting LPCAT2, LPCAT3, and LPCAT4 (B) or all four LPCATs (C). Forty-eight hours after transfection, LPCAT 1–4 mRNA levels were evaluated by quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) and RNA rings functionalized with 3 or 4 siRNAs against GFP (Green Fluorescence Protein) were used as a control. Lyso-PAF quantification by high resolution mass-spectrometry in LPCAT1–4 silenced and irradiated melanoma cells. Melanoma cells (A375) were transfected with RNA rings (Control or LPCAT1–4) and 15 minutes after radiation exposure (2.5 Gy), cells were collected and lipid extraction was performed. Mass-spectrometry was operated in both positive and negative ionization modes, for the identification and quantification of Lyso-PAFs (16:0 and 18:0) (D and E, respectively). Total amounts of Lyso-PAFs are expressed in pmol/106 cells. One-way ANOVA followed by Bonferroni post hoc test. *P< 0.05, **P< 0.01, *** P< 0.001. Legend: phosphatidylcholine (PC), Lyso-platelet activating factor (Lyso-PAF), platelet activating factor (PAF), PAF-acetylhydrolase (PAF-AH), Lysophosphatidylcholine Acyltransferase (LPCAT).

Figure 4. LPCATs silencing sensitizes melanoma cells to irradiation-induced cell death.

Figure 4.

A375 melanoma cells were transfected with RNA rings functionalized with different combinations of siRNAs against LPCAT1–4 or GFP genes. 48 hours post-transfection, cells were irradiated with 2.5 Gy X-Rays. Cell death was evaluated by propidium iodide (PI) staining 48 hours post-irradiation (A). Cell death was measured as the percentage of total cell population with the subG1 DNA content before and after irradiation. (B) Phase-contrast images were captured from each condition. One-way ANOVA followed by Bonferroni post hoc test. (*) significantly different from control. (#) significantly different from GFP Ring. */#P< 0.05, **/##P< 0.01, ***/### P< 0.001.

LPCAT1–4 exert acyl-CoA-dependent lysophospholipid acyltransferase activity, converting lysophosphatidylcholine (LPC) into phosphatidylcholine (PC) (http://www.genecards.org). Additionally, LPCAT1 and LPCAT2 exhibit both acyltransferase and acetyltransferase activities, catalyzing the conversion of Lyso-PAF (1-O-alkyl-sn-glycero-3-phosphocholine) into PAF (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) (13). To define if the silencing of LPCAT1–4 was interfering in the phospholipid metabolic flow regulated by these enzymes (Figure 3A), we used mass spectrometry studies to identify and quantify Lyso-PAFs and PAF species. We observed an increase in the total amount of Lyso-PAF (16:0 and 18:0) (Figure S2) in A375 melanoma cells silenced for LPCAT1–4; however, these lipids were not modulated by irradiation (Figure 3D and E). Of note, PAF species (Table 2) were not detected in any of the experimental conditions evaluated.

Silencing of LPCATs sensitizes melanoma cells to irradiation-induced cell death.

To investigate the role of LPCAT1–4 genes in melanoma resistance to irradiation, we examined cell death induction by propidium iodide (PI) staining to detect subG1 content 48h post-irradiation in LPCATs silenced cells compared to controls. Melanoma A375 cells were transfected with RNA rings functionalized with two, three, or four siRNAs against each LPCAT and exposed to a single dose of irradiation (2.5 Gy). All experiments were delineated with 2.5 Gy, a similar dose to the maximum used in the clinic for the management of advanced or disseminated melanoma (37), and siRNA combinations were randomly chosen. We compared LPCAT rings with control rings functionalized with identical numbers of DS RNAs designed against GFP, herein referred as GFP rings. As a result, we verified an increase in subG1 percentage when all four LPCATs were simultaneously silenced in non-irradiated cells (Figure 4A). Additionally, silencing of at least two LPCATs (e.g., LPCAT 2 and 3 or LPCAT 1 and 4) resulted in an increase of subG1 cells when irradiated (2.5 Gy) compared to controls (irradiated GFP2 RNA rings or non-irradiated groups). Rounded and detached cells were present when at least two LPCATs were silenced in cells either irradiated or not, although it was more evident when all LPCATs were silenced, which was followed by a drastic decrease in cell number (Figure 4B).

The same results were obtained using free siRNAs against all LPCATs (Figure S1A). A375 and SK-MEL-5 melanoma cells were transiently transfected with LPCAT1–4 siRNAs and subsequently exposed to irradiation (2.5 Gy). In both cell lines, analyses of subG1 cells showed a higher percentage of apoptotic cells in the LPCAT1–4 silenced group compared to controls (non-transfected and siRNA scramble) and a significant increase in subG1 was also observed in the irradiated LPCAT1–4 silenced group in comparison to the non-irradiated LPCAT1–4 silenced group (Figure S1B). These results revealed that simultaneous silencing of all four LPCATs sensitize melanoma cells to irradiation-induced cell death.

LPCATs inhibition decreases long-term survival capacity in melanoma cells after irradiation.

Next, melanoma cell long term survival after LPCAT1–4 ring silencing and irradiation was tested by a clonogenic survival assay. Data revealed that silencing all four LPCATs reduced the number of clones formed in non-irradiated melanoma cells and this reduction was evidenced when the cells were irradiated (Figure 5A). The colony formation inhibition in irradiated silenced LPCAT cells can be visualized in clonogenic plates represented in Figure 5B. These findings demonstrate that LPCAT1–4 silencing enhances the radiation sensitivity of melanoma cells with a decreased survival ability over a long-term period.

Figure 5. LPCAT 1–4 inhibition by RNA rings reduces colony formation ability upon irradiation.

Figure 5.

LPCAT1–4 genes were silenced with RNA rings functionalized with siRNAs against all four LPCATs in A375 melanoma cells. These cells were irradiated with 2.5 Gy X-Rays and after 48h they were seeded in a very low confluence and grown for about 2 weeks, then surviving colonies were stained with crystal violet. Bar graph quantification of colonies number in each experimental group (A). A representative photograph of petri dishes containing colonies is shown (B). One-way ANOVA followed by Bonferroni post hoc test. (*) significantly different from control. (#) significantly different from GFP Ring. */# P< 0.05, **/## P< 0.01, ***/### P< 0.001. Legend: CTL (control).

Silencing of LPCATs activates apoptosis.

Activation of executioner caspases is a distinctive feature of early stages of apoptosis. To explore LPCATs’ relevance in increasing irradiation-induced cell death, caspase 3/7 activation was evaluated in irradiated melanoma cells transfected with control or LPCAT1–4 rings. Data shown in Figure 6 revealed that upon irradiation, LPCATs 1–4 silencing increased the percentage of activated caspase 3/7 compared to the corresponding irradiated ring control group or non-irradiated LPCAT1–4 cells. Notably, silencing of all LPCATs also induced caspase 3/7 activation in non-irradiated cells. Therefore, these results reveal that silencing of LPCAT1–4 induced apoptotic cell death in irradiated melanoma cells.

Figure 6. LPCATs silencing by RNA rings induces caspase 3/7 activation.

Figure 6.

LPCAT1–4 genes were silenced with RNA rings for 48hours in A375 melanoma cells. Following irradiation with 2.5 Gy X-Rays, the percentage of activated caspase 3/7 was measured 48 hours post-irradiation. One-way ANOVA followed by Bonferroni post hoc test. *P< 0.05, **P< 0.01, *** P< 0.001. Legend: neg: (unstained cells).

Discussion

Here we explored an RNA nanotechnology-based approach to inhibit PAF production by silencing the complete LPCAT gene family as a strategy to sensitize melanoma cells to irradiation-induced cell death. Modular NANPs targeting LPCAT1–4 genes were developed de novo to simultaneously target—via Dicer-initiated RNA interference—all four LPCAT mRNAs. These NANPs successfully silenced LPCAT1–4 (Figure 3C) and significantly increased the cell death rate of irradiated melanoma cells (Figure 4). Notably, LPCAT1–4 silencing also decreased melanoma cells’ long-term survival ability after irradiation (Figure 5). Our data exclude the possibility that the observed effects of LPCAT1–4 silencing are unspecific, mediated by the RNA rings by themselves, since we did not observe cell death induction by NANPs designed to target GFP. This indicates that the amount of nucleic acids present in the rings is not interfering in the biological response observed here. LPCATs have a critical role in metabolizing Lyso-PAF into phosphatidylcholine (LPCAT1–4) or PAF (LPCAT1 and LPCAT2) (Figure 3A). Interruption of this metabolic flow by LPCAT1–4 silencing resulted in Lyso-PAF accumulation as predicted (Figure 3D and E). Increased levels of Lyso-PAF could precondition melanoma cells to radiation-induced cell death, as shown in hepatocytes. In the latter, a high concentration of Lysophosphatidylcholine disrupted mitochondrial integrity accompanied by enhanced cytochrome C release (38). Furthermore, LPCAT1–4 silencing could result in decreased levels of the pro-survival lipid mediator PAF, which could favor the enhanced radiation cytotoxic effects observed in this study. However, we did not detect PAF in our samples. After being produced, PAF is rapidly metabolized by PAF acetylhydrolases (PAF-AH) into Lyso-PAF, hence the detection of PAF is challenging (39). To our knowledge, there is only one study that has demonstrated PAF generation induced by irradiation (4), where they showed an increase in PAF generation by murine melanoma cells irradiated at a 10 Gy dose. In line with this, the irradiation dose used in our study was four times less intense (2.5 Gy) and could be not enough to generate detectable amounts of PAF by MS. As outlined, our data reinforce the hypothesis that the PAF/PAF-R axis is involved in tumor radio-resistance in melanoma. Indeed, the use of RNA nanotechnology to interfere and inhibit LPCAT represents a promising strategy to improve radio-sensitization of malignant cells. Then, to our knowledge, the present work represents the first effort based on a nanotechnology approach to interfere in the enzymatic pathway of PAF biosynthesis mediated by LPCATs as an antitumoral strategy.

Another important aspect of this work is that our data demonstrated that there was a redundancy among LPCAT1–4 gene family members. The silencing of LPCAT2, 3, and 4 resulted in an increase in LPCAT1 mRNA expression (Figure 3B). This unexpected compensatory effect was not observed in the other combinations of LPCAT silencing. Consistent with this finding, our in silico analysis reveals that LPCAT1 and 2 are upregulated in melanomas compared to non-tumoral samples (Figure 2A) and in particular, LPCAT1 is more overexpressed according to melanoma progression (Figure 2B) and in late stages of the disease (Figure 2C). There is complementary evidence in the literature showing increased LPCAT1 protein levels in murine B16F10 melanoma cells compared to non-tumoral cells (40). These findings suggest that among all LPCAT members, LPCAT1 may play a pivotal role in melanoma malignancy and progression. LPCAT1 is upregulated in several tumors and is related to increased cell proliferation, migration, and metastasis (13). The exact mechanism mediated by LPCAT1 that culminates in these pro-tumoral biological effects is not completely elucidated. One possible mechanism could be through the constitutive activity of lyso-PAF acetyltransferase for the production of PAF which, as already mentioned, is a lipid mediator that plays important roles in cell proliferation and survival. However, the enzymatic activity of LPCAT1 can be pro-tumoral independently of PAF production. Bi et al. (2019) (41) reported that LPCAT1-mediated phospholipid remodeling of the cell membrane was essential for oncogenic receptors to properly localize on the cell surface and is required for the transduction of oncogenic signals. In the same study, targeting of LPCAT1 resulted in the dissociation of these receptors from the cell membrane, blocking their signaling and inducing tumor cell death (40).

Melanoma samples also showed higher levels of LPCAT2 in in silico data (Figure 2A). LPCAT2 possesses biosynthetic activities for PAF; however, different from LPCAT1, it is an inducible lyso-PAF acetyltransferase activated in response to inflammatory stimuli (14). This enzyme catalyzes not only PAF biosynthesis (lyso-PAF acetyltransferase), but also generates membrane glycerophospholipids (LPC acyltransferase), which are precursors of PAF and major membrane constituents. Even though LPCAT2 has been described to be expressed in inflammatory cells, Williams and colleagues (2019) described LPCAT2 as a novel aggressive prostate cancer susceptibility gene (42). To date, there was no evidence of differential expression of LPCAT2 in melanoma; however, in the current study, in silico data showed that LPCAT2 is upregulated in melanomas, providing insights that it can be involved in melanoma tumorigenesis (Figure 2A). Interestingly, LPCAT2-mediated lipid droplet accumulation in colorectal cancer confers chemoresistance to these cells by blocking chemotherapy-induced endoplasmic reticulum stress, calreticulin membrane translocation, and subsequent immunogenic cell death (43). Therefore, silencing LPCAT2 could be a potential oncologic approach to favor immunogenic cell death. Additional work will be required to identify whether the LPCAT1–4 RNA rings approach could induce immunogenic cell death as a consequence of LPCATs’ silencing.

In our study, we show that silencing LPCAT1–4 induces apoptosis with activation of caspase 3/7 (Figure 6); however, we anticipate that since melanoma sensitization is in part mediated by the induction of apoptosis, other cell death process could be involved in this anti-tumoral response. Interestingly, LPCAT3 is involved in a newly identified form of non-apoptotic regulated cell death characterized by iron-dependent accumulation of lipid peroxides. The generation of lipid peroxides from arachidonoyl mediated by LPCAT3 is a major pathway that leads to ferroptosis and lack of LPCAT3 increases resistance to ferroptosis (44–47). Additionally, LPCAT3 is also involved in the production of “find me” signals from ferroptotic tumor cells, mediating antitumor immunity (48–50). These findings open the interpretation that LPCATs can be involved in different cell death processes. LPCAT3 is also linked to intestinal stem cell proliferation by stimulating cholesterol biosynthesis and tumorigenesis and loss of LPCAT3 in Apcmin mice markedly promotes intestinal tumor formation (51). There is little evidence in the literature about the role of LPCAT4 in cancer. LPCAT4 was associated with high levels of PC (16:0/16:1) in colorectal cancer (52). LPCAT3 and LPCAT4 also possess LPC acyltransferase and are functionally linked to plasma membrane remodeling. LPCAT3 and LPCAT4 are involved in the production of building block phospholipids used as a supply of energy required for uncontrolled cell proliferation in cancer cells.

Collectively, these findings highlight the complex interplay of different LPCATs in tumorigenesis. Therefore, the simultaneous silencing of all LPCATs is crucial not only for inhibiting PAF production, but also the production of building block phospholipids used as supplies of energy required for uncontrolled cell proliferation in cancer. Future studies will be needed to further delineate the mechanism involved in the radio-sensitization of melanoma cells by LPCAT1–4 gene silencing. Lastly, additional work will be required to identify, develop, and test LPCAT1–4 RNA rings for targeting LPCATs in melanoma patients. Considering that this nanotechnology allows for the specific targeting of tumor cells by decorating the rings with tumor-specific surface markers, it can be very promising for the future translation into the clinic.

Supplementary Material

1
2
3

Acknowledgements

Research reported in this publication was supported by the National Institute of General Medical Sciences of the National Institutes of Health under Award Numbers R01GM120487 and R35GM139587 (to K.A.A.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. This research was also supported in part by a FAPESP-USP SPRINT grant from The Graduate School at the University of North Carolina at Charlotte (to K.A.A.) and Sao Paulo Research Foundation (FAPESP) under FAPESP Grants 2017/50029-6 (to RC) and CNPq grants 426714/2016-0 and 305700/2017-0. S.M. and A.B.C.F. were supported by FAPESP (grant 2013/07937-8) and M.Y.Y. by CAPES. The authors would also like to thank Dr. Alexander Lushnikov and Dr. Alexey Krasnoslobodtsev for performing AFM imaging at the Nanoimaging Core Facility at the University of Nebraska Medical Center; and Mara de Souza Junqueira, MSc for performing cell irradiation at the University of São Paulo.

The authors declare no commercial associations that could be construed as a potential conflict of interest. This work was supported by grants CNPq 426714/2016-0 and 305700/2017-0; and FAPESP/SPRINT 17/50029-6 to R.C.; and R35GM139587 and R01GM120487 to K.A.A.

Footnotes

Disclaimer

All authors declare no financial conflict of interest associated with this study.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Sia J, Szmyd R, Hau E, Gee HE. Molecular Mechanisms of Radiation-Induced Cancer Cell Death: A Primer. Front Cell Dev Biol. 2020;8:41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rodriguez-Ruiz ME, Vitale I, Harrington KJ, Melero I, Galluzzi L. Immunological impact of cell death signaling driven by radiation on the tumor microenvironment. Nat Immunol. 2020;21(2):120–34. [DOI] [PubMed] [Google Scholar]
  • 3.Birkl D, Quiros M, García-Hernández V, Zhou DW, Brazil JC, Hilgarth R, et al. TNFα promotes mucosal wound repair through enhanced platelet activating factor receptor signaling in the epithelium. Mucosal Immunol. 2019;12(4):909–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sahu RP, Harrison KA, Weyerbacher J, Murphy RC, Konger RL, Garrett JE, et al. Radiation therapy generates platelet-activating factor agonists. Oncotarget. 2016;7(15):20788–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lordan R, Tsoupras A, Zabetakis I, Demopoulos CA. Forty Years Since the Structural Elucidation of Platelet-Activating Factor (PAF): Historical, Current, and Future Research Perspectives. Molecules. 2019;24(23). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Jancar S, Chammas R. PAF receptor and tumor growth. Curr Drug Targets. 2014;15(10):982–7. [PubMed] [Google Scholar]
  • 7.da Silva-Junior IA, Dalmaso B, Herbster S, Lepique AP, Jancar S. Platelet-Activating Factor Receptor Ligands Protect Tumor Cells from Radiation-Induced Cell Death. Front Oncol. 2018;8:10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yao B, Liu B, Shi L, Li X, Ren C, Cai M, et al. PAFR selectively mediates radioresistance and irradiation-induced autophagy suppression in prostate cancer cells. Oncotarget. 2017;8(8):13846–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.da Silva IA, Chammas R, Lepique AP, Jancar S. Platelet-activating factor (PAF) receptor as a promising target for cancer cell repopulation after radiotherapy. Oncogenesis. 2017;6(1):e296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Papakonstantinou VD, Lagopati N, Tsilibary EC, Demopoulos CA, Philippopoulos AI. A Review on Platelet Activating Factor Inhibitors: Could a New Class of Potent Metal-Based Anti-Inflammatory Drugs Induce Anticancer Properties? Bioinorg Chem Appl. 2017;2017:6947034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Snyder F Platelet-activating factor: the biosynthetic and catabolic enzymes. Biochem J. 1995;305 ( Pt 3):689–705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Venable ME, Zimmerman GA, McIntyre TM, Prescott SM. Platelet-activating factor: a phospholipid autacoid with diverse actions. J Lipid Res. 1993;34(5):691–702. [PubMed] [Google Scholar]
  • 13.Shi C Recent progress of lysophosphatidylcholine acyltransferases in metabolic disease and cancer. In: Shuxuan Qiao SW, Tao Wu, Guang Ji, editor. Int J Clin Exp Med: Int J Clin Exp Med; 2018. p. 8941–53. [Google Scholar]
  • 14.Shindou H, Hishikawa D, Nakanishi H, Harayama T, Ishii S, Taguchi R, et al. A single enzyme catalyzes both platelet-activating factor production and membrane biogenesis of inflammatory cells. Cloning and characterization of acetyl-CoA:LYSO-PAF acetyltransferase. J Biol Chem. 2007;282(9):6532–9. [DOI] [PubMed] [Google Scholar]
  • 15.Harayama T, Shindou H, Shimizu T. Biosynthesis of phosphatidylcholine by human lysophosphatidylcholine acyltransferase 1. J Lipid Res. 2009;50(9):1824–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hishikawa D, Shindou H, Kobayashi S, Nakanishi H, Taguchi R, Shimizu T. Discovery of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity. Proc Natl Acad Sci U S A. 2008;105(8):2830–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dobrovolskaia MA, Afonin KA. Use of human peripheral blood mononuclear cells to define immunological properties of nucleic acid nanoparticles. Nat Protoc. 2020;15(11):3678–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Juneja R, Vadarevu H, Halman J, Tarannum M, Rackley L, Dobbs J, et al. Combination of Nucleic Acid and Mesoporous Silica Nanoparticles: Optimization and Therapeutic Performance In Vitro. ACS Appl Mater Interfaces. 2020;12(35):38873–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Afonin KA, Dobrovolskaia MA, Church G, Bathe M. Opportunities, Barriers, and a Strategy for Overcoming Translational Challenges to Therapeutic Nucleic Acid Nanotechnology. ACS Nano. 2020;14(8):9221–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Halman JR, Kim KT, Gwak SJ, Pace R, Johnson MB, Chandler MR, et al. A cationic amphiphilic co-polymer as a carrier of nucleic acid nanoparticles (Nanps) for controlled gene silencing, immunostimulation, and biodistribution. Nanomedicine. 2020;23:102094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ke W, Hong E, Saito RF, Rangel MC, Wang J, Viard M, et al. RNA-DNA fibers and polygons with controlled immunorecognition activate RNAi, FRET and transcriptional regulation of NF-κB in human cells. Nucleic Acids Res. 2019;47(3):1350–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Rackley L, Stewart JM, Salotti J, Krokhotin A, Shah A, Halman JR, et al. RNA Fibers as Optimized Nanoscaffolds for siRNA Coordination and Reduced Immunological Recognition. Adv Funct Mater. 2018;28(48). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Halman JR, Satterwhite E, Roark B, Chandler M, Viard M, Ivanina A, et al. Functionally-interdependent shape-switching nanoparticles with controllable properties. Nucleic Acids Res. 2017;45(4):2210–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hong E, Halman JR, Shah AB, Khisamutdinov EF, Dobrovolskaia MA, Afonin KA. Structure and Composition Define Immunorecognition of Nucleic Acid Nanoparticles. Nano Lett. 2018;18(7):4309–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Johnson MB, Halman JR, Satterwhite E, Zakharov AV, Bui MN, Benkato K, et al. Programmable Nucleic Acid Based Polygons with Controlled Neuroimmunomodulatory Properties for Predictive QSAR Modeling. Small. 2017;13(42). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ke W, Hong E, Saito RF, Rangel MC, Wang J, Viard M, et al. RNA-DNA fibers and polygons with controlled immunorecognition activate RNAi, FRET and transcriptional regulation of NF-κB in human cells. Nucleic acids research. 2019;47(3):1350–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Johnson MB, Chandler M, Afonin KA. Nucleic acid nanoparticles (NANPs) as molecular tools to direct desirable and avoid undesirable immunological effects. Advanced drug delivery reviews. 2021;173:427–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Halman JR, Kim K-T, Gwak S-J, Pace R, Johnson MB, Chandler MR, et al. A cationic amphiphilic co-polymer as a carrier of nucleic acid nanoparticles (Nanps) for controlled gene silencing, immunostimulation, and biodistribution. Nanomedicine: Nanotechnology, Biology and Medicine. 2020;23:102094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Juneja R, Vadarevu H, Halman J, Tarannum M, Rackley L, Dobbs J, et al. Combination of Nucleic Acid and Mesoporous Silica Nanoparticles: Optimization and Therapeutic Performance In Vitro. ACS applied materials & interfaces. 2020;12(35):38873–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Afonin KA, Viard M, Koyfman AY, Martins AN, Kasprzak WK, Panigaj M, et al. Multifunctional RNA Nanoparticles. Nano Letters. 2014;14(10):5662–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Grabow WW, Zakrevsky P, Afonin KA, Chworos A, Shapiro BA, Jaeger L. Self-assembling RNA nanorings based on RNAI/II inverse kissing complexes. Nano Lett. 2011;11(2):878–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Afonin KA, Viard M, Koyfman AY, Martins AN, Kasprzak WK, Panigaj M, et al. Multifunctional RNA nanoparticles. Nano Lett. 2014;14(10):5662–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Goldman MJ, Craft B, Hastie M, Repečka K, McDade F, Kamath A, et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol. 2020;38(6):675–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kabbarah O, Nogueira C, Feng B, Nazarian RM, Bosenberg M, Wu M, et al. Integrative genome comparison of primary and metastatic melanomas. PLoS One. 2010;5(5):e10770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yoshida Y, Kodai S, Takemura S, Minamiyama Y, Niki E. Simultaneous measurement of F2-isoprostane, hydroxyoctadecadienoic acid, hydroxyeicosatetraenoic acid, and hydroxycholesterols from physiological samples. Anal Biochem. 2008;379(1):105–15. [DOI] [PubMed] [Google Scholar]
  • 36.Chaves-Filho AB, Pinto IFD, Dantas LS, Xavier AM, Inague A, Faria RL, et al. Alterations in lipid metabolism of spinal cord linked to amyotrophic lateral sclerosis. Sci Rep. 2019;9(1):11642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Strojan P Role of radiotherapy in melanoma management. Radiol Oncol. 2010;44(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hollie NI, Cash JG, Matlib MA, Wortman M, Basford JE, Abplanalp W, et al. Micromolar changes in lysophosphatidylcholine concentration cause minor effects on mitochondrial permeability but major alterations in function. Biochim Biophys Acta. 2014;1841(6):888–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Travers JB, Rohan JG, Sahu RP. New Insights Into the Pathologic Roles of the Platelet-Activating Factor System. Front Endocrinol (Lausanne). 2021;12:624132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bao J, Liu F, Zhang C, Wang K, Jia X, Wang X, et al. Anti-melanoma activity of Forsythiae Fructus aqueous extract in mice involves regulation of glycerophospholipid metabolisms by UPLC/Q-TOF MS-based metabolomics study. Sci Rep. 2016;6:39415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bi J, Ichu TA, Zanca C, Yang H, Zhang W, Gu Y, et al. Oncogene Amplification in Growth Factor Signaling Pathways Renders Cancers Dependent on Membrane Lipid Remodeling. Cell Metab. 2019;30(3):525–38.e8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Williams KA, Lee M, Hu Y, Andreas J, Patel SJ, Zhang S, et al. A systems genetics approach identifies CXCL14, ITGAX, and LPCAT2 as novel aggressive prostate cancer susceptibility genes. PLoS Genet. 2014;10(11):e1004809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Cotte AK, Aires V, Fredon M, Limagne E, Derangère V, Thibaudin M, et al. Lysophosphatidylcholine acyltransferase 2-mediated lipid droplet production supports colorectal cancer chemoresistance. Nat Commun. 2018;9(1):322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Dixon SJ, Winter GE, Musavi LS, Lee ED, Snijder B, Rebsamen M, et al. Human Haploid Cell Genetics Reveals Roles for Lipid Metabolism Genes in Nonapoptotic Cell Death. ACS Chem Biol. 2015;10(7):1604–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Doll S, Proneth B, Tyurina YY, Panzilius E, Kobayashi S, Ingold I, et al. ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition. Nat Chem Biol. 2017;13(1):91–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kagan VE, Mao G, Qu F, Angeli JP, Doll S, Croix CS, et al. Oxidized arachidonic and adrenic PEs navigate cells to ferroptosis. Nat Chem Biol. 2017;13(1):81–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yang F, Wei Y, Cai Z, Yu L, Jiang L, Zhang C, et al. Activated cytotoxic lymphocytes promote tumor progression by increasing the ability of 3LL tumor cells to mediate MDSC chemoattraction via Fas signaling. Cell Mol Immunol. 2015;12(1):66–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Friedmann Angeli JP, Schneider M, Proneth B, Tyurina YY, Tyurin VA, Hammond VJ, et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nat Cell Biol. 2014;16(12):1180–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1–2):317–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li D, Li Y. The interaction between ferroptosis and lipid metabolism in cancer. Signal Transduct Target Ther. 2020;5(1):108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wang B, Rong X, Palladino END, Wang J, Fogelman AM, Martín MG, et al. Phospholipid Remodeling and Cholesterol Availability Regulate Intestinal Stemness and Tumorigenesis. Cell Stem Cell. 2018;22(2):206–20.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kurabe N, Hayasaka T, Ogawa M, Masaki N, Ide Y, Waki M, et al. Accumulated phosphatidylcholine (16:0/16:1) in human colorectal cancer; possible involvement of LPCAT4. Cancer Sci. 2013;104(10):1295–302. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3

RESOURCES