Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Aug 31.
Published in final edited form as: Arch Pharm Res. 2021 Jan 24;44(2):230–240. doi: 10.1007/s12272-021-01309-7

Inhibition of hyaluronan synthesis by 4-methylumbelliferone ameliorates non-alcoholic steatohepatitis in choline-deficient l-amino acid-defined diet-induced murine model

Yoon Mee Yang 1,2, Zhijun Wang 2, Michitaka Matsuda 2, Ekihiro Seki 2,3
PMCID: PMC8407017  NIHMSID: NIHMS1735045  PMID: 33486695

Abstract

Hyaluronan (HA) as a glycosaminoglycan can bind to cell-surface receptors, such as TLR4, to regulate inflammation, tissue injury, repair, and fibrosis. 4-methylumbelliferone (4-MU), an inhibitor of HA synthesis, is a drug used for the treatment of biliary spasms. Currently, therapeutic interventions are not available for non-alcoholic steatohepatitis (NASH). In this study, we investigated the effects of 4-MU on NASH using a choline-deficient amino acid (CDAA) diet model. CDAA diet-fed mice showed NASH characteristics, including hepatocyte injury, hepatic steatosis, inflammation, and fibrogenesis. 4-MU treatment significantly reduced hepatic lipid contents in CDAA diet-fed mice. 4-MU reversed CDAA diet-mediated inhibition of Ppara and induction of Srebf1 and Slc27a2. Analysis of serum ALT and AST levels revealed that 4-MU treatment protected against hepatocellular damage induced by CDAA diet feeding. TLR4 regulates low molecular weight-HA-induced chemokine expression in hepatocytes. In CDAA diet-fed, 4-MU-treated mice, the upregulated chemokine/cytokine expression, such as Cxcl1, Cxcl2, and Tnf was attenuated with the decrease of macrophage infiltration into the liver. Moreover, HA inhibition repressed CDAA diet-induced mRNA expression of fibrogenic genes, Notch1, and Hes1 in the liver. In conclusion, 4-MU treatment inhibited liver steatosis and steatohepatitis in a mouse model of NASH, implicating that 4-MU may have therapeutic potential for NASH.

Keywords: CXCL1, Hyaluronic acid, Hymecromone, NASH, TLR4

Introduction

Non-alcoholic fatty liver disease (NAFLD) has become the most common cause of chronic liver diseases in western countries (Michelotti et al. 2013). The prevalence of NAFLD in the U.S. adult population is approximately 25% (Diehl and Day 2017). About one fourth of the patients with NAFLD is estimated to have nonalcoholic steatohepatitis (NASH) (Diehl and Day 2017). Through histological examinations, NASH is characterized by steatosis, lobular inflammation, hepatocyte ballooning, and varying degrees of liver fibrosis (Aly and Kleiner 2011). Since NAFLD/NASH is strongly associated with obesity and metabolic syndrome, the prevalence of NASH-related cirrhosis and liver cancer is increasing and a proportion of patients transplanted for NASH is also increasing in both the U.S. and Europe (Chedid 2017; Haldar et al. 2019). Although NASH has become a major health concern, there are no FDA-approved drugs for treating NASH.

Hepatic stellate cells (HSCs) are the major fibrogenic cells in the liver. Under the circumstance of liver injury, HSCs are activated and transdifferentiate into myofibroblasts (Tsuchida and Friedman 2017). Activated HSCs produce extracellular matrix, such as collagen and hyaluronan (HA) (Yang et al. 2019). HA is an anionic, nonsulfated glycosaminoglycan, composed of D-glucuronic acid and N-acetyl-D-glucosamine (Jiang et al. 2011). HA is widely distributed throughout the body. The 70-kg individual has approximately 15 g of HA (Stern 2004). HA is synthesized by hyaluronan synthase (HAS) expressed in the plasma membrane. There are three isozymes of HAS (HAS1, HAS2, and HAS3). HAS generates high-molecular-weight forms of HA (HMW-HA). In the fibrotic liver, HAS2 is overexpressed (Yang et al. 2019) and produces an extremely large mass of HA (> 2 × 106 Da) (Itano et al. 1999).

Liver sinusoidal endothelial cells play a significant role in the clearance of HA from the systemic circulation (Tamaki et al. 1996). Hyaluronidases, such as hyaluronidase-1 and hyaluronidase-2, are responsible for HA catabolism (Bourguignon and Flamion 2016). Recently, TMEM2 was identified as the new cell surface hyaluronidase which can promote ER homeostasis (Schinzel et al. 2019). Hyaluronidases cleave HA chains and generates a various range of fragmented HA. Low-molecular-weight-HA (LMW-HA, 100–300 kDa) is a major form in mouse fibrotic livers (Yang et al. 2019). Serum LMW-HA levels were also increased in NASH-mediated fibrotic patients, as compared to those subjects without fibrosis (Yang et al. 2019). Interestingly, HMW-HA and fragmented LMW-HA have distinct biological properties. For example, LMW-HA (MW ~ 135 kDa) stimulated chemokine expression through both TLR4 and TLR2 on peritoneal macrophages, whereas HMW-HA protects lung epithelial cells from bleomycin-induced apoptosis (Jiang et al. 2005).

4-methylumbelliferone (4-MU, also known as hymecromone, Fig. 1) is an inhibitor of HA synthesis. This drug is approved for the treatment of biliary spasm in Europe and Asia (Nagy et al. 2015). The results from clinical trials using 4-MU suggested that this drug is generally safe and well-tolerated (Nagy et al. 2015). In view of anti-inflammatory and anti-fibrogenic properties of 4-MU (McKallip et al. 2015; Yang et al. 2019), the present study investigated whether 4-MU treatment inhibits the early progression of NASH. We applied the mouse model of choline-deficient L-amino acid-defined diet (CDAA)-induced NASH to assess the pharmacological effects of 4-MU. Here, we report that 4-MU effectively ameliorated NASH-associated steatosis, hepatocyte injury, inflammation, and fibrotic response. Our findings suggest 4-MU may be a potential therapeutic intervention for NASH.

Fig. 1.

Fig. 1

Chemical structure of 4-methylumbelliferone

Materials and methods

Materials

Sodium salt of 4-MU (Cat. M1508, ≥ 98%), Oil Red O (Cat. O0625), Collagenase D (Cat. 11088882001), and Collagenase P (Cat. 11249002001) were purchased from Sigma-Aldrich (St Louis, MO, USA). Healon® (sodium hyaluro-nate) was supplied from Kabi Pharmacia Ophthalamics Inc. (Monrovia, CA, USA). F4/80 monoclonal antibody (clone BM8, Cat. 14–4801) was from eBioscience (San Diego, CA, USA) and biotin-labeled HA-binding protein [rhAggrecan aa20–675/His (NSO/7), biotin] was the custom reagent from R&D Systems (Minneapolis, MN, USA). CDAA diet (Cat. 518753GI) was purchased from Dyets, Inc. (Bethlehem, PA, USA).

Animals

Animal experiments were conducted in accordance with National Institutes of Health recommendations outlined in the Guide for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Cedars-Sinai Medical Center Institutional Animal Care and Use Committee. Male C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, MA, USA) and were acclimatized for 1 week. Animals were randomly assigned to experimental groups without bias. Mice were divided into four groups as follows: control diet + vehicle (n = 4), control diet + 4-MU (n = 4), CDAA diet + vehicle (n = 8), and CDAA diet + 4-MU (n = 8). At 8 weeks of age, mice were subjected to feeding ad libitum CDAA diet for 3 weeks. Vehicle (PBS) or 200 mg/kg of 4-MU was orally administered once-daily during the last 2 weeks of the diet feeding. Body weight was monitored weekly throughout the experiment.

Histopathology

Mouse liver tissues were fixed in 10% buffered formalin for 24 h at room temperature. Formalin-fixed, paraffin-embedded sections were cut with thickness of 5-μm. H&E staining was performed on deparaffinized and rehydrated sections according to manufacturer’s protocol (Leica Biosystems, Buffalo Grove, IL, USA). Immunochemistry for F4/80 and HA staining were carried out by established procedures as previously described (Yang et al. 2019). F4/80 monoclonal antibody or biotin-labeled HA-binding protein were applied to mouse liver sections. VECTASTAIN Elite ABC kit and DAB Peroxidase Substrate kits were used as directed by the manufacturer (Vector Laboratories, Burlingame, CA, USA). HA-positive area was evaluated from randomly selected 10 fields of × 200 magnification per slide and quantified with NIH Image J software.

Oil red O staining

Mouse liver tissues were fixed in 4% neutral-buffered formalin at 4 °C and subjected to OCT compound embedding processing. Frozen liver tissues were sliced into 10-μm thick sections using a cryostat microtome. Sections were rinsed with 60% isopropanol, and subsequently stained with freshly prepared Oil Red O staining solution for 15 min. After rinsing with 60% isopropanol, sections were mounted and imaging analyses were performed using LEICA DMi8. Oil Red O-positive area was evaluated from randomly selected 15 fields of × 200 magnification per slide and quantified with NIH Image J software.

Alanine aminotransferase (ALT) and AST measurement

Blood was collected by cardiac puncture. The blood clot was removed by centrifuging at 5000 rpm for 15 min. The serum samples were stored at − 80 °C until assayed. Serum ALT and AST levels were measured by Infinity ALT (GPT) and AST (GOT) liquid stable reagent (Thermo Scientific, Middletown, VA, USA) according to manufacturer’s protocol.

Quantitative real-time polymerase chain reaction (qPCR)

As per the manufacturer’s recommendations, total RNA was extracted from snap-frozen mouse liver tissues using NucleoSpin® RNA kit (Macherey–Nagel, Düren, Germany). Reverse-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) was used to synthesize cDNA from the DNase I treated RNA. Quantitative real-time PCR was carried out using iTaq™ Universal SYBR® Green Supermix (Bio-rad, Hercules, CA, USA) and CFX96 real-time PCR system (Bio-rad, Hercules, CA, USA). The sequences of mouse PCR primers are listed in Table 1.

Table 1.

Sequence of primers used for real-time PCR

Gene Forward Reverse
18S rRNA AGTCCCTGCCCTTTGTACACA CGATCCGAGGGCCTCACTA
Acta2 ACTGGGACGACATGGAAAAG GTTCAGTGGTGCCTCTGTCA
Ccl2 CCTGCTGTTCACAGTTGCC ATTGGGATCATCTTGCTGGT
Ccl5 CCACTTCTTCTCTGGGTTGG GTGCCCACGTCAAGGAGTAT
Col1a1 ACATGTTCAGCTTTGTGGACC TAGGCCATTGTGTATGCAGC
Cxcl1 TGCACCCAAACCGAAGTC GTCAGAAGCCAGCGTTCACC
Cxcl2 AAAGTTTGCCTTGACCCTGAA CTCAGACAGCGAGGCACATC
Hes1 ATAGCTCCCGGCATTCCAA GCGCGGTATTTCCCCAACA
Notch1 GTGCCTGCCCTTTGAGTCTT GCGATAGGAGCCGATCTCATTG
Ppara AACATCGAGTGTCGAATATGTGG CCGAATAGTTCGCCGAAAGAA
Slc27a2 GGAACCACAGGTCTTCCAAA TAAAGTAGCCCCAACCACGA
Srebf1 GAACAGACACTGGCCGAGAT GAGGCCAGAGAAGCAGAAGAG
Timp1 GTAAGGCCTGTAGCTGTGCC AGGTGGTCTCGTTGATTTCT
Tnf AGGGTCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC

HA ELISA

100- and 300-kDa cutoff columns (Centrisart, Sartorius) were used to prepare size-specific HA fractions of serum samples, as previously described (Yang et al. 2019). Total HA and fractionated HA levels were determined by Hyaluronan DuoSet ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to manufacturer’s instruction.

Hepatocyte isolation

Hepatocytes were isolated from wild-type or Tlr4−/− mice by the previous method (Kodama et al. 2009), with minor modifications. Tlr4−/− mice were kindly provided by S. Akira (Osaka University, Japan) (Hoshino et al. 1999). Briefly, mice were anesthetized by injecting a mixture of Ketamine and Xylazine intraperitoneally. The abdominal incision was made to expose abdominal cavity. The catheter was inserted into the vena cava. The primary hepatocytes were isolated from mice by in situ liver perfusion with Collagenase D and Collagenase P, followed by spinning cells at 500 rpm for 1 min.

In vitro treatment

Isolated primary mouse hepatocytes were seeded on collagen-coated plates in M199 medium containing 10% fetal bovine serum and Antibiotic–antimycotic (ThermoFisher Scientific, San Jose, CA, USA). After 3 h, hepatocytes were washed once. Then, cells were serum starved for 12 h followed by treatment with LMW-HA (100 μg/ml) or HMW-HA (600 μg/ml) in the presence of polymyxin B (10 μg/ml) for 12 h.

Statistical analysis

Statistical significance was analyzed by using GraphPad Prism 5.01 software (GraphPad Software, Inc, La Jolla, CA, USA). Statistical significance was determined using Student’s t-test or one-way ANOVA, followed by Tukey’s post hoc analysis. P values of < 0.05 were considered significant.

Results

4-methylumbelliferone inhibits hepatic lipid accumulation in a CDAA diet–induced animal model of non-alcoholic steatohepatitis

First, we investigated the effect of 4-MU on liver steatosis. 4-MU or vehicle was orally given to either control diet-fed mice or CDAA diet-fed mice. There were no significant differences in body weight among different experimental groups (Fig. 2a). Mice fed a CDAA diet for 3 weeks successfully developed hepatic steatosis, inflammation, hepatocyte ballooning, and mild fibrosis as previously reported (Yang et al. 2018) (Fig. 2b). Treatment of mice with 4-MU (200 mg/kg/day) for the last 2 weeks during the total 3 weeks of CDAA diet feeding ameliorated NASH (Fig. 2b). Oil Red O staining clearly indicated that CDAA diet feeding for 3 weeks caused severe lipid deposition in the liver (Fig. 2c, d). In contrast, 4-MU treatment significantly reduced hepatic fat accumulation in mice fed the CDAA diet (Fig. 2c, d). CDAA diet feeding reduced mRNA expression of Ppara (encoding peroxisome proliferator-activated receptor alpha, PPARα) involved in fatty acid oxidation, whereas increased mRNA expression of Srebf1 (encoding sterol regulatory element-binding protein 1c, SREBP1c) and Slc27a2 (encoding fatty acid transport protein 2, FATP2) involved in lipo-genesis and fatty acid uptake, respectively. 4-MU treatment reversed CDAA diet-induced alterations of gene expression in lipid metabolism (Fig. 2e). These results demonstrated that 4-MU administration improved NASH features in mice.

Fig. 2.

Fig. 2

4-methylumbelliferone treatment ameliorated CDAA diet-induced non-alcoholic fatty liver disease. a Body weight. Male C57BL/6 mice were fed on either a control diet (Con) or choline-deficient, amino acid-defined (CDAA) diet for 3 weeks. Vehicle (Veh) or 4-MU (200 mg/kg/day) was orally administered to mice daily during the last 2 weeks of the diet feeding. Data are presented as means ± S.D. (ND-Veh, n = 4; ND-4-MU, n = 4; CDAA-Veh, n = 8; CDAA-4MU, n = 8). b H&E staining of the liver sections. Representative images are shown. (magnification, × 200). c Oil Red O staining for hepatic lipid droplet accumulation. (magnification, × 200). d Quantification of Oil Red O staining. Data are presented as means ± S.E.M. e Hepatic mRNA expression of Ppara, Srebf1, and Slc27a2. Data are presented as means ± S.E.M. (*P < 0.05, **P < 0.01, significantly different from Con-Veh; #P < 0.05, ##P < 0.01, significantly different from CDAA-Veh, n = 4–8 per group)

4-MU alleviates liver damage

Imbalanced uptake, synthesis, oxidation, and export of fatty acids are responsible for the pathogenesis of NAFLD. Lipotoxicity to hepatocytes provokes cell stress and ultimately hepatocyte death (Machado and Diehl 2016). To determine CDAA diet-induced liver injury, we evaluated serum ALT and AST levels, since damaged liver cells release ALT and AST to the systemic circulation. CDAA diet-fed mice had strongly increased serum ALT and AST levels. In contrast, serum ALT and AST levels were low in CDAA diet-fed mice treated with 4-MU compared to vehicle-treated CDAA diet-fed mice (Fig. 3a, b). Our results showed the protective effect of 4-MU in NASH-mediated liver damage.

Fig. 3.

Fig. 3

4-methylumbelliferone administration inhibited CDAA diet-induced liver damage. a Serum alanine aminotransferase (ALT) level. b Serum aspartate aminotransferase (AST) level. Data are presented as means ± S.D. (**P < 0.01, significantly different from Con-Veh; #P < 0.05, ##P < 0.01, significantly different from CDAA-Veh, n = 4–8 per group)

LMW-HA regulates proinflammatory chemokine expression through TLR4

Liver inflammation is known to trigger NASH-mediated liver fibrosis (Schuster et al. 2018). Chemokines are produced by liver cells including hepatocytes, Kupffer cells, and hepatic stellate cells. Production of CXCL1, CXCL2, and CCL2 leads to the recruitment of inflammatory cells, such as monocytes/macrophages, neutrophils, and NK cells (Saiman and Friedman 2012). Previously, we observed increased HA expression in NASH-induced fibrosis in human liver samples (Yang et al. 2019). Specifically, LMW forms of HA (100–300 kDa) were elevated in sera from NASH patients with fibrosis as compared to subjects without fibrosis (Yang et al. 2019). Here, we found that serum HA levels were elevated in CDAA diet-fed mice. In parallel with results obtained from NASH patients, LMW-HA were significantly increased in sera from CDAA diet-fed mice (Fig. 4a).

Fig. 4.

Fig. 4

Low molecular weight form of hyaluronan increases proinflammatory gene expression in a TLR4-dependent manner. a Total and fractionated serum HA content (> 100 kDa, 100 ~ 300 kDa, and > 300 kDa) in control diet (Con)- or CDAA diet-fed mice. Data are presented as means ± S.E.M. (*P < 0.05, significantly different from Con). b Proinflammatory gene expression in mouse hepatocytes. Cells were treated with vehicle (Con), 600 μg/ml high molecular weight-hyaluronan (HMW-HA; Healon®), or 100 μg/ml low molecular weight-hyaluronan (LMW-HA) in the presence of 10 μg/ml polymyxin B for 12 h. Data are presented as means ± S.E.M. (**P < 0.01, significantly different from Con, n = 3). c qRT-PCR assay for Cxcl1 and Ccl2 mRNA. Wild-type (WT) or Tlr4−/− hepatocytes were treated with or without LMW-HA in the presence of 10 μg/ml polymyxin B for 12 h. Data are presented as means ± S.E.M. (*P < 0.05, **P < 0.01, significantly different from WT-Veh; #P < 0.05, significantly different from WT-LMW-HA, n = 3)

LMW-HA has an ability to increase chemokine expression, such as Cxcl1 and Ccl2 on Kupffer cells and HSCs (Yang et al. 2019). In addition to Kupffer cells and HSCs, hepatocytes, the major parenchymal cells of the liver can amplify inflammation through chemokine production, particularly CXCL1 (Roh et al. 2015; Yang et al. 2017; Hwang et al. 2020a, b). To investigate the role of LMW-HA in chemokine production by hepatocytes, cells were treated with either LMW-HA or HMW-HA. LMW-HA treatment increased Cxcl1, Cxcl2, and Ccl2 mRNA expression, while HMW-HA treatment had no effect (Fig. 4b).

TLR4 and CD44 are two major HA receptors whose pathological roles in NASH have been identified (Patouraux et al. 2017; Yang et al. 2017). Since normal hepatocytes do not express CD44 (Flanagan et al. 1989), we hypothesized that TLR4 is the crucial receptor for HA in hepatocytes. In line with this, we tested whether the induction of chemokine expression by LMW-HA is mediated through TLR4. LMWHA-induced Cxcl1 and Ccl2 mRNA expression was attenuated in Tlr4−/− hepatocytes (Fig. 4c). These results indicated that LMW forms of HA increased chemokine expression in a TLR4-dependent manner.

4-MU has anti-inflammatory effect in CDAA diet-fed mice

Liver macrophages comprise Kupffer cells, liver resident macrophages, and monocyte-derived macrophages. These cells are key players in the pathogenesis of NASH, in which they contribute to not only inflammation but also fibrosis and tissue repair (Krenkel and Tacke 2017). Immunohisto-chemical staining for F4/80 revealed that the inflammatory foci containing macrophages were formed after CDAA diet feeding, which were reduced by 4-MU treatment (Fig. 5a, b). This finding was in line with our quantitative real-time PCR results that 4-MU treatment abrogated CDAA-diet induced hepatic Cxcl1, Cxcl2, and Tnf mRNA expression in mice fed with CDAA diet for 3 weeks (Fig. 5c). 4-MU treatment attenuated Ccl5 mRNA expression in control diet-fed mice, but the reduction did not reach statistically significant in CDAA diet-fed mice. Taken together, 4-MU diminished liver macrophage infiltration and chemokine/cytokine production triggered by CDAA diet feeding, thereby contributing to its anti-inflammatory effect.

Fig. 5.

Fig. 5

4-methylumbelliferone attenuated CDAA diet-induced inflammation. a Measurement of macrophages positive for F4/80 by immunohistochemistry. (magnification, × 200). Arrows point inflammatory foci. b Number of F4/80+ foci. It was quantified from all mice (five fields per mouse, magnification × 100). Data are presented as means ± S.E.M. c Hepatic mRNA expression of Cxcl1, Cxcl2, Tnf, and Ccl5. Data are presented as means ± S.E.M. (*P < 0.05, **P < 0.01, significantly different from Con-Veh; #P < 0.05, ##P < 0.01, significantly different from CDAA-Veh, n = 4–8 per group) n.s., not significant

Inhibition of hyaluronan synthesis reduces CDAA diet-induced fibrogenic gene expression

The advancement of NASH leads to fibrosis. In the progression of liver fibrosis, excessive extracellular matrix molecular composition, including HA is deposited in the liver (Yang et al. 2019). After 3 weeks of CDAA diet feeding, HA deposition was observed in the mouse liver (Fig. 6a, b). Increased hepatic HA expression induced by CDAA diet feeding were significantly reduced by the treatment of 4-MU (Fig. 6a, b). To assess anti-fibrogenic effect of 4-MU, we measured fibrosis-related gene expression. Mice fed CDAA diet exhibited an increase in mRNA expression of Col1a1, the encoding gene of collagen, type 1, alpha1, Acta2, the encoding gene of α-SMA, and Timp1, the encoding gene of a tissue inhibitor of metalloproteinases, whereas 4-MU treatment abolished increases in Col1a1, Acta2, and Timp1 mRNA expression (Fig. 6c). Notch1 activation exacerbated NASH and fibrosis (Zhu et al. 2018; Yang et al. 2019). Finally, we showed that 4-MU treatment successfully attenuated CDAA diet-induced Notch1 and its target gene, Hes1. Our results demonstrated that 4-MU treatment could inhibit fibrogenesis in NASH.

Fig. 6.

Fig. 6

4-methylumbelliferone had an anti-fibrogenic effect on CDAA diet-fed mice. a HA staining of sections of mouse liver with lower (× 200) and higher (× 400) magnifications. The representative pictures are shown. b Quantification of HA-positive area. c Hepatic mRNA expression of Col1a1, Acta2, and Timp1. d Hepatic mRNA expression of Notch1, and Hes1. Data are presented as means ± S.E.M. (*P < 0.05, **P < 0.01, significantly different from Con-Veh; #P < 0.05, ##P < 0.01, significantly different from CDAA-Veh, n = 4–8 per group)

Discussion

Dysregulated HA production and deposition are often found in various human diseases (Jiang et al. 2011). Serum HA has been used as a biomarker for liver fibrosis (Gao et al. 2012). Recently, we showed that the overexpression of HA and its synthesizing enzyme, HAS2 is observed in NASH-mediated fibrotic patient livers, as compared to those from NASH patients without fibrosis (Yang et al. 2019). In an effort to determine the effect of HA inhibition on NASH development, we investigated the potential use of 4-MU. An in vivo model using mice fed a CDAA diet was employed in this study. In particular, CDAA diet feeding results in liver injury, steatosis, inflammation, HA production, and fibrogenic response. These pathological features of NASH were significantly attenuated by 4-MU treatment (200 mg/kg/day) for the last 2 weeks of the CDAA diet feeding.

In Europe and Asia, 4-MU has been used for the treatment of biliary spasm and also as a dietary supplement for improving liver health (Nagy et al. 2015; Yates et al. 2015). 4-MU has poor oral bioavailability due to extensive first-pass glucuronidation in the liver and small intestine and its rapid metabolism in the blood stream (t1/2 = 28 min, human; t1/2 = 3 min, mice) (Nagy et al. 2019). The recommended oral dose of 4-MU in adults is 900–2400 mg/day (Nagy et al. 2015). 4-MU is a well-tolerated drug with low toxicity. According to package insert of hymecromone (4-MU) provided by Italian Medicines Agency, the LD50 for oral administration is 7593 mg/kg in mice (Nagy et al. 2015). Material Safety Data Sheet from Santa Cruz Biotechnology, Inc. provided the toxicological information of 4-MU (catalog no. sc-206910) subcutaneous (mouse) LD50 as over 10,000 mg/kg. In mice, the maximum tolerated dose is 2.8–7.3 g/kg (Yates et al. 2015). Previously, we evaluated the efficacy of 450 mg/kg 4-MU in a choline-deficient, high-fat diet (CDHFD) model, which develops fibrosis in NASH (Matsumoto et al. 2013). Mice receiving 4-MU treatment by oral gavage at this dose prevented long-term CD-HFD-induced liver fibrosis (Yang et al. 2019). 200–450 mg/kg of 4-MU in mice is equivalent to 1.5–2 g/day in humans (Yates et al. 2015). During NASH progression, drug metabolism and excretion can be retarded and cause drug-related adverse effects (Dietrich et al. 2017). In this study, we tested the efficacy of a lower dose of 4-MU (200 mg/kg) to minimize its off-target effects. We found that 200 mg/kg of 4-MU treatment attenuated lipid accumulation, liver damage, liver inflammation, and fibrogenic responses. We proved that 4-MU at a lower dose is effective for mitigating NASH.

In this study, 4-MU treatment alleviated hepatic steatosis (Fig. 2). Previous study showed that the long-term supplementation of 4-MU (0.02% wt/wt, for 12 weeks) improved high-fat diet-induced hypertriglyceridemia and hyperglycemia (Sim et al. 2014). Another study demonstrated that 4-MU treatment (600 mg/kg daily, for 2 or 4 weeks) prevented CCl4-induced liver fibrosis (Andreichenko et al. 2019). Bioinformatic analysis suggested that CCl4 exposure inhibited the expression of genes associated with lipid metabolism involved in cholesterol and fatty acid metabolism, including fatty acid beta-oxidation (Andreichenko et al. 2019). 4-MU treatment improved the expression of genes involved in cholesterol and retinol metabolism and amino acid metabolism (Andreichenko et al. 2019). We also found that 4-MU treatment modulated the expression of genes that regulate lipid metabolism pathways including fatty acid oxidation, uptake, and lipogenesis. These findings suggested the protective effect of 4-MU against excessive lipid accumulation in hepatocytes.

NASH can progress to cirrhosis and hepatocellular carcinoma (HCC) (Lee et al. 2019). 4-MU also has antitumor effects (Piccioni et al. 2012, 2015). In an orthotopic HCC mouse model associated with advanced fibrosis, the 4-MU therapy (20 mg/kg/day, i.p. injection for 14 days) decreased the number of satellite tumor nodules as well as the amount of fibrous septae and regenerative nodules (Piccioni et al. 2012). Inhibition of angiogenesis and IL-6 production by 4-MU is related to anti-tumor activity (Piccioni et al. 2015). Therefore, 4-MU could be a potential treatment agent for both NASH and HCC.

There are several therapeutic approaches to target HA biology for human diseases (Liang et al. 2016). Most native HA are present as HMW-HA, which plays an important role in normal biological processes and tissue protection (Liang et al. 2016). Therefore, the injection of HMW-HA, such as Healon® (Abbott) and Synvisc-One® (Genzyme), has been used as a therapeutic application. Healon® was clinically approved for the ophthalmic viscoelastic used as a surgical aid in cataract extraction. Synvisc-One® is another FDA-approved HA product used for the relief of pain in osteo-arthritis. Oral HA supplementation is also available in the market. However, HA can also promote cell growth, and thereby long-term therapy with oral HA could be potentially detrimental to patients with a history of cancer (Simone and Alberto 2015).

Hyaluronidases are the enzymes that hydrolyze HA and catalyze its degradation. Hyaluronidases play an important role in inflammation, wound healing, angiogenesis, and disease progression (Girish and Kemparaju 2007). Hyaluronidases are clinically used as an adjuvant to enhance absorption of concomitant drugs. HA is massively secreted from pancreatic adenocarcinoma cells (Mahlbacher et al. 1992). To degrade HA in the tumor microenvironment, pegylated recombinant human hyaluronidase, Pegvorhyaluronidase alfa (PEGPH20) was suggested to enhance the absorption and dispersion of anti-cancer drugs (Kim et al. 2020; Gourd 2018). The clinical study was conducted to evaluate PEGPH20 in combination with FOLFIRINOX for the treatment of pancreatic cancer. However, the clinical outcome was disappointing. Phase IB/II randomized study revealed that an addition of PEGPH20 to FOLFIRINOX increased the treatment-related grade 3–4 toxicity (Ramanathan et al. 2019). Hyaluronidases digest HMW-HA and generate LMW-HA. HA fragments and HA oligomers are often found in injured or fibrotic tissues and these smaller sizes of HA could regulate pathological processes (Liang et al. 2016; Yang et al. 2019). Our result supported that LMW-HA is associated with inflammation. Unlike hyaluronidases, 4-MU blocks HA synthesis, thereby inhibiting the generation of HA, including LMW-HA.

In the livers of patients with NASH compared to those with simple steatosis, the expression of genes involved in inflammation and fibrosis, including CXCL1 and CCL2, are notably upregulated (Lake et al. 2011; Hwang et al. 2019). An independent study from the Gual group also revealed that CXCL1 is highly overexpressed in the liver of patients with NASH (Bertola et al. 2010). Hepatic overexpression of CXCL1 accelerates the steatosis-to-NASH progression (Hwang et al. 2019). A low-grade systemic inflammation is a key feature of patients with NAFLD. Serum CCL2 levels were also increased in NAFLD compared to controls (Haukeland et al. 2006). The elevation of CCL2 is important for the progression from simple steatosis to NASH (Haukeland et al. 2006). Our present study found that LMW-HA induced CXCL1 and CCL2 mRNA expression in hepatocytes, whereas HMW-HA did not (Fig. 4). LMW-HA also enhanced CXCL1 and CCL2 production in HSCs and Kupffer cells (Yang et al. 2019). The cross-talk between different hepatic cell types is a key feature in NASH. LMWHA-regulated chemokine production may contribute to NASH progression by recruiting inflammatory cells.

TLR4, a major HA receptor (Jiang et al. 2005), promotes liver fibrosis through the enhanced activation of TGF-β signaling (Seki et al. 2007). Deficiency of TLR4 ameliorated NASH and fibrosis in methionine choline-deficient diet-fed mice (Csak et al. 2011). In the liver, parenchymal cells and non-parenchymal cells orchestrate the progression of TLR4-mediated NASH and fibrosis. TLR4 expressed in hepatocytes promoted hepatic steatosis in CDAA diet-fed mice through TIR-domain containing adaptor-inducing interferon-β (TRIF) (Yang et al. 2017). TLR4 in Kupffer cells is also important in the progression of simple steatosis to NASH by XBP-1 activation through ROS production (Ye et al. 2012). In HSCs, TLR4 upregulated chemokine secretion and caused chemotaxis of Kupffer cells (Seki et al. 2007). Also, TLR4 promoted HSC activation and liver fibrosis through MyD88, another important TLR4 adaptor molecule (Seki et al. 2007). Interestingly, MyD88 and TRIF have distinct roles in liver inflammation and fibrosis in NASH. TRIF deficiency exacerbated pro-inflammatory and pro-fibrogenic responses, whereas MyD88 deficiency had the opposite effect (Yang et al. 2017). The present study showed that TLR4 deficiency abolished LMW-HA-induced CXCL1 and CCL2 expression in hepatocytes (Fig. 4). It has been shown that LMW-HA stimulated CXCL2 expression through TLR4 (Jiang et al. 2005). We provided evidence of the role of HA-TLR4 interaction in the promotion of inflammation in NASH. We propose inhibition of HA synthesis by 4-MU as an anti-inflammatory approach for the treatment of NASH.

In conclusion, the present study demonstrated that 4-MU has beneficial effects on NASH as it suppresses liver injury, fat accumulation, and fibrogenic response. LMW-HA increased chemokine expression, such as CXCL1 and CCL2 in a TLR4-dependent manner. The administration of 4-MU successfully inhibited liver inflammation. 4-MU inhibited CDAA diet-induced Notch1 activation. Inhibition of Notch signaling may contribute to suppress hepatic stellate cell activation and liver fibrosis. This study elucidated HA as an attractive target for NASH treatment. Our finding suggests that 4-MU has potential in treating NASH.

Acknowledgements

This study was supported by NIH Grant R01DK085252, R21AA025841, and P01CA233452 (E.S). This study was supported by 2019 Research Grant from Kangwon National University (Y.M.Y.) and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MIST) (# 2020R1C1C1004185) (Y.M.Y).

Footnotes

Conflict of interest The authors declare that they have no conflict of interest to declare.

References

  1. Aly FZ, Kleiner DE (2011) Update on fatty liver disease and steatohepatitis. Adv Anat Pathol 18:294–300. 10.1097/PAP.0b013e318220f59b [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andreichenko IN, Tsitrina AA, Fokin AV, Gabdulkhakova AI, Malt-sev DI, Perelman GS, Bulgakova EV, Kulikov AM, Mikaelyan AS, Kotelevtsev YV (2019) 4-Methylumbelliferone prevents liver fibrosis by affecting hyaluronan deposition, FSTL1 expression and cell localization. Int J Mol Sci. 10.3390/ijms20246301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bertola A, Bonnafous S, Anty R, Patouraux S, Saint-Paul MC, Iannelli A, Gugenheim J, Barr J, Mato JM, Le Marchand-Brustel Y, Tran A, Gual P (2010) Hepatic expression patterns of inflammatory and immune response genes associated with obesity and NASH in morbidly obese patients. PLoS ONE 5:e13577. 10.1371/journal.pone.0013577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bourguignon V, Flamion B (2016) Respective roles of hyaluronidases 1 and 2 in endogenous hyaluronan turnover. FASEB J 30:2108–2114. 10.1096/fj.201500178R [DOI] [PubMed] [Google Scholar]
  5. Chedid MF (2017) Nonalcoholic steatohepatitis: the second leading indication for liver transplantation in the USA. Dig Dis Sci 62:2621–2622. 10.1007/s10620-017-4724-6 [DOI] [PubMed] [Google Scholar]
  6. Csak T, Velayudham A, Hritz I, Petrasek J, Levin I, Lippai D, Catalano D, Mandrekar P, Dolganiuc A, Kurt-Jones E, Szabo G (2011) Deficiency in myeloid differentiation factor-2 and toll-like receptor 4 expression attenuates nonalcoholic steatohepatitis and fibrosis in mice. Am J Physiol Gastrointest Liver Physiol 300:G433–441. 10.1152/ajpgi.00163.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Diehl AM, Day C (2017) Cause, pathogenesis, and treatment of nonalcoholic steatohepatitis. N Engl J Med 377:2063–2072. 10.1056/NEJMra1503519 [DOI] [PubMed] [Google Scholar]
  8. Dietrich CG, Rau M, Jahn D, Geier A (2017) Changes in drug transport and metabolism and their clinical implications in non-alcoholic fatty liver disease. Expert Opin Drug Metab Toxicol 13:625–640. 10.1080/17425255.2017.1314461 [DOI] [PubMed] [Google Scholar]
  9. Flanagan BF, Dalchau R, Allen AK, Daar AS, Fabre JW (1989) Chemical composition and tissue distribution of the human CDw44 glycoprotein. Immunology 67:167–175 [PMC free article] [PubMed] [Google Scholar]
  10. Gao XX, Shi DH, Chen YX, Cui JT, Wang YR, Jiang CP, Wu JH (2012) The therapeutic effects of tectorigenin on chemically induced liver fibrosis in rats and an associated metabonomic investigation. Arch Pharm Res 35:1479–1493. 10.1007/s12272-012-0819-y [DOI] [PubMed] [Google Scholar]
  11. Girish KS, Kemparaju K (2007) The magic glue hyaluronan and its eraser hyaluronidase: a biological overview. Life Sci 80:1921–1943. 10.1016/j.lfs.2007.02.037 [DOI] [PubMed] [Google Scholar]
  12. Gourd E (2018) PEGPH20 for metastatic pancreatic ductal adenocarcinoma. Lancet Oncol 19:e81. 10.1016/S1470-2045(17)30953-1 [DOI] [PubMed] [Google Scholar]
  13. Haldar D, Kern B, Hodson J, Armstrong MJ, Adam R, Berlakovich G, Fritz J, Feurstein B, Popp W, Karam V, Muiesan P, O’grady J, Jamieson N, Wigmore SJ, Pirenne J, Malek-Hosseini SA, Hidalgo E, Tokat Y, Paul A, Pratschke J, Bartels M, Trunecka P, Settmacher U, Pinzani M, Duvoux C, Newsome PN, Schnee-berger S, European L, Intestine Transplant A (2019) Outcomes of liver transplantation for non-alcoholic steatohepatitis: a European Liver Transplant Registry study. J Hepatol 71:313–322. 10.1016/j.jhep.2019.04.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Haukeland JW, Damas JK, Konopski Z, Loberg EM, Haaland T, Goverud I, Torjesen PA, Birkeland K, Bjoro K, Aukrust P (2006) Systemic inflammation in nonalcoholic fatty liver disease is characterized by elevated levels of CCL2. J Hepatol 44:1167–1174. 10.1016/j.jhep.2006.02.011 [DOI] [PubMed] [Google Scholar]
  15. Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, Takeda K, Akira S (1999) Cutting edge: toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol 162:3749–3752 [PubMed] [Google Scholar]
  16. Hwang S, He Y, Xiang X, Seo W, Kim SJ, Ma J, Ren T, Park SH, Zhou Z, Feng D, Kunos G, Gao B (2019) Interleukin-22 ameliorates neutrophil-driven nonalcoholic steatohepatitis through multiple targets. Hepatology. 10.1002/hep.31031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hwang S, He Y, Xiang X, Seo W, Kim SJ, Ma J, Ren T, Park SH, Zhou Z, Feng D, Kunos G, Gao B (2020a) Interleukin-22 ameliorates neutrophil-driven nonalcoholic steatohepatitis through multiple targets. Hepatology 72:412–429. 10.1002/hep.31031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hwang S, Wang X, Rodrigues RM, Ma J, He Y, Seo W, Park SH, Kim SJ, Feng D, Gao B (2020b) Protective and detrimental roles of p38alpha MAPK in different stages of nonalcoholic fatty liver disease. Hepatology. 10.1002/hep.31390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Itano N, Sawai T, Yoshida M, Lenas P, Yamada Y, Imagawa M, Shinomura T, Hamaguchi M, Yoshida Y, Ohnuki Y, Miyauchi S, Spicer AP, Mcdonald JA, Kimata K (1999) Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties. J Biol Chem 274:25085–25092. 10.1074/jbc.274.35.25085 [DOI] [PubMed] [Google Scholar]
  20. Jiang D, Liang J, Noble PW (2011) Hyaluronan as an immune regulator in human diseases. Physiol Rev 91:221–264. 10.1152/physrev.00052.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jiang D, Liang J, Fan J, Yu S, Chen S, Luo Y, Prestwich GD, Mascarenhas MM, Garg HG, Quinn DA, Homer RJ, Goldstein DR, Bucala R, Lee PJ, Medzhitov R, Noble PW (2005) Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nat Med 11:1173–1179. 10.1038/nm1315 [DOI] [PubMed] [Google Scholar]
  22. Kim SS, Kim HK, Kim H, Lee WT, Lee ES, Oh KT, Choi HG, Youn YS (2020) Hyperthermal paclitaxel-bound albumin nanoparticles co-loaded with indocyanine green and hyaluronidase for treating pancreatic cancers. Arch Pharm Res. 10.1007/s12272-020-01264-9 [DOI] [PubMed] [Google Scholar]
  23. Kodama Y, Taura K, Miura K, Schnabl B, Osawa Y, Brenner DA (2009) Antiapoptotic effect of c-Jun N-terminal Kinase-1 through Mcl-1 stabilization in TNF-induced hepatocyte apoptosis. Gastroenterology 136:1423–1434. 10.1053/j.gastro.2008.12.064 [DOI] [PubMed] [Google Scholar]
  24. Krenkel O, Tacke F (2017) Liver macrophages in tissue homeostasis and disease. Nat Rev Immunol 17:306–321. 10.1038/nri.2017.11 [DOI] [PubMed] [Google Scholar]
  25. Lake AD, Novak P, Fisher CD, Jackson JP, Hardwick RN, Billheimer DD, Klimecki WT, Cherrington NJ (2011) Analysis of global and absorption, distribution, metabolism, and elimination gene expression in the progressive stages of human nonalcoholic fatty liver disease. Drug Metab Dispos 39:1954–1960. 10.1124/dmd.111.040592 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lee J, Park JS, Roh YS (2019) Molecular insights into the role of mitochondria in non-alcoholic fatty liver disease. Arch Pharm Res 42:935–946. 10.1007/s12272-019-01178-1 [DOI] [PubMed] [Google Scholar]
  27. Liang J, Jiang D, Noble PW (2016) Hyaluronan as a therapeutic target in human diseases. Adv Drug Deliv Rev 97:186–203. 10.1016/j.addr.2015.10.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Machado MV, Diehl AM (2016) Pathogenesis of nonalcoholic steatohepatitis. Gastroenterology 150:1769–1777. 10.1053/j.gastro.2016.02.066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mahlbacher V, Sewing A, Elsasser HP, Kern HF (1992) Hyaluronan is a secretory product of human pancreatic adenocarcinoma cells. Eur J Cell Biol 58:28–34 [PubMed] [Google Scholar]
  30. Matsumoto M, Hada N, Sakamaki Y, Uno A, Shiga T, Tanaka C, Ito T, Katsume A, Sudoh M (2013) An improved mouse model that rapidly develops fibrosis in non-alcoholic steatohepatitis. Int J Exp Pathol 94:93–103. 10.1111/iep.12008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mckallip RJ, Ban H, Uchakina ON (2015) Treatment with the hyaluronic acid synthesis inhibitor 4-methylumbelliferone suppresses LPS-induced lung inflammation. Inflammation 38:1250–1259. 10.1007/s10753-014-0092-y [DOI] [PubMed] [Google Scholar]
  32. Michelotti GA, Machado MV, Diehl AM (2013) NAFLD, NASH and liver cancer. Nat Rev Gastroenterol Hepatol 10:656–665. 10.1038/nrgastro.2013.183 [DOI] [PubMed] [Google Scholar]
  33. Nagy N, Kuipers HF, Frymoyer AR, Ishak HD, Bollyky JB, Wight TN, Bollyky PL (2015) 4-methylumbelliferone treatment and hyaluronan inhibition as a therapeutic strategy in inflammation, autoimmunity, and cancer. Front Immunol 6:123. 10.3389/fimmu.2015.00123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nagy N, Gurevich I, Kuipers HF, Ruppert SM, Marshall PL, Xie BJ, Sun W, Malkovskiy AV, Rajadas J, Grandoch M, Fischer JW, Frymoyer AR, Kaber G, Bollyky PL (2019) 4-Methylumbelliferyl glucuronide contributes to hyaluronan synthesis inhibition. J Biol Chem 294:7864–7877. 10.1074/jbc.RA118.006166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Patouraux S, Rousseau D, Bonnafous S, Lebeaupin C, Luci C, Canivet CM, Schneck AS, Bertola A, Saint-Paul MC, Iannelli A, Gugenheim J, Anty R, Tran A, Bailly-Maitre B, Gual P (2017) CD44 is a key player in non-alcoholic steatohepatitis. J Hepatol 67:328–338. 10.1016/j.jhep.2017.03.003 [DOI] [PubMed] [Google Scholar]
  36. Piccioni F, Malvicini M, Garcia MG, Rodriguez A, Atorrasagasti C, Kippes N, Piedra Buena IT, Rizzo MM, Bayo J, Aquino J, Viola M, Passi A, Alaniz L, Mazzolini G (2012) Antitumor effects of hyaluronic acid inhibitor 4-methylumbelliferone in an orthotopic hepatocellular carcinoma model in mice. Glycobiology 22:400–410. 10.1093/glycob/cwr158 [DOI] [PubMed] [Google Scholar]
  37. Piccioni F, Fiore E, Bayo J, Atorrasagasti C, Peixoto E, Rizzo M, Malvicini M, Tirado-Gonzalez I, Garcia MG, Alaniz L, Mazzolini G (2015) 4-methylumbelliferone inhibits hepatocellular carcinoma growth by decreasing IL-6 production and angiogenesis. Glycobiology 25:825–835. 10.1093/glycob/cwv023 [DOI] [PubMed] [Google Scholar]
  38. Ramanathan RK, Mcdonough SL, Philip PA, Hingorani SR, Lacy J, Kortmansky JS, Thumar J, Chiorean EG, Shields AF, Behl D, Mehan PT, Gaur R, Seery T, Guthrie KA, Hochster HS (2019) Phase IB/II randomized study of folfirinox plus pegylated recombinant human hyaluronidase versus FOLFIRINOX alone in patients with metastatic pancreatic adenocarcinoma: SWOG S1313. J Clin Oncol 37:1062–1069. 10.1200/JCO.18.01295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Roh YS, Zhang B, Loomba R, Seki E (2015) TLR2 and TLR9 contribute to alcohol-mediated liver injury through induction of CXCL1 and neutrophil infiltration. Am J Physiol Gastrointest Liver Physiol 309:G30–41. 10.1152/ajpgi.00031.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Saiman Y, Friedman SL (2012) The role of chemokines in acute liver injury. Front Physiol 3:213. 10.3389/fphys.2012.00213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schinzel RT, Higuchi-Sanabria R, Shalem O, Moehle EA, Webster BM, Joe L, Bar-Ziv R, Frankino PA, Durieux J, Pender C, Kelet N, Kumar SS, Savalia N, Chi H, Simic M, Nguyen NT, Dillin A (2019) The hyaluronidase, TMEM2, promotes ER homeostasis and longevity independent of the UPR(ER). Cell 179(1306–1318):e1318. 10.1016/j.cell.2019.10.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schuster S, Cabrera D, Arrese M, Feldstein AE (2018) Triggering and resolution of inflammation in NASH. Nat Rev Gastroenterol Hepatol 15:349–364. 10.1038/s41575-018-0009-6 [DOI] [PubMed] [Google Scholar]
  43. Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, Schwabe RF (2007) TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat Med 13:1324–1332. 10.1038/nm1663 [DOI] [PubMed] [Google Scholar]
  44. Sim MO, Ham JR, Lee HI, Seo KI, Lee MK (2014) Long-term supplementation of umbelliferone and 4-methylumbelliferone alleviates high-fat diet induced hypertriglyceridemia and hyperglycemia in mice. Chem Biol Interact 216:9–16. 10.1016/j.cbi.2014.03.003 [DOI] [PubMed] [Google Scholar]
  45. Simone P, Alberto M (2015) Caution should be used in long-term treatment with oral compounds of hyaluronic acid in patients with a history of cancer. Clin Drug Investig 35:689–692. 10.1007/s40261-015-0339-x [DOI] [PubMed] [Google Scholar]
  46. Stern R (2004) Hyaluronan catabolism: a new metabolic pathway. Eur J Cell Biol 83:317–325. 10.1078/0171-9335-00392 [DOI] [PubMed] [Google Scholar]
  47. Tamaki S, Ueno T, Torimura T, Sata M, Tanikawa K (1996) Evaluation of hyaluronic acid binding ability of hepatic sinusoidal endothelial cells in rats with liver cirrhosis. Gastroenterology 111:1049–1057 [DOI] [PubMed] [Google Scholar]
  48. Tsuchida T, Friedman SL (2017) Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol 14:397–411. 10.1038/nrgastro.2017.38 [DOI] [PubMed] [Google Scholar]
  49. Yang L, Miura K, Zhang B, Matsushita H, Yang YM, Liang S, Song J, Roh YS, Seki E (2017) TRIF differentially regulates hepatic steatosis and inflammation/fibrosis in mice. Cell Mol Gastroenterol Hepatol 3:469–483. 10.1016/j.jcmgh.2016.12.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yang YM, Fukui M, Wang Z, Miao F, Karriker MJ, Seki E (2018) Interventional potential of recombinant feline hepatocyte growth factor in a mouse model of non-alcoholic steatohepatitis. Front Endocrinol (Lausanne) 9:378. 10.3389/fendo.2018.00378 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yang YM, Noureddin M, Liu C, Ohashi K, Kim SY, Ramnath D, Powell EE, Sweet MJ, Roh YS, Hsin IF, Deng N, Liu Z, Liang J, Mena E, Shouhed D, Schwabe RF, Jiang D, Lu SC, Noble PW, Seki E (2019) Hyaluronan synthase 2-mediated hyaluronan production mediates Notch1 activation and liver fibrosis. Sci Transl Med. 10.1126/scitranslmed.aat9284 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yates TJ, Lopez LE, Lokeshwar SD, Ortiz N, Kallifatidis G, Jordan A, Hoye K, Altman N, Lokeshwar VB (2015) Dietary supplement 4-methylumbelliferone: an effective chemopreventive and therapeutic agent for prostate cancer. J Natl Cancer Inst. 10.1093/jnci/djv085 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ye D, Li FY, Lam KS, Li H, Jia W, Wang Y, Man K, Lo CM, Li X, Xu A (2012) Toll-like receptor-4 mediates obesity-induced non-alcoholic steatohepatitis through activation of X-box binding protein-1 in mice. Gut 61:1058–1067. 10.1136/gutjnl-2011-300269 [DOI] [PubMed] [Google Scholar]
  54. Zhu C, Kim K, Wang X, Bartolome A, Salomao M, Dongiovanni P, Meroni M, Graham MJ, Yates KP, Diehl AM, Schwabe RF, Tabas I, Valenti L, Lavine JE, Pajvani UB (2018) Hepatocyte Notch activation induces liver fibrosis in nonalcoholic steatohepatitis. Sci Transl Med. 10.1126/scitranslmed.aat0344 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES