Complete Genome Sequence of Pseudomonas aeruginosa CMC-097, Isolated from a Ventilator-Associated Pneumonia Patient, Containing a Novel Carbapenem Resistance Class 1 Integron

ABSTRACT

We report the complete genome of a clinical strain of Pseudomonas aeruginosa CMC-097, which was isolated from a ventilator-associated pneumonia patient with a chronic infection. Illumina sequence reads were assembled using Geneious to yield a 7,044,064-bp circular chromosome containing a carbapenem resistance integron, In2020.

ANNOUNCEMENT

Chronic and multidrug-resistant (MDR) Pseudomonas aeruginosa is a threat to ventilator patients, with increased mortality rates of up to 30% in intensive care units (1–3). A World Health Organization (WHO) survey reported that carbapenem-resistant (CR) P. aeruginosa ranked as the second most critical priority bacterium among 20 antimicrobial-resistant bacterial species (4). In the United States, CR P. aeruginosa was reported in 2004 for an isolate containing the Verona integron encoding a carbapenemase (5) associated with mobile insertional sequence (IS) elements that play a major role in global dissemination (6–8).

A prospective study was approved by the Carilion Clinic institutional review board and conducted from 2010 to 2012 (9). In this study, P. aeruginosa CMC-097 was obtained from the Quest Diagnostics microbiology laboratory at Carilion Clinic. The strain was isolated from a tracheal aspirate specimen from a chronic ventilator-associated pneumonia patient and was confirmed by antimicrobial tests to be CR (10). The isolate was grown on a blood agar plate and transported to the Carilion basic science research laboratory; glycerol stocks were made and stored at −80°C.

A single colony of CMC-097 was grown in 25 ml lysogeny broth at 37°C at 200 rpm for 18 h. The cell pellet was used for genomic DNA isolation by Genomic-tip 20/G (9, 11). The genome was sequenced on the Illumina NextSeq platform at the Virginia Tech Genomics Resource Center with a library constructed using the Illumina TruSeq DNA preparation kit. Sequencing generated 72,739,130 paired-end (PE) reads of 150-bp length, which were assembled with the Geneious v11.0.4 de novo assembly algorithm with the default low sensitivity/fastest settings, which allow at most 10% base mismatches (9). No additional read quality filtering was necessary. This resulted in 77 contigs larger than 1,000 bp, with a maximum length of 597,066 bp and an N₅₀ value of 214,826 bp. Then the Geneious algorithm map to reference was used to map the PE reads to these 77 contigs, with fine tuning set to iterate up to 10 times and custom sensitivity settings set to 0% mismatch and 0% gaps, to iteratively extend the ends of the 77 contigs until the ends overlapped and all of the gaps were closed into a circular genome (9). Synteny with highly similar Pseudomonas genomes (strains W60856 and PABCH45) was used to assist in joining contigs separated by repeated sequences of IS elements and rRNA operons. Finally, Geneious was used to map 96% of the PE reads to this complete genome with a uniform average coverage of 1,487×.

The complete assembly of CMC-097 resulted in a circular genome of 7,044,064 bp, with a G+C content of 66.4%. The NCBI Prokaryotic Genome Annotation Pipeline (PGAP) v5.0 (6, 7) identified 6,632 genes (IAU57_00005 to IAU57_33160), including 6,467 protein-coding genes, 82 RNA genes (65 tRNAs, 12 rRNAs, and 5 noncoding RNAs), 83 pseudogenes, and 1 CRISPR array.

BLAST analysis of the resulting genome found that it was highly similar to P. aeruginosa strain W60856 (GenBank accession number CP008864.2) and P. aeruginosa strain PABCH45 (GenBank accession number CP056101.1), with differences of <1/1,000 bp over genome stretches as long as 400,000 bp. However, the genome sequence was interrupted by many different IS elements, including 13 copies of an IS21 family transposon, consisting of a transposase (istA) gene and a transposition helper (istB) gene (e.g., IAU57_01410 to IAU57_01415), and 9 copies of an IS3 family transposase (e.g., IAU57_01325). P. aeruginosa CMC-097 also contains a CR class 1 integron, called In2020, which was defined and named by INTEGRALL (12) and is detailed in Table 1 and shown in Fig. 1.

TABLE 1.

Genetic composition of the antibiotic resistance island containing the class 1 integron In2020

IS/integron elementa	Gene identifier	Gene name	Direct/inverted repeat(s)b	Gene functionc
		Hypothetical proteind
		5′-PA0981d	DR: AATAAgggct
	IAU57_09040	Hypothetical protein
	IAU57_09045	Hypothetical protein
	IAU57_09050	Hypothetical protein
	IAU57_09055	Conserved protein		DNA recombination protein RmuC
ISPa85	IAU57_09060	istA	IRL: tgcggattccacgctgactcggacacccattccacgcacatccgg	IS21 family transposase
	IAU57_09065	istB	IRR: tgcggattccacgccattcggacactcagcccacgctgatccgga	IS21-like element ISUnCu3 family helper ATPase
	IAU57_09070	tonB		TonB C-terminal domain-containing protein
	IAU57_09075	Integrase		Tyrosine-type, site-specific recombinase/integrase
IS6100	IAU57_09080	tnpA2	IRL: ggctctgttgcaaagattggcggcagtcagagg; IRR: ggctctgttgcaaaaatcgtgaagcttgagcat	IS6-like element
In2020	IAU57_09085	N-Acetyltransferase		GNAT family protein
	IAU57_09090	sul1		Sulfonamide-resistant dihydropteroate synthase
	IAU57_09095	qacEΔ1		Quaternary ammonium compound efflux SMR (truncated) transporter
	IAU57_09100	bla OXA-2		Oxacillin-hydrolyzing class D β-lactamase
	IAU57_09105	aacA27		Aminoglycoside N-acetyltransferase AAC(6′)-IIc
	IAU57_09110	intI1 e		Class 1 integron integrase IntI1
ISPsy42	IAU57_09115	yafQ	IRR: aatgatgacctcaagccggttctggtcg	Type II toxin-antitoxin system
	IAU57_09120	Invertase		Recombinase family protein; DNA invertase Pin-like protein
	IAU57_09125	tnpR	IRL: aatgttctccgtggcccgcttccggccg	TnpR resolvase protein
		3′-PA0981d	DR: accccAATAA
	IAU57_09130	Hypothetical protein

^aA novel integron was identified in this study.

^bDR, direct repeat; IRL, left inverted repeat; IRR, right inverted repeat. Lowercase letters are used for gene sequences and capital letters are used for direct repeat sequences.

^cPutative functions of the gene were identified from an NCBI protein BLAST search. GNAT, GCN5-related N-acetyltransferase; SMR, small multidrug resistance.

^dGene was not annotated in CMC-097.

^eGene was truncated and overlapped.

FIG 1.

Antibiotic resistance island containing In2020 in P. aeruginosa CMC-097 (nucleotide positions 1944662 to 1961187). The IS, inverted repeat, and transposon elements (tnp) were identified using ISfinder with their previously described names (13). The solid arrows represent the annotated open reading frames (ORFs) and their orientations, including the novel P. aeruginosa In2020 containing the GCN5-related N-acetyltransferase (GNAT), sul1, qacEΔ1, bla_OXA-2, and accA27 resistance genes in red. Open arrows indicate ORFs for hypothetical proteins. The terminal direct repeats belonging to the insertion sites in the PA0981 gene are in green. The P_C (−10, nucleotide positions 1956769 to 1956774; −35, nucleotide positions 1956792 to 1956797) is the common promoter present in the integron, and P_intI1 (−35, nucleotide positions 1956627 to 1956632; −10, nucleotide positions 1956650 to 1956655) is the promoter for the truncated integrase gene IntI1_{R32_H39Δ} (nucleotide positions 1956682 to 1957845). The recombination sites for IntI1Δ, attI (nucleotide positions 1956539 to 1956601), attC1 (nucleotide positions 1955802 to 1955871), and attC2 (nucleotide positions 19549326 to 1954995) are marked with vertical bars (12). Notably, insertion elements ISPa85 and IS6100 were found upstream and downstream of tonB and another integrase. Also, downstream of In2020 the ISPsy42 element is inserted into the broken segment of PA0981. The inverted repeats at the 5′ and 3′ ends (left and right ends), i.e., the left inverted repeat (IRL) and the right inverted repeat (IRR), for the IS elements and transposons are marked.

Data availability.

The annotated complete genome assembly of Pseudomonas aeruginosa strain CMC-097 is available in GenBank under the accession numbers CP065848, SRR14783931, PRJNA660482, and SAMN15950776. The novel In2020 sequence was registered at INTEGRALL, a web-based platform dedicated to integron identification, under the accession number CP065848 (http://integrall.bio.ua.pt/?acc=CP065848).