Skip to main content
NCBI home page
American Journal of Physiology - Gastrointestinal and Liver Physiology logoLink to American Journal of Physiology - Gastrointestinal and Liver Physiology
. 2021 Jun 2;321(2):G123–G133. doi: 10.1152/ajpgi.00144.2021

Effect of chronic alcohol exposure on gut vitamin B7 uptake: involvement of epigenetic mechanisms and effect of alcohol metabolites

Kalidas Ramamoorthy 1, Subrata Sabui 1,5, Padmanabhan Srinivasan 1,5, Saleh Al-Juburi 1, Quang Pham 1, Brian D Chu 1,5, Rita D Simoes 3, James M Fleckenstein 3,4, Hamid M Said 1,2,5,✉
PMCID: PMC8410103  PMID: 34077272

graphic file with name gi-00144-2021r01.jpg

Open in a new tab

Keywords: alcohol/alcohol metabolites, biotin, epigenetics, human enteroids/colonoids, intestine/colonic uptake

Abstract

Vitamin B7 (biotin) is essential for normal health and its deficiency/suboptimal levels occur in a variety of conditions including chronic alcoholism. Mammals, including humans, obtain biotin from diet and gut-microbiota via absorption along the intestinal tract. The absorption process is carrier mediated and involves the sodium-dependent multivitamin transporter (SMVT; SLC5A6). We have previously shown that chronic alcohol exposure significantly inhibits intestinal/colonic biotin uptake via suppression of Slc5a6 transcription in animal and cell line models. However, little is known about the transcriptional/epigenetic factors that mediate this suppression. In addition, the effect of alcohol metabolites (generated via alcohol metabolism by gut microbiota and host tissues) on biotin uptake is still unknown. To address these questions, we first demonstrated that chronic alcohol exposure inhibits small intestinal and colonic biotin uptake and SMVT expression in human differentiated enteroid and colonoid monolayers. We then showed that chronic alcohol exposures of both, Caco-2 cells and mice, are associated with a significant suppression in expression of the nuclear factor KLF-4 (needed for Slc5a6 promoter activity), as well as with epigenetic alterations (histone modifications). We also found that chronic exposure of NCM460 human colonic epithelial cells as well as human differentiated colonoid monolayers, to alcohol metabolites (acetaldehyde, ethyl palmitate, ethyl oleate) significantly inhibited biotin uptake and SMVT expression. These findings shed light onto the molecular/epigenetic mechanisms that mediate the inhibitory effect of chronic alcohol exposure on intestinal biotin uptake. They further show that alcohol metabolites are also capable of inhibiting biotin uptake in the gut.

NEW & NOTEWORTHY Using complementary models, including human differentiated enteroid and colonoid monolayers, this study shows the involvement of molecular and epigenetic mechanisms in mediating the inhibitory effect of chronic alcohol exposure on biotin uptake along the intestinal tract. The study also shows that alcohol metabolites (generated by gut microbiota and host tissues) cause inhibition in gut biotin uptake.

INTRODUCTION

Vitamin B7 (biotin) is an indispensable micronutrient for normal human health due to the essential roles it plays in a variety of metabolic activities (1). Biotin serves as a cofactor for multiple carboxylases that catalyze key reactions in gluconeogenesis, fatty acid synthesis, and amino acid catabolism (1). In recent years, evidence has mounted showing functions for biotin beyond its role as cofactor, including regulation of immune response (2–6), gene expression (7–9), and mitochondrial function (10). Biotin deficiency and suboptimal levels occur in a variety of conditions including chronic alcoholism (11), IBD (12, 13), in patients with mutations in the SLC5A6 gene and other inborn errors of biotin metabolism (14–17), and those on long-term therapy with certain anticonvulsant drugs (18, 19). Biotin deficiency leads to a variety of clinical abnormalities including immune dysfunction and cutaneous and neurological features (19–21).

Humans (and other mammals) cannot synthesize biotin endogenously, and thus, must obtain the vitamin from exogenous sources (dietary and bacterial sources; 1) via intestinal absorption. The intestinal tract is exposed to two sources of biotin: dietary (absorbed in the small intestine) and microbiota-generated (absorbed in the large intestine). Using a variety of human and animal intestinal preparations, studies from our laboratory and others have shown that biotin absorption in both the small and large intestine is via a Na-dependent carrier-mediated process (22–25). Although different biotin transport systems appear to operate in mammalian cells (22, 26, 27), we have demonstrated using an intestinal-specific Slc5a6 knockout mouse model that the sodium-dependent multivitamin transporter (SMVT; product of the SLC5A6 gene) is the system responsible for biotin uptake in the intestinal tract (28, 29). Other studies from our laboratory have characterized different regulatory and cell biological aspects of the intestinal biotin uptake process (30–34). We have also investigated the effect of external/environmental factors to which the intestinal tract is exposed to on intestinal biotin uptake and SMVT expression (35–37). This includes studying the effect of chronic alcohol exposure on biotin uptake in the small and large intestine where significant inhibition was observed (37). In the latter studies, evidence was obtained to show that the inhibition is mediated at the level of transcription of the SLC5A6 gene (37). So far, however, there has been little known about the factors (e.g., transcription factors and epigenetic mechanisms) that mediate this effect. Also not known is the effect of alcohol oxidative (acetaldehyde) and nonoxidative (ethyl palmitate and ethyl oleate) metabolites on biotin uptake. Like ethanol, where blood and intestinal/colonic luminal concentrations are in a state of semi-equilibrium (38, 39), the latter metabolites also exist in considerable amounts in the small and large intestine, as a result of ethanol metabolism by the gut microbiota and the ethanol metabolizing enzymes in the gastrointestinal tract (38, 40). We addressed these issues in the current investigation using in vitro (cell lines), in vivo (mice), and ex vivo (human differentiated enteroid and colonoid monolayers) models. The results showed involvement of the transcriptional factor KLF-4, as well as epigenetic mechanisms (i.e., histone modifications, where a decrease in the euchromatin histone activators H3K4me3 and H3K9Ac, and an increase in the heterochromatin suppressor H3K27me3 marker) in mediating the alcohol inhibitory effect on SLC5A6 transcription. The results also showed that oxidative and nonoxidative alcohol metabolites are capable of inhibiting biotin uptake in the gut.

MATERIALS AND METHODS

Materials

[3H]Biotin (specific activity 30 Ci/mmol; radiochemical purity 98%) was purchased from American Radiolabel Chemicals (St. Louis, MO); polyclonal primary antibodies, anti-KLF-4 (Cat. No. AF3640) from R&D Systems, Inc. (Minneapolis, MN), anti-AP-2 (Cat. No. ab52222), and monoclonal primary antibody anti-β-actin (Cat. No. sc47778) were brought from Abcam (Cambridge, MA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. The secondary antibodies anti-rabbit IRDye 800 (Cat. No. 926–32211) and anti-mouse IRDye 680 (Cat. No. 926–68020) were obtained from LI-COR Biosciences (Lincoln, NE). Oligonucleotide primers were procured from Integrated DNA Technologies, Inc. (Coralville, IA). Ethyl oleate (Cat. No. 268011-5G), ethyl palmitate (Cat. No. P9009-5G), and acetaldehyde (Cat. No. 402788-1L) were purchased from Millipore Sigma (St. Louis, MO). The chromatin IP kit SimpleChIP (Cat. No. 9005S) obtained from CellSignaling, Inc., (Danvers, MA). All cell culture products and other molecular biology reagents were obtained from commercial sources.

Methods

Cell culture, exposure to alcohol and its metabolites, and [3H]biotin uptake.

Human-derived intestinal epithelial Caco-2 cells and human-derived colonic epithelial NCM460 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA) and INCELL (San Antonio, TX), respectively. Caco-2 cells were grown in Eagle’s minimal essential medium (EMEM) whereas, NCM460 cells were maintained in M3 Base culture medium, supplemented with FBS (10% for Caco-2 cells and 20% for NCM460), penicillin (100 U/mL), and streptomycin (100 μg/mL) and incubated at 37°C in 5% CO2 incubator. Cells were grown in 12 well plate and then chronically exposed to alcohol [200 mM; a concentration that mimics the level of alcohol in the intestine in chronic alcohol drinkers (41)] or to its nonoxidative metabolites ethyl oleate (50 μM) and ethyl palmitate (50 μM) or to its oxidative metabolites acetaldehyde (500 μM) for 96 h, as described before (42, 43). After 96 h of exposure to alcohol or to its metabolites, [3H]biotin uptake was examined at 37°C in Krebs–Ringer (KR) buffer for 5 min; radioactive content was then determined using a scintillation counter as described by us previously (22, 23).

Human primary enteroid and colonoid cultures, their differentiation, exposure to alcohol/metabolites, and [3H]biotin uptake studies.

Human enteroids and colonoids were generated from biopsy samples (obtained from adult normal subjects) at the Digestive Diseases Research Center of the Washington University School of Medicine, St. Louis, MO (44, 45). Frozen samples were quickly thawed, washed with DMEM/F-12 with HEPES (Invitrogen) medium to remove DMSO and cell debris and plated in Matrigel (BD Biosciences) drops (15 μL) followed by incubation at 37°C with conditioned media (CM) [prepared from a 1:1 mixture of the L-WRN cell line (44–46) and primary culture media (Advanced DMEM/F12; Invitrogen) supplemented with 20% FBS, 2 mM l-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 10 μM Stemolecule Y-27632 (ROCK inhibitor; Reprocell), and 10 μM SB 431542 (TGFBR1 inhibitor; Peprotech)]. To generate polarized primary enteroid and colonoid monolayers, cells grown on Matrigel droplets were dissociated by TrypLE (Gibco), resuspended in CM media, and 50,000 cell were plated onto 24 well Transwell insert (0.4 μm, 6.5 mm, 0.33 cm2; Corning) coated with type IV human collagen (33 µg/mL) (Sigma), then grown for 4 days before induction of differentiation by addition of differentiation media (5% CM media supplemented with Stemolecule Y-27632 but not SB 431542). Differentiated enteroid and colonoid monolayers were then chronically exposed (96 h) to alcohol (200 mM); differentiated colonoid monolayers were also exposed to alcohol metabolites [acetaldehyde (500 μM), ethyl palmitate (50 μM) and ethyl oleate (50 μM), followed by performance of [3H]biotin uptake (30 min; 37°C) in Krebs–Ringer (KR)].

Chronic alcohol feeding of mice.

Alcohol pair-feeding of age- and sex-matched mice (C57BL/6J, The Jackson Laboratory) was performed as described previously (37). Briefly, mice were divided into two groups: alcohol-fed and pair-fed control. The first group was given (for 4 wk) an ethanol-liquid diet (Lieber-DeCarli) that provides 25% of total calories in the form of ethanol; alcohol in the liquid diet was gradually increased by 5% of total calories per day until it reached 25%. The control group was pair-fed a control-liquid diet where maltose-dextrin was used to replace ethanol iso-calorically. At the end of the feeding period, animals were euthanized, and their small intestinal mucosa was collected by scrapping and used in the epigenetic and molecular biological studies. All animal procedures conducted were approved by the animal use committee of the Veterans Affairs Medical Center at Long Beach, CA.

RNA isolation and real-time-quantitative polymerase chain reaction.

Total RNA was isolated from the different samples (Caco-2 cells, NCM460 cells, differentiated enteroid and colonoid monolayers) as well as mouse jejunal mucosa using QIAzol reagent (QIAGEN) and RNeasy Kit (QIAGEN) following the manufacturer’s protocol. The complemented DNA (cDNA) was then prepared using the Verso-cDNA Synthesis Kit (Thermo Fisher Scientific). Levels of mRNA expression was quantified by RT-qPCR using iQ SYBER Green Super mix (Bio-Rad) in the CFX96 real-time PCR system (Bio-Rad) according to the manufacturer's instructions using gene-specific primers (see Table 1 for list). The relative mRNA expression was quantified by normalizing Ct values to the respective β-actin following 2−ΔΔCt method (47).

Table 1.

List of primers used in real-time PCR analysis [forward and reverse (5′-3′)]

Histone Modifications
hSMVT-P1 GTAGCGCCAGAGCCCTTT; CACCAAGGGAACGGAAAAT
mSMVT-P1 AATCCTGTCACTCTGGGGCGT; GAAGAATGGAGAGATGGTGGGTC
Gene-Specific Primers
hSLC5A6 TGTCTACCTTCTCCATCATGGA; TAGAGCCCAATGGCAAGAGA
hKLF-4 CCGCTCCATTACCAAGAGCT; ATCGTCTTCCCCTCTTTGGC
hAP2α GTTACCCTGCTCACATCACTAG; TCTTGTCACTTGCTCATTGGG
hβ-actin CATCCTGCGTCTGGACCT; TAATGTCACGCACGATTTCC
mKLF-4 AACATGCCCGGACTTACAAA; TTCAAGGGAATCCTGGTCTTC
mSlc5a6 GGATCTGTGGGACTGTGA; CACATCTGTCCAGATGACA
mAP2α CAATGAGCAAGTGGCAAGAA; GTGGGTCAAGCAACTCTGG
mβ-actin GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT
Slc5a6 Promoter Bisulfite PCR Primers (4 pairs)
TTTTTTTTGTATTTTAGGTAGAGTTAGGGT; AATAACAAAATTTAAAAACTAAACCTC
GATAGATTTATTATTTTTTTATTTTTTTTG; ATCTCCACATAAAAACAACTAACCC
TTTTTATGTGGAGATTTTAAAGGTG; CATTAAAATAAAAAATTCCCAAACTC
AGTTTGGGAATTTTTTATTTTAATGTT; CCCTTCCAATCAAACCTACTACTATT
Open in a new tab

Isolation of protein and Western blotting.

Total protein was isolated using RIPA buffer (Sigma) containing complete protease inhibitor cocktail (Roche), and the soluble protein fraction was separated by centrifugation at 12,000 rpm for 20 min. Then 60 μg of total protein was loaded onto a 4%–12% NuPAGE mini gel (Invitrogen) and separated protein was blotted on an PVDF membrane followed by incubation in blocking buffer (LI-COR Biosciences). The blot was probed overnight with primary antibodies against SMVT (1:500 dilution) (29), KLF-4 (1:200 dilution) polyclonal antibodies, or β-actin (1:5,000 dilution) monoclonal antibody. The blots were then incubated with anti-rabbit IR-800 dye and anti-mouse IR-680 dye (LI-COR) secondary antibodies (1:30,000) for 30 min. Relative protein expression was determined by comparing the fluorescence intensities of the target proteins to β-actin protein intensity in an Odyssey infrared imaging system (LI-COR).

Assessment of DNA methylation status in vitro and in vivo.

The methylation status of the SLC5A6 promoter region was determined by bisulfite sequencing as described previously (48). Human intestinal epithelial Caco-2 cells and small intestinal mucosa of mice exposed/fed alcohol chronically and their appropriate pair-fed controls were used in the DNA methylation analysis. Genomic DNA was isolated using Wizard Genomic DNA purification kit (Promega, Madison, WI) according to the manufacturer’s instructions. The genomic DNA samples isolated from alcohol treated and control Caco-2 cells (n = 6 for each) were subjected to bisulfite conversion followed by PCR amplification of the SLC5A6 promoter region (Zymo Research, Irvine, CA). The bisulfite amplicon sequencing reads were then aligned with the SLC5A6 promoter sequence (GenBank no. AF 442738) and analyzed. The methylation ratio in the SLC5A6 promoter region from the alcohol-treated and control samples were then calculated by using methylated CpG-counts/total CpG-counts. The methylation ratio of the two groups were then averaged and compared. With regards to analyzing changes in the methylation status of the mouse Slc5a6 promoter, genomic DNA was isolated from the alcohol-fed and control mice (n = 5 for each group) in our laboratory and processed as described by us previously (48).

Chromatin immunoprecipitation assay.

Alcohol exposed Caco-2 cells and jejunal mucosa (from the alcohol-fed and control mice) were used as described previously (48, 49). Mucosa from five mice were pooled for one chromatin immunoprecipitation (ChIP) assay; a total of 15 control and 15 alcohol-fed mice were used for this assay. Chromatin was cross-linked with 1% formaldehyde, followed by termination of the reaction via addition of glycine stop solution. Cold PBS containing protease inhibitor cocktail (2 mL) was then added, centrifuged at 1,500 rpm for 5 min, and the resulting pellet was resuspended in 1 mL of ice-cold buffer A containing DTT and protease inhibitor cocktail (PIC). Nuclei were then prepared followed by digestion of chromatin with micrococcal nuclease. Samples were sonicated to shear DNA into fragments, centrifuged at 10,000 rpm for10 min, followed by chromatin analysis. Then 5 µg of digested chromatin from both alcohol exposed and control samples were incubated overnight with 2 µg of the specific antibodies (H3, H3K4me3, H3K9Ac, and H3K27me3), including anti-IgG as negative control. Finally, the immunoprecipitated samples were analyzed by qPCR as previously described (48) using SLC5A6 promoter-specific primers (Table 1); data were then normalized and represented as percentage of enrichment relative to H3 compared to control

Statistical Analysis

All data were presented as means ± standard error (SE) and graphs made using GraphPad Prism 8 software (v. 8, GraphPad Software Inc., La Jolla). The graphical data representations in all figures were expressed as a percentage relative to simultaneously performed controls. Carrier-mediated [3H]biotin uptake was determined by deducting uptake in the presence of 1 mM unlabeled biotin from that in its absence. Level of significance between control and treated groups were set at P < 0.05 and statistical significance was evaluated by Student t-test.

RESULTS

Effect of Chronic Exposure to Alcohol on Carrier-Mediated Biotin Uptake and SMVT Expression in Human Differentiated Enteroid Monolayers

Our previous studies using animal and cell line models have shown that chronic alcohol exposure leads to significant inhibition in biotin uptake and SMVT expression in the small intestine (37). Whether chronic alcohol exposure similarly affect biotin uptake and SMVT expression in native human small intestinal epithelia was not clear. We addressed this question using human differentiated enteroid monolayers derived from normal human subjects. The results showed that exposure of enteroid monolayers to alcohol (200 mM; 96 h) leads to a significant inhibition in carrier-mediated biotin uptake (P < 0.01) and in level of expression of the SMVT (P < 0.01) compared to untreated controls (Fig. 1, A and B). These findings demonstrate that alcohol exposure inhibits intestinal biotin uptake in native human intestinal tissue and establish the suitability of previous animal (rodent) and cell line (Caco-2 cells) models to further investigate the mechanism(s) involved in the effect of chronic alcohol exposure on intestinal biotin transport.

Figure 1.

Figure 1.

Open in a new tab

Effect of chronic exposure to alcohol on biotin uptake and SMVT expression in human differentiated enteroid monolayers: Differentiated human primary enteroid monolayers were chronically exposed to alcohol (200 mM for 96 h). A: carrier-mediated [3H]biotin (64 nM) uptake. (n = 5; **P < 0.01). B: level of expression of SMVT mRNA (n = 3; **P < 0.01) was determined by RT-qPCR and data were normalized relative to β-actin see methods. Statistical significance for uptake and RT-qPCR data were evaluated by Student t test.

Involvement of Transcriptional Factors in the Inhibitory Effect of Chronic Alcohol Exposure on SLC5A6 Transcription

Although involvement of transcription mechanism(s) in mediating the effect of chronic alcohol exposure on SMVT expression in intestinal epithelial cells have been demonstrated in previous studies in our laboratory (37), little is known about the nature of the mechanisms involved. Thus, in this study we examined whether suppression in the expression of the nuclear factors KLF-4 and AP-2 (which play important roles in driving the activity of the SLC5A6 promoter; 33) as well as epigenetic mechanisms are involved in mediating the SLC5A6 transcription inhibitory effect. The results showed that chronic exposure to alcohol both in vitro (Caco-2 cells) and in vivo (mice) led to a significant (P < 0.01) reduction in the level of expression of KLF-4 protein and mRNA; however, no change in level of expression of AP-2 was observed (Fig. 2).

Figure 2.

Figure 2.

Open in a new tab

Effect of chronic exposure to alcohol in vitro (Caco-2 cells) and in vivo (mice) on expression of the nuclear factors KLF-4 and AP-2 in intestinal epithelial cells: I: human intestinal Caco-2 cells were exposed to alcohol (200 mM for 96 h). II: mice were fed alcohol for 4 wk and their intestinal mucosa was collected and used in the study. A: level of mRNA expression of KLF-4 (i) and AP-2 (ii) in Caco-2 cells and in small intestinal mucosa of mice was determined by RT-qPCR. (n = 4; **P < 0.01; NS, not significant). B: level of expression of KLF-4 protein in Caco-2 cells (I) and in small intestinal mucosa of mice (II) was determined by Western blotting. All mRNA and protein expression data were normalized relative to β-actin and compared with their respective controls (n = 4; **P < 0.01). Statistical significance was evaluated by Student t test.

Involvement of Epigenetic Mechanisms in Mediating the Inhibitory Effect of Chronic Alcohol Exposure on SLC5A6 Transcription

Possible involvement of epigenetic mechanisms in the inhibitory effect of chronic exposure to alcohol on SLC5A6 transcription in intestinal epithelial cells was examined by focusing on possible alterations in DNA methylation status and on histone modifications. We focused on these epigenetic mechanisms because chronic alcohol exposure has been shown to affect transcription of other genes via these mechanisms (50, 51). In examining possible changes of DNA methylation, we first subjected the human SLC5A6 promoter to in silico Methprimer analysis, which predicted the existence of four CpG islands (located between −5,451/−5,344, −5,057/−4,576, −4,564/−4,022 and −4,010/−3,893, using translation start site +1) in this promoter, we then examined the effect of chronic alcohol exposure of Caco-2 cells and intestinal mucosa of mice on methylation status of their respective SLC5A6 promoter regions. The results showed no significant change in DNA methylation status of the SLC5A6 promoter regions of both human (Caco-2 cells) and mouse intestine (data not shown). These results suggest that the effect of chronic alcohol exposure on transcriptional activity of SLC5A6 is unlikely mediated via changes in the methylation status of this gene promoter.

In examining possible role of histone modifications in mediating the inhibitory effects of chronic alcohol exposure on SLC5A6 transcription, we investigated possible involvement of this mechanism using ChIP-qPCR and monitored for changes in H3K4me3 and H3K9Ac (activation markers) and H3K27me3 (a repressive marker) expression in Caco-2 cells and mouse small intestinal exposed to alcohol chronically. With both models, the results showed a significant reduction in levels of expression of H3K4me3 and H3K9Ac, and a significant induction in the level of H3K27me3 in alcohol exposed cells/mucosa compared to untreated controls (Fig. 3, A, i–iii and B, i–iii). These results suggest that the effect of chronic alcohol exposure on transcriptional activity of SLC5A6 is mediated, in part, via changes in the methylation status of this gene promoter.

Figure 3.

Figure 3.

Open in a new tab

Effect of chronic alcohol exposure in vitro (Caco-2 cells) and in vivo (mice) on histone modifications of the SLC5A6 promoter in intestinal epithelial cells: Analysis of histone H3 modifications [activator markers H3K4me3 (i) and H3K9Ac (ii); repressor marker H3K27me3 (iii)] inCaco-2 cells (A) and mice intestinal mucosa (B). ChIP assays were performed using Caco-2 cells/freshly scrapped mice intestinal mucosa and antibodies specific for modified forms of histone H3, followed by quantitative RT-qPCR (see Methods) (n = 3; **P < 0.01, *P < 0.05). The RT-qPCR results were analyzed using the Percent Input and are presented in % relative to input DNA. The background signal (normal rabbit IgG) to verify the immunoprecipitation specificity was not detected in RT-qPCR. Statistical significance was evaluated by Student t test.

Effect of Chronic Exposure to Alcohol and to Its Metabolites on Colonic Carrier-Mediated Biotin Uptake and SMVT Expression

The normal microbiota of the large intestine generates a significant amount of biotin in the free form that is readily available for absorption. Indeed, an efficient carrier-mediated uptake process that involves the SMVT system has been shown to exist in the cells of large intestine (23). Previous animal studies have shown that this biotin uptake process is sensitive to the effect of chronic exposure to alcohol (37). It is not clear, however, if chronic alcohol exposure also inhibits biotin uptake by human colonocytes. Also not known is whether the alcohol metabolites that are generated via the action of ethanol-metabolizing enzymes of the gut microbiota and the host gut mucosa/tissue (i.e., acetaldehyde, ethyl palmitate, and ethyl oleate; 42, 43) can affect colonic biotin uptake and SMVT expression. Thus, in these studies, we first examined the effect of chronic alcohol exposure on biotin uptake by human-derived colonic epithelial NCM460 cells and human differentiated colonoid monolayers. The results showed that chronic alcohol exposure of both human colonic preparations caused a significant inhibition in carrier-mediated biotin uptake (P < 0.01) as well as in the expression level of SMVT (P < 0.01) compared with untreated controls (Fig. 4, A, i and ii and B, i and ii).

Figure 4.

Figure 4.

Open in a new tab

Effect of chronic exposure to alcohol on colonic biotin uptake and SMVT expression: studies using human-derived colonic epithelial NCM460 cells and human differentiated colonoid monolayers: NCM460 cells (A) and human differentiated colonoid monolayers (B) were exposed chronically to alcohol as described in methods. i: carrier-mediated [3H]biotin uptake. ii: level of expression of SMVT mRNA (determined by RT-qPCR, and values were normalized relative to β-actin). Statistical significance of biotin uptake (n = 9; **P < 0.01) and RT-qPCR (n = 4; **P < 0.01) data in NCM460 cells; biotin uptake and RT-qPCR data in human colonoid monolayers (n = 3, **P < 0.01) were evaluated by Student t test.

In examining the effect of alcohol metabolites on colonic biotin uptake, we focused on testing the effect of the alcohol oxidative metabolite acetaldehyde as well as the non-oxidative metabolites ethyl palmitate and ethyl oleate. Again, we used both NCM460 cells and human differentiated colonoid monolayers as models. The result showed that exposure of these colonic preparations to acetaldehyde (500 μM; 96 h) and to ethyl palmitate and ethyl oleate (both 50 μM; 96 h) led to a significant inhibition in carrier-mediated biotin uptake and SMVT expression compared to untreated controls (Fig. 5). Together, these results show that oxidative and non-oxidative metabolites of alcohol profoundly affect colonic carrier-mediated uptake of the microbiota-generated biotin and expression of its transporter.

Figure 5.

Figure 5.

Open in a new tab

Effect of chronic exposure to oxidized and nonoxidized alcohol metabolites on colonic biotin uptake and SMVT expression: studies using human-derived colonic epithelial NCM460 cells, and human differentiated colonoid monolayers: NCM460 cells (A) and human differentiated colonoid monolayers (B) were exposed chronically to the alcohol oxidative metabolite acetaldehyde (I) and to the nonoxidative metabolites ethyl palmitate (II) and ethyl oleate (III) (see Methods). i: carrier-mediated [3H]biotin; ii and iii: level of expression of SMVT protein and mRNA, respectively. All protein and mRNA results were normalized relative to β-actin, and comparison was made relative to simultaneously performed controls. Statistical significance of biotin uptake (n = 9; **P < 0.01), SMVT protein and mRNA (n = 4 for both; **P < 0.01) data in NCM460 cells; biotin uptake and SMVT mRNA data in human colonoid monolayers (n = 3, *P < 0.05, **P < 0.01) were evaluated by Student t test.

DISCUSSION

The aim of this investigation was to shed light onto the role of transcriptional and epigenetic mechanisms in mediating the previously observed inhibitory effects of chronic alcohol exposure on intestinal biotin uptake and on expression of the transport system involved, i.e., SMVT (product of the SLC5A6 gene). We also aimed at examining the effect of the alcohol metabolites (i.e., acetaldehyde, ethyl palmitate, and ethyl oleate; 42, 43) that are generated via alcohol metabolism by the gut microbiota and by the host lining mucosa/tissues on biotin uptake and SMVT expression. We used complementary in vitro (Caco-2 and NCM460 cells), in vivo (mice), and ex vivo (human differentiated enteroid and colonoid monolayers) as models in our investigations.

The results showed that chronic alcohol exposure of human differentiated primary enteroids to lead to a significant inhibition in carrier-mediated biotin uptake and SMVT expression. These findings confirm in human primary intestinal epithelial preparation the previously reported observations with animal (in vivo) and cultured intestinal epithelial cell line (in vitro) preparations of inhibition in biotin uptake and SMVT expression upon chronic exposure to alcohol. The findings also established the suitability of the earlier models (rodents, and in vitro cultured intestinal epithelial cells) for further investigations into the mechanisms that mediate the effect of chronic alcohol exposure on biotin absorption. In studying possible involvement of transcriptional mechanism(s) in mediating the effect of chronic alcohol exposure on SLC5A6 transcription, we focused our effort on determining the effect of alcohol exposure on level of expression of the nuclear factors KLF-4 and AP-2. The reason for that is because these nuclear factors play important roles in driving the activity of the SLC5A6 promoter in intestinal epithelia (33). The results showed that while alcohol exposure has no effect on expression of AP-2 in intestinal epithelial cells, it caused a significant inhibition in level of expression of KLF-4. The latter finding raises the possibility that at least part of the alcohol inhibitor effect on SLC5A6 transcription in intestinal epithelial cells could be mediated via this mechanism. It is interesting to mention here that the effect of chronic alcohol exposure on KLF-4 expression is not unique to intestinal epithelia but has also been observed in other tissues (48, 52).

In examining possible involvement of epigenetic mechanisms in mediating the inhibitory effect of chronic alcohol exposure on SLC5A6 transcription in intestinal epithelia, we focused on possible changes in DNA methylation and histone modifications since these mechanisms are known to be involved in mediating the effect of external factors (including chronic alcohol exposure) on gene expression (48, 53, 54). The results of both the in vitro and in vivo studies showed that while chronic alcohol exposure causes significant changes in histone modifications [where a significant decrease in expression of the euchromatin histone (activators H3K4me3 and H3K9Ac), and a significant increase in expression of the heterochromatin (repressor H3K27me3 marker)], it did not affect the methylation status of the SLC5A6 promoter. These findings suggest possible involvement of the former epigenetic mechanisms in mediating at least part of the inhibitory effect of chronic alcohol exposure on SLC5A6 transcription. The lack of effect of chronic alcohol exposure on methylation status of the SLC5A6 promoter in intestinal epithelial cells is in contrast to the significant changes that were observed in the methylation status of this gene promoter in pancreatic acinar cells (48); the latter suggests that the alcohol effect on SLC5A6 promoter methylation status is tissue specific in nature.

In examining the effect of alcohol and its metabolites (those that are generated as result of alcohol metabolism by the gut microbiota and the host intestinal mucosa/tissues) on colonic uptake of biotin, we first confirmed our previous findings in animals (rats; 37) using human colonic models: differentiated primary colonoid monolayers ex vivo and human-derived colonic epithelial NCM460 cells in vitro. With both of these human colonic cell models, similar results were obtained in that chronic alcohol exposure significantly inhibits biotin uptake and SMVT expression. We then examined the effect of oxidative (acetaldehyde) and non-oxidative (ethyl palmitate and ethyl oleate) alcohol metabolites on colonic biotin uptake and SMVT expression using NCM460 cells and human differentiated colonoid monolayers. The results showed that chronic alcohol exposure of these human colonic preparations leads to a significant inhibition in carrier-mediated biotin uptake and SMVT expression.

In summary, results of these investigations shed light onto the transcriptional and epigenetic mechanisms that mediate the observed inhibition in SLC5A6 transcription in intestinal epithelial cells. The results also show that alcohol metabolites that gut epithelia encounters are also capable of inhibiting biotin uptake and SMVT expression.

GRANTS

This study was supported by the National Institutes of Health (NIH) Grants DK56061, AA018071, and DK58057 (to H.M.S.) and AI126887 (to J.M.F.), the Department of Veterans Affairs (Merit I01BX001142 to H.M.S. and I01BX004825 to J.M.F.), and the Digestive Diseases Research Core Center at Washington University School of Medicine Grant P30 DK5257.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

K.R., S.S., P.S., and H.M.S. conceived and designed research; K.R., S.S., P.S., S.A.-J., Q.P., B.D.C., and R.D.S. performed experiments; K.R., S.S., P.S., S.A.-J., Q.P., B.D.C., R.D.S., J.M.F., and H.M.S. analyzed data; K.R., S.S., P.S., R.D.S., J.M.F., and H.M.S. interpreted results of experiments; K.R. and S.S. prepared figures; K.R. and S.S. drafted manuscript; K.R., S.S., P.S., S.A-J., Q.P., J.M.F., and H.M.S. edited and revised manuscript; K.R., S.S., P.S., Q.P., B.D.C., R.D.S., J.M.F., and H.M.S. approved final version of manuscript.

REFERENCES

  • 1.Said HM. Biotin: biochemical, physiological and clinical aspects. Subcell Biochem 56: 1–19, 2012. doi: 10.1007/978-94-007-2199-9_1. [DOI] [PubMed] [Google Scholar]
  • 2.Báez-Saldaña A, Díaz G, Espinoza B, Ortega E. Biotin deficiency induces changes in subpopulations of spleen lymphocytes in mice. Am J Clin Nutr 67: 431–437, 1998. doi: 10.1093/ajcn/67.3.431. [DOI] [PubMed] [Google Scholar]
  • 3.Elahi A, Sabui S, Narasappa NN, Agrawal S, Lambrecht NW, Agrawal A, Said HM. Biotin deficiency induces Th1- and Th17-mediated proinflammatory responses in human CD4+ T lymphocytes via activation of the mTOR signaling pathway. J Immunol 200: 2563–2570, 2018. doi: 10.4049/jimmunol.1701200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kung JT, Mackenzie CG, Talmage DW. The requirement for biotin and fatty acids in the cytotoxic T-cell response. Cell Immunol 48: 100–110, 1979. doi: 10.1016/0008-8749(79)90103-5. [DOI] [PubMed] [Google Scholar]
  • 5.Kuroishi T, Endo Y, Muramoto K, Sugawara S. Biotin deficiency up-regulates TNF-alpha production in murine macrophages. J Leukoc Biol 83: 912–920, 2008. doi: 10.1189/jlb.0607428. [DOI] [PubMed] [Google Scholar]
  • 6.Kuroishi T, Kinbara M, Sato N, Tanaka Y, Nagai Y, Iwakura Y, Endo Y, Sugawara S. Biotin status affects nickel allergy via regulation of interleukin-1beta production in mice. J Nutr 139: 1031–1036, 2009. doi: 10.3945/jn.108.097543. [DOI] [PubMed] [Google Scholar]
  • 7.Rodriguez-Melendez R, Griffin JB, Zempleni J. The expression of genes encoding ribosomal subunits and eukaryotic translation initiation factor 5A depends on biotin and bisnorbiotin in HepG2 cells. J Nutr Biochem 17: 23–30, 2006. doi: 10.1016/j.jnutbio.2005.04.001. [DOI] [PubMed] [Google Scholar]
  • 8.Rodriguez-Melendez R, Zempleni J. Regulation of gene expression by biotin (review). J Nutr Biochem 14: 680–690, 2003. doi: 10.1016/j.jnutbio.2003.07.001. [DOI] [PubMed] [Google Scholar]
  • 9.Wiedmann S, Rodriguez-Melendez R, Ortega-Cuellar D, Zempleni J. Clusters of biotin-responsive genes in human peripheral blood mononuclear cells. J Nutr Biochem 15: 433–439, 2004. doi: 10.1016/j.jnutbio.2004.02.005. [DOI] [PubMed] [Google Scholar]
  • 10.Madsen CT, Sylvestersen KB, Young C, Larsen SC, Poulsen JW, Andersen MA, Palmqvist EA, Hey-Mogensen M, Jensen PB, Treebak JT, Lisby M, Nielsen ML. Biotin starvation causes mitochondrial protein hyperacetylation and partial rescue by the SIRT3-like deacetylase Hst4p. Nat Commun 6: 7726, 2015. doi: 10.1038/ncomms8726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bonjour JP. Vitamins and alcoholism. V. Riboflavin, VI. Niacin, VII. Pantothenic acid, and VIII. Biotin. Int J Vitam Nutr Res 50: 425–440, 1980. [PubMed] [Google Scholar]
  • 12.Fernandez-Banares F, Abad-Lacruz A, Xiol X, Gine JJ, Dolz C, Cabre E, Esteve M, Gonzalez-Huix F, Gassull MA. Vitamin status in patients with inflammatory bowel disease. Am J Gastroenterol 84: 744–748, 1989. [PubMed] [Google Scholar]
  • 13.Okabe N, Urabe K, Fujita K, Yamamoto T, Yao T, Doi S. Biotin effects in Crohn's disease. Dig Dis Sci 33: 1495–1496, 1988. doi: 10.1007/BF01537009. [DOI] [PubMed] [Google Scholar]
  • 14.Schwantje M, de Sain-van der Velden M, Jans J, van Gassen K, Dorrepaal C, Koop K, Visser G. Genetic defect of the sodium-dependent multivitamin transporter: A treatable disease, mimicking biotinidase deficiency. JIMD Rep 48: 11–14, 2019. doi: 10.1002/jmd2.12040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Subramanian VS, Constantinescu AR, Benke PJ, Said HM. Mutations in SLC5A6 associated with brain, immune, bone, and intestinal dysfunction in a young child. Hum Genet 136: 253–261, 2017. doi: 10.1007/s00439-016-1751-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sweetman L, Nyhan WL. Inheritable biotin-treatable disorders and associated phenomena. Annu Rev Nutr 6: 317–343, 1986. doi: 10.1146/annurev.nu.06.070186.001533. [DOI] [PubMed] [Google Scholar]
  • 17.Velázquez-Arellano A. From an inborn error patient to a search for regulatory meaning: a biotin conducted voyage. Mol Genet Metab 87: 194–197, 2006. doi: 10.1016/j.ymgme.2005.10.017. [DOI] [PubMed] [Google Scholar]
  • 18.Krause KH, Berlit P, Bonjour JP. Impaired biotin status in anticonvulsant therapy. Ann Neurol, 12: 485–486, 1982. doi: 10.1002/ana.410120513. [DOI] [PubMed] [Google Scholar]
  • 19.Krause KH, Bonjour JP, Berlit P, Kochen W. Biotin status of epileptics. Ann NY Acad Sci 447: 297–313, 1985. doi: 10.1111/j.1749-6632.1985.tb18447.x. [DOI] [PubMed] [Google Scholar]
  • 20.Cowan MJ, Wara DW, Packman S, Ammann AJ, Yoshino M, Sweetman L, Nyhan W. Multiple biotin-dependent carboxylase deficiencies associated with defects in T-cell and B-cell immunity. Lancet 2: 115–118, 1979. doi: 10.1016/s0140-6736(79)90002-3. [DOI] [PubMed] [Google Scholar]
  • 21.Ginsburg CH, Dambrauskas JT, Ault KA, Falchuk ZM. Impaired natural killer cell activity in patients with inflammatory bowel disease: evidence for a qualitative defect. Gastroenterology 85: 846–851, 1983. [PubMed] [Google Scholar]
  • 22.Balamurugan K, Ortiz A, Said HM. Biotin uptake by human intestinal and liver epithelial cells: role of the SMVT system. Am J Physiol Gastrointest Liver Physiol 285: G73–G77, 2003. doi: 10.1152/ajpgi.00059.2003. [DOI] [PubMed] [Google Scholar]
  • 23.Said HM, Ortiz A, McCloud E, Dyer D, Moyer MP, Rubin S. Biotin uptake by human colonic epithelial NCM460 cells: a carrier-mediated process shared with pantothenic acid. Am J Physiol Cell Physiol 275: C1365–C1371, 1998. doi: 10.1152/ajpcell.1998.275.5.C1365. [DOI] [PubMed] [Google Scholar]
  • 24.Said HM, Redha R, Nylander W. Biotin transport in basolateral membrane vesicles of human intestine. Gastroenterology 94: 1157–1163, 1988. doi: 10.1016/0016-5085(88)90007-8. [DOI] [PubMed] [Google Scholar]
  • 25.Said HM. Cell and molecular aspects of human intestinal biotin absorption. J Nutr 139: 158–162, 2009. doi: 10.3945/jn.108.092023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Daberkow RL, White BR, Cederberg RA, Griffin JB, Zempleni J. Monocarboxylate transporter 1 mediates biotin uptake in human peripheral blood mononuclear cells. J Nutr 133: 2703–2706, 2003. doi: 10.1093/jn/133.9.2703. [DOI] [PubMed] [Google Scholar]
  • 27.Prasad PD, Ganapathy V. Keratinocytes join forces with immune cells in the prosecution of SMVT as a “false” biotin transporter. J Invest Dermatol 120: 11–12, 2003. doi: 10.1046/j.1523-1747.2003.12075.x. [DOI] [PubMed] [Google Scholar]
  • 28.Ghosal A, Lambrecht N, Subramanya SB, Kapadia R, Said HM. Conditional knockout of the Slc5a6 gene in mouse intestine impairs biotin absorption. Am J Physiol Gastrointest Liver Physiol 304: G64–G71, 2013. doi: 10.1152/ajpgi.00379.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sabui S, Skupsky J, Kapadia R, Cogburn K, Lambrecht NW, Agrawal A, Said HM. Tamoxifen-induced, intestinal-specific deletion of Slc5a6 in adult mice leads to spontaneous inflammation: involvement of NF-κB, NLRP3, and gut microbiota. Am J Physiol Gastrointest Liver Physiol 317: G518–G530, 2019. doi: 10.1152/ajpgi.00172.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Dey S, Subramanian VS, Chatterjee NS, Rubin SA, Said HM. Characterization of the 5’ regulatory region of the human sodium-dependent multivitamin transporter, hSMVT. Biochim Biophys Acta 1574: 187–192, 2002. doi: 10.1016/s0167-4781(02)00226-9. [DOI] [PubMed] [Google Scholar]
  • 31.Ghosal A, Subramanian VS, Said HM. Role of the putative N-glycosylation and PKC-phosphorylation sites of the human sodium-dependent multivitamin transporter (hSMVT) in function and regulation. Biochim Biophys Acta 1808: 2073–2080, 2011. doi: 10.1016/j.bbamem.2011.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Reidling JC, Nabokina SM, Said HM. Molecular mechanisms involved in the adaptive regulation of human intestinal biotin uptake: a study of the hSMVT system. Am J Physiol Gastrointest Liver Physiol 292: G275–G281, 2007. doi: 10.1152/ajpgi.00327.2006. [DOI] [PubMed] [Google Scholar]
  • 33.Reidling JC, Said HM. Regulation of the human biotin transporter hSMVT promoter by KLF-4 and AP-2: confirmation of promoter activity in vivo. Am J Physiol Cell Physiol 292: C1305–C1312, 2007. doi: 10.1152/ajpcell.00360.2006. [DOI] [PubMed] [Google Scholar]
  • 34.Subramanian VS, Marchant JS, Boulware MJ, Ma TY, Said HM. Membrane targeting and intracellular trafficking of the human sodium-dependent multivitamin transporter in polarized epithelial cells. Am J Physiol Cell Physiol 296: C663–C671, 2009. doi: 10.1152/ajpcell.00396.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ghosal A, Jellbauer S, Kapadia R, Raffatellu M, Said HM. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms. Am J Physiol Gastrointest Liver Physiol 309: G123–G131, 2015. doi: 10.1152/ajpgi.00112.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lakhan R, Said HM. Lipopolysaccharide inhibits colonic biotin uptake via interference with membrane expression of its transporter: a role for a casein kinase 2-mediated pathway. Am J Physiol Cell Physiol 312: C376–C384, 2017. doi: 10.1152/ajpcell.00300.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Subramanya SB, Subramanian VS, Kumar JS, Hoiness R, Said HM. Inhibition of intestinal biotin absorption by chronic alcohol feeding: cellular and molecular mechanisms. Am J Physiol Gastrointest Liver Physiol 300: G494–G501, 2011. doi: 10.1152/ajpgi.00465.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Elamin EE, Masclee AA, Dekker J, Jonkers DM. Ethanol metabolism and its effects on the intestinal epithelial barrier. Nutr Rev 71: 483–499, 2013. doi: 10.1111/nure.12027. [DOI] [PubMed] [Google Scholar]
  • 39.Levitt MD, Doizaki W, Levine AS. Hypothesis: metabolic activity of the colonic bacteria influences organ injury from ethanol. Hepatology 2: 598–600, 1982. doi: 10.1002/hep.1840020514. [DOI] [PubMed] [Google Scholar]
  • 40.Virdee MS, Saini N, Kay CD, Neilson AP, Kwan STC, Helfrich KK, Mooney SM, Smith SM. An enriched biosignature of gut microbiota-dependent metabolites characterizes maternal plasma in a mouse model of fetal alcohol spectrum disorder. Sci Rep 11: 248, 2021. doi: 10.1038/s41598-020-80093-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Halsted CH, Robles EA, Mezey E. Distribution of ethanol in the human gastrointestinal tract. Am J Clin Nutr 26: 831–834, 1973. doi: 10.1093/ajcn/26.8.831. [DOI] [PubMed] [Google Scholar]
  • 42.Elamin E, Masclee A, Juuti-Uusitalo K, van Ijzendoorn S, Troost F, Pieters HJ, Dekker J, Jonkers D. Fatty acid ethyl esters induce intestinal epithelial barrier dysfunction via a reactive oxygen species-dependent mechanism in a three-dimensional cell culture model. PLoS One 8: e58561, 2013. doi: 10.1371/journal.pone.0058561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nosova T, Jousimies-Somer H, Jokelainen K, Heine R, Salaspuro M. Acetaldehyde production and metabolism by human indigenous and probiotic Lactobacillus and Bifidobacterium strains. Alcohol 35: 561–568, 2000. doi: 10.1093/alcalc/35.6.561. [DOI] [PubMed] [Google Scholar]
  • 44.Sheikh A, Tumala B, Vickers TJ, Alvarado D, Ciorba MA, Bhuiyan TR, Qadri F, Singer BB, Fleckenstein JM. CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Proc Natl Acad Sci 117: 29055–29062, 2020. doi: 10.1073/pnas.2012480117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.VanDussen KL, Marinshaw JM, Shaikh N, Miyoshi H, Moon C, Tarr PI, Ciorba MA, Stappenbeck TS. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut 64: 911–920, 2015. doi: 10.1136/gutjnl-2013-306651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Miyoshi H, Stappenbeck TS. In vitro expansion and genetic modification of gastrointestinal stem cells in spheroid culture. Nat Protoc 8: 2471–2482, 2013. doi: 10.1038/nprot.2013.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408, 2001. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 48.Srinivasan P, Kapadia R, Biswas A, Said HM. Chronic alcohol exposure inhibits biotin uptake by pancreatic acinar cells: possible involvement of epigenetic mechanisms. Am J Physiol Gastrointest Liver Physiol 307: G941–G949, 2014. doi: 10.1152/ajpgi.00278.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nabokina SM, Ramos MB, Said HM. Correction: mechanism(S) involved in the colon-specific expression of the thiamine pyrophosphate (Tpp) transporter. PLoS One 12: e0186550, 2017. doi: 10.1371/journal.pone.0186550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Bleich S, Lenz B, Ziegenbein M, Beutler S, Frieling H, Kornhuber J, Bönsch D. Epigenetic DNA hypermethylation of the HERP gene promoter induces down-regulation of its mRNA expression in patients with alcohol dependence. Alcoholism Clin Exp Res 30: 587–591, 2006. doi: 10.1111/j.1530-0277.2006.00068.x. [DOI] [PubMed] [Google Scholar]
  • 51.Bönsch D, Lenz B, Fiszer R, Frieling H, Kornhuber J, Bleich S. Lowered DNA methyltransferase (DNMT-3b) mRNA expression is associated with genomic DNA hypermethylation in patients with chronic alcoholism. J Neural Transm (Vienna) 113: 1299–1304, 2006. doi: 10.1007/s00702-005-0413-2. [DOI] [PubMed] [Google Scholar]
  • 52.Curry-McCoy TV, Guidot DM, Joshi PC. Chronic alcohol ingestion in rats decreases Krüppel-like factor 4 expression and intracellular zinc in the lung. Alcohol Clin Exp Res 37: 361–371, 2013. doi: 10.1111/j.1530-0277.2012.01946.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.D'Addario C, Caputi FF, Ekström TJ, Di Benedetto M, Maccarrone M, Romualdi P, Candeletti S. Ethanol induces epigenetic modulation of prodynorphin and pronociceptin gene expression in the rat amygdala complex. J Mol Neurosci 49: 312–319, 2013. doi: 10.1007/s12031-012-9829-y. [DOI] [PubMed] [Google Scholar]
  • 54.D'Addario C, Johansson S, Candeletti S, Romualdi P, Ögren SO, Terenius L, Ekström TJ. Ethanol and acetaldehyde exposure induces specific epigenetic modifications in the prodynorphin gene promoter in a human neuroblastoma cell line. FASEB J 25: 1069–1075, 2011. doi: 10.1096/fj.10-168534. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Gastrointestinal and Liver Physiology are provided here courtesy of American Physiological Society

RESOURCES