Skip to main content
eLife logoLink to eLife
. 2021 Sep 3;10:e65644. doi: 10.7554/eLife.65644

Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans

Mor Levi-Ferber 1, Rewayd Shalash 1, Adrien Le-Thomas 2, Yehuda Salzberg 3, Maor Shurgi 1, Jennifer IC Benichou 1, Avi Ashkenazi 2, Sivan Henis-Korenblit 1,
Editors: Julie Hollien4, David Ron5
PMCID: PMC8416019  PMID: 34477553

Abstract

Understanding the molecular events that regulate cell pluripotency versus acquisition of differentiated somatic cell fate is fundamentally important. Studies in Caenorhabditis elegans demonstrate that knockout of the germline-specific translation repressor gld-1 causes germ cells within tumorous gonads to form germline-derived teratoma. Previously we demonstrated that endoplasmic reticulum (ER) stress enhances this phenotype to suppress germline tumor progression(Levi-Ferber et al., 2015). Here, we identify a neuronal circuit that non-autonomously suppresses germline differentiation and show that it communicates with the gonad via the neurotransmitter serotonin to limit somatic differentiation of the tumorous germline. ER stress controls this circuit through regulated inositol requiring enzyme-1 (IRE-1)-dependent mRNA decay of transcripts encoding the neuropeptide FLP-6. Depletion of FLP-6 disrupts the circuit’s integrity and hence its ability to prevent somatic-fate acquisition by germline tumor cells. Our findings reveal mechanistically how ER stress enhances ectopic germline differentiation and demonstrate that regulated Ire1-dependent decay can affect animal physiology by controlling a specific neuronal circuit.

Research organism: C. elegans

Introduction

Pluripotency is the developmental potential of a stem cell to give rise to cells of the three embryonic germ layers. Pluripotent stem cells maintain a proliferative, undifferentiated state as long as they reside within a ‘niche’ that provides continuous pro-mitotic, anti-differentiation cues (Ohlstein et al., 2004). Exit from this niche is associated with a tightly regulated switch from self-renewal to differentiation, demonstrating that the immediate microenvironment plays a central role in regulating cell pluripotency. Ultimately, the progressive restriction of cell fate is driven cell autonomously by cell-intrinsic mechanisms that regulate the expression of differentiation promoting genes, including pluripotency-regulatory transcription factors and chromatin remodeling factors, as well as translational control of gene expression (Schlesinger and Meshorer, 2019).

The germline stem cells are the ultimate pluripotent cells because they hold the potential to differentiate into all the cell types that comprise the embryo and the adult. Germ cells initially give rise to differentiating gametes, whose somatic fate must be repressed until fertilization. Nevertheless, at a low frequency, germ cells and gametes can generate rare germline tumors containing differentiated somatic cells that are not native to the location in which it occurs (Ciosk et al., 2006; Wright and Ciosk, 2013). These somatic germline tumors are called teratomas. In humans, the most common form of teratoma originates from oocytes that have entered, but not properly completed, meiosis (Ulbright, 2005). The mere existence of ovarian teratomas suggests that oocyte pluripotency is normally restrained to prevent uncontrolled precocious differentiation into somatic cells.

The Caenorhabditis elegans gonad provides a well-defined model for studying how germline cells maintain pluripotency in their natural micro- and macroenvironments, that is, in the somatic gonad and in the whole organism (Seydoux and Braun, 2006). The C. elegans germline stem cells are located in the distal end of the gonad, near the mesenchymal distal tip cell, which interacts with the germ cells and promotes germline stemness (Byrd and Kimble, 2009). As in humans, germ cell differentiation is initially limited to meiotic progression and gametogenesis, until the removal of somatic differentiation constraints occurs upon fertilization (Kuwabara, 2003). Nevertheless, at a low frequency (enhanced by certain genetic backgrounds), germ cells can abnormally differentiate into many kinds of somatic cells in the absence of fertilization (Ciosk et al., 2006; Biedermann et al., 2009). We refer to these germline cells, which lose their pluripotency and acquire a differentiated somatic cell fate prior to fertilization, as germline ectopic differentiation (GED). In C. elegans, GED can occur by direct conversions of germline cells to somatic cells. Such conversions have been observed upon ectopic expression of a differentiation-promoting transcription factor in the germline (Tursun et al., 2011) and upon depletion of the germline-specific translation repressor gld-1 (Ciosk et al., 2006; Biedermann et al., 2009). In the absence of gld-1, female germline stem cells initiate meiosis, but then exit pachytene and return to the mitotic cycle, yielding a tumorous germline phenotype (Gumienny et al., 1999). A fraction of the mitotic germ cells forms a teratoma, which expresses somatic markers and is characterized by aberrantly large, misformed nuclei, readily detectable by DAPI staining (Ciosk et al., 2006; Biedermann et al., 2009).

The endoplasmic reticulum (ER) mediates correct folding of secretory proteins. ER stress increases the load of misfolded proteins in the ER. In turn, the accumulation of misfolded proteins in the ER activates an ER-adaptive unfolded protein response (UPR). The ER-UPR consists of signaling pathways that help to restore ER homeostasis by reducing the load on the ER and degrading misfolded proteins (Walter and Ron, 2011). Previously we have shown that activation of the conserved UPR sensor inositol requiring enzyme-1 (IRE-1) enhances ectopic differentiation of the tumorous germline in gld-1-deficient C. elegans, which limits the progression of the lethal germline tumor (Levi-Ferber et al., 2015). Although the major signaling mode of action of IRE-1 is to generate an active form of the ER stress-related transcription factor xbp-1 (X-box binding protein-1), ER stress-induced GED requires the ire-1 gene, but not its downstream target xbp-1. The nature of this ire-1-dependent xbp-1-independent signal remains a mystery (Levi-Ferber et al., 2015). xbp-1-independent outputs of ire-1 include activation of signaling cascades by virtue of IRE-1 oligomerization (Urano et al., 2000; Yoneda et al., 2001), and degradation of ER-localized mRNAs by virtue of IRE-1 ribonuclease activity—a process called regulated Ire1-dependent decay (RIDD) (Hollien and Weissman, 2006; Hollien et al., 2009). During RIDD, select mRNAs and microRNAs are nicked by IRE1, rendering them vulnerable to rapid degradation by cytoplasmic exoribonucleases (Hollien and Weissman, 2006; Kimmig et al., 2012; Guydosh et al., 2017). Thus far, RIDD has been implicated in a variety of biological processes, including regulation of programmed cell death, cellular differentiation, and inflammation (Coelho and Domingos, 2014; Maurel et al., 2014; Lu et al., 2014).

In this work, we set out to explore how ER stress modulates the germ cell pluripotency/differentiation switch in the tumorous germline of gld-1-deficient animals. We discovered that the differentiation of the germline in response to ER stress is regulated at the organismal level and is based on neuronal signaling. We identified a novel ER stress-sensitive neuronal circuit, which communicates with the gonad through the conserved neurotransmitter serotonin to actively repress ectopic germline differentiation. Surprisingly, it is not the stress per se that regulates germ cell fate, but rather the activation of the ER stress response sensor IRE-1 that destabilizes through RIDD the transcripts of a critical neuropeptide implicated in the GED regulatory neuronal circuit. To our knowledge, this is the first example of neuronal circuit inhibition by RIDD.

Results

Neuronal IRE-1 regulates ER stress-induced GED

The tumorous germline of gld-1(-) animals is prone to undergo ectopic differentiation into somatic cells, which are cleared away from the gonad by programmed cell death followed by corpse absorbance by the surrounding tissues (Ciosk et al., 2006; Levi-Ferber et al., 2015). These abnormal, ectopically differentiated cells can be identified based on the expression of somatic markers and based on their relatively enlarged and irregularly shaped nuclei, which are distinct from the typical nuclei of the germline cells. The expression of somatic markers by this subgroup of cells with aberrant nuclei within the gonad of ER-stressed gld-1(-) animals has been previously demonstrated, confirming their somatic state (see Figure 3—figure supplement 1 in Levi-Ferber et al., 2015). Blocking the ability of the ectopic somatic cells to execute apoptosis increases their half-life in the gonad, facilitating their detection in nearly all of the animals, where they occupy up to 10% of the gonad (Levi-Ferber et al., 2015). Previously we have shown that upon exposure to ER stress the population of ectopically differentiated germ cells expands and occupies up to 40% of the gonad of gld-1(-) animals, indicating that ER stress promotes the induction of a somatic differentiated state (Levi-Ferber et al., 2015). Given the central role of the ER in secretory-protein biosynthesis, including the processing of a variety of hormones and neuropeptides, we wondered whether ER stress-induced GED is a consequence of stress within the germline itself or the perturbation of non-autonomous signals emanating from outside the germline.

We first examined the possibility that ER stress within the germ cells controls GED. To induce ER stress primarily in the germ cells, we used mutants in the rrf-1 gene, whose RNAi activity is compromised in most somatic tissues but whose germline RNAi activity is intact (Kumsta and Hansen, 2012). Specifically, rrf-1 mutants were treated with a mixture of gld-1, tfg-1, and ced-3 RNAi. gld-1 RNAi induces a germline tumor and sensitizes the germline for GED (Ciosk et al., 2006). tfg-1 RNAi induces ER stress by abrogating protein export from the ER (Levi-Ferber et al., 2014; Witte et al., 2011). ced-3 RNAi blocks apoptosis (Ellis and Horvitz, 1986) and extends the half-life of the ectopic somatic cells in the gonad, facilitating their detection (Levi-Ferber et al., 2015). The efficacy of each of the RNAi treatments was individually confirmed as described in the Materials and methods section. As a proxy for GED, the animals were stained with DAPI, and the presence of ectopically large somatic-like nuclei with irregular shape within the gonad was scored. Strikingly, even though rrf-1 is not required for RNA interference in the germline, hardly any increase in the amount of ectopic somatic cells in the gonad was apparent upon treatment of rrf-1 mutants with the gld-1/tfg-1/ced-3 RNAi (Figure 1A). This was in contrast to wild-type animals with intact RNAi machinery, in which approximately 25% of each gonad was occupied by cells with large soma-like nuclei upon exposure to ER stress (Figure 1A). This data suggests that ER stress in the soma, rather than only in the germline, drives the induction of aberrant cells within the gonad.

Figure 1. Endoplasmic reticulum (ER) stress in the soma regulates germline ectopic differentiation (GED).

Figure 1.

Percent of gonad area occupied by aberrant somatic-like cells determined by DAPI staining of day 4 gld-1(RNAi); ced-3(RNAi) animals. (A) tfg-1 RNAi treatment resulted in increased levels of aberrant somatic-like cells in the gonads of wild-type animals but not in rrf-1 mutants (n = 320 gonads per genotype, N = 6). Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 compared to the same genetic background treated with control RNAi. (B) Rescue of ire-1 expression in the soma (Pire-1::ire-1) and in the neurons (Prgef-1::ire-1) increased levels of aberrant somatic-like cells in the gonads upon tfg-1 RNAi treatment, whereas expression of ire-1 in the muscles (Pmyo-3::ire-1) and in the intestine (Pges-1::ire-1) did not. Full arrows indicate mitotic germ cells. Open arrows indicate aberrant nuclei (n = 210 gonads per genotype, N = 4). Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 compared to ire-1(-) animals unless indicated otherwise. (C) Overexpression of ire-1 in the soma (Pire-1::ire-1) and in the neurons (Prgef-1::ire-1) of animals with wild-type ire-1 resulted in high levels of aberrant somatic-like cells in the gonads even in the absence of ER stress, whereas overexpression of ire-1 in the muscles (Pmyo-3::ire-1) and in the intestine (Pges-1::ire-1) did not (n = 250 gonads per genotype, N = 4). Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 compared to Pges-1::ire-1 animals. (D) Overexpression of ire-1 in the neurons (Prgef-1::ire-1) of animals expressing the neuronal reporter Punc-119::gfp resulted in high GED levels in gld-1(RNAi); ced-3(-) genetic background, even in the absence of an ER stress-inducing treatment. Asterisks mark nested one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001. Means represented by ‘X’ (n = 70 gonads per genotype, N = 2). Triple asterisks mark significant results of at least a twofold change.

Because IRE-1 is required for ER stress-induced GED (Levi-Ferber et al., 2015), we examined whether expression of IRE-1 specifically within the soma is sufficient to drive the induction of ectopic cells within the gonad upon ER stress. To this end, we used ire-1(-) mutants, whose germline does not undergo GED in response to ER stress induced by tfg-1 RNAi treatment (Levi-Ferber et al., 2015), and restored IRE-1 expression in its somatic tissues. To restore IRE-1 expression in the entire soma but not the germline, we generated ire-1(-) animals expressing an extrachromosomal somatic ire-1 transgene under its own promoter (note that extrachromosomal arrays are actively silenced in the C. elegans germline, but are expressed in the soma; Kelly et al., 1997). This line of experiments was carried out in animals treated with gld-1 and ced-3 RNAi to facilitate GED detection. As a proxy for GED, the animals were stained with DAPI, and the presence of abnormal nuclei within the gonad was scored. We found that expression of the somatic IRE-1 transgene was sufficient to fully restore the induction of aberrant cells within the gonad upon ER stress (Figure 1B).

Next, we examined which somatic tissues mediate ER stress-induced GED. To this end, we restored IRE-1 expression in specific somatic tissues of ire-1(-) mutants by driving expression of the rescuing transgene with tissue-specific promoters. We found that expression of ire-1 under the rgef-1 pan-neuronal promoter was sufficient to permit ER stress-induced abnormal somatic-like nuclei within the gonad of ire-1(-) animals. In contrast, expression of ire-1 under the myo-3 muscle promoter or under the ges-1 intestine promoter did not increase the level of abnormal nuclei in the gonads of ER-stressed animals (Figure 1B).

While IRE-1 is normally activated under ER stress conditions, some activation of IRE-1 can be achieved merely by its overexpression (Kimata et al., 2007; Li et al., 2010; Salzberg et al., 2017). Hence, we asked whether increasing IRE-1 expression is sufficient for inducing GED even in the absence of direct ER stress. To this end, we overexpressed ire-1 transgenes in various tissues of ire-1(+); gld-1(RNAi); ced-3(RNAi) animals and followed GED induction in the absence of an ER stress trigger using DAPI staining as a proxy. Overexpression of IRE-1, either in the muscles or in the intestine, did not lead to the detection of ectopic cells within the gonad of the animals in the absence of ER stress (Figure 1C). In contrast, overexpression of IRE-1 in wild-type animals, either in the soma or in the neurons, gave rise to high amount of ectopic somatic-like nuclei even in the absence of ER stress (Figure 1C). Furthermore, overexpression of IRE-1 specifically in neurons resulted in expression of the pan-neuronal marker Punc-119::gfp throughout the gonads of the transgenic animals, confirming the presence of somatic cells with neuronal characteristics with the gonads of the animals (Figure 1D). Since overexpression of IRE-1 in neurons is sufficient for its artificial activation independent of ER stress (Salzberg et al., 2017), this data suggests that active IRE-1 signaling in the neurons, rather than neuronal ER stress or ER dysfunction, promotes GED formation in the tumorous gonads of these animals.

ER stress-induced GED is dictated by specific sensory neurons

Next, we tested whether IRE-1-induced GED is controlled by specific neurons or in a neuron-wide manner. This was examined by expressing ire-1-rescuing constructs driven by various neuronal promoters in ire-1(-); gld-1(RNAi); ced-3(RNAi) animals and scoring for restoration of ER stress-induced accumulation of ectopic cells in the gonads. We found that rescue of ire-1 expression in dopaminergic or GABAergic neurons (driven by the dat-1 and unc-25 promoters, respectively) did not induce aberrant cells in the gonads under ER stress conditions (Figure 2A and Figure 2—figure supplement 1). In contrast, rescue of ire-1 expression in sensory neurons or in glutamatergic neurons (driven by the che-12 and eat-4 promoters) led to high levels of aberrant cells in the gonads under ER stress conditions (Figure 2A and Figure 2—figure supplement 1). Note that although the che-12 promoter drives expression in 16 sensory neurons, only 10 of them overlap with the eat-4 promoter (Supplementary file 1). Altogether, these findings indicate that the increased generation of aberrant cells upon ER stress is dictated by specific sensory neurons, and it is not a neuron-wide phenomenon. Furthermore, the relevant neurons could be the overlapping subset of sensory and glutamatergic neurons.

Figure 2. ASE-secreted FLP-6 regulates germline ectopic differentiation (GED).

Percent of gonad area occupied by ectopic somatic cells determined by DAPI-staining of day 4 animals. g.c.c represents treatment with gld-1, ced-3, and control RNAi mixture. g.c.t represents treatment with gld-1, ced-3, and tfg-1 RNAi mixture. (A) Rescue of ire-1 expression in all neurons (Prgef-1::ire-1), in sensory neurons (Pche-12::ire-1 (or in glutamatergic neurons [Peat-4::ire-1])) resulted in high levels of ectopic somatic cells in the gonads upon tfg-1 RNAi treatment, whereas expression of ire-1 in the dopaminergic (Pdat-1::ire-1), GABAergic (Punc-25::ire-1), and ASI/ASJ neurons (Pdaf-28::ire-1and Pdaf-7::ire-1) did not (n = 210 gonads per genotype, N = 4). Asterisks mark two-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals treated with g.c.c RNAi. For representative animals, see Figure 2—figure supplement 1. (B) eat-4 mutants displayed high levels of ectopic somatic cells in the gonads only upon tfg-1 RNAi treatment (n = 180 gonads per genotype, N = 3). Asterisks mark two-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals treated with g.c.c RNAi. (C, D) flp-6 mutants (C) and flp-6 RNAi-treated animals (D) displayed high levels of ectopic somatic cells in the gonads in the absence of endoplasmic reticulum (ER) stress (n = gonads per genotype, N = 4). Asterisks mark two-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to wild-type animals treated with the same RNAi treatment (C) and Student’s t-test of p<0.001 (D). (E) che-1 mutants (with defective ASE) displayed high levels of ectopic somatic cells in the gonads, whereas lin-11 mutants (with defective ASG) did not. Rescue of flp-6 expression in ASE (Pche-1::flp-6) suppressed GED in flp-6(-) mutants, whereas its expression in ADF (Psrh-142::flp-6) did not. (n = 195 gonads per genotype, N = 4). Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 relative to wild-type animals, unless indicated otherwise. All animals were treated with gld-1 and ced-3 RNAi. (F) gld-1(RNAi); ced-3(-) animals expressing the neuronal reporter Punc-119::gfp or the muscle reporter Pmyo-3::gfp displayed high GED levels upon treatment with flp-6 RNAi (n = 70 gonads per genotype, N = 2). Full arrows point at the labeling of somatic neurons (n) or muscles (m) within the soma. Arrowheads point at the labeling of somatic neuron or muscle cells within the gonad. Asterisks mark nested one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001. Means represented by ‘X.’ Triple asterisks mark significant results of at least a twofold change.

Figure 2.

Figure 2—figure supplement 1. Endoplasmic reticulum (ER) stress-induced germline ectopic differentiation (GED) is controlled by sensory neuronal IRE-1.

Figure 2—figure supplement 1.

Representative micrographs of whole-body (×100) DAPI stained day 4 ire-1(-) transgenic animals, each expressing an ire-1-rescuing transgene driven by the indicated promoters, treated with either a mixture of control, gld-1, and ced-3 RNAi or with a mixture of tfg-1, gld-1, and ced-3 RNAi (n = 210 gonads per genotype, N = 4). See Figure 2A for quantification.

ASI does not regulate GED

Previously, we have shown that ASI regulates ER stress-induced germline apoptosis (Levi-Ferber et al., 2014). Furthermore, it is known that sensory information indicating favorable environmental conditions is relayed to the distal tip cell through altered TGFβ production by the ASI neurons (Dalfó et al., 2012). ASI is included in the group of sensory neurons covered by the che-12 promoter. However, it does not communicate with glutamate. Nevertheless, given its known role in regulation of germ cell proliferation and germ cell apoptosis, we examined whether it may also be involved in ER stress-induced GED. Expression of ire-1 under the Pdaf-28 promoter (which drives ire-1 expression in ASI/ASJ neurons) or under Pdaf-7 (which drives ire-1 expression specifically in the ASI neuron) did not restore ER stress induction of ectopic cells in the gonads of gld-1 sensitized ire-1(-) animals (Figure 2A and Figure 2—figure supplement 1). Thus, IRE-1 signaling in ASI is not sufficient for ER stress-induced GED, suggesting that the signaling pathways that regulate ER stress-induced GED and apoptosis are distinct.

ASE-secreted FLP-6 regulates GED

Next, we hypothesized that the activity of sensory neurons, mediated by the release of glutamate or neuropeptides, communicates a signal that controls germline pluripotency in the gonad. One possibility is that ER stress in the relevant sensory neurons activates a signaling cascade that promotes GED in the gonad. If so, inactivation of the critical signaling molecules/cells of such a germline pluripotency inhibitory/GED-promoting signal should prevent ER stress-induced GED. Alternatively, since ER stress conditions are incompatible with efficient signaling due to secretory defects (Safra et al., 2013), ER stress conditions that promote GED formation may do so by interfering with an existing germline pluripotency-promoting signal rather than generating a novel GED-promoting signal. In this case, inactivation of the critical signaling molecules/cells of such a germline pluripotency-promoting pathway should lead to the generation of GED even in the absence of ER stress. To distinguish between these possibilities, we examined whether a deficiency in any of the potential neurotransmitters and neuropeptides, expressed in the 10 glutamatergic sensory neurons, is sufficient to prevent ER stress-induced GED in ER-stressed animals or sufficient to induce GED in non-stressed gld-1(RNAi); ced-3(RNAi) animals.

Since the main neurotransmitter synthesized in the 10 candidate sensory neurons is glutamate, we examined whether glutamate serves as a signaling molecule for GED. To this end, we assessed the level of ectopic nuclei in two different glutamate transport-deficient eat-4(-) mutants. Upon treatment with ced-3 and gld-1 RNAi, eat-4(-) mutants exhibited low levels of abnormal nuclei under non-stress conditions and high levels of abnormal nuclei under ER stress conditions (Figure 2B), similarly to wild-type animals (Figure 1A). Thus, the interference with glutamate transport does not preclude the induction of GED under ER stress conditions, nor is it sufficient for induction of GED.

We next searched for candidate neuropeptides that may be involved in GED induction. To this end, we analyzed the nuclei pattern in mutants that lack each one of the neuropeptides known to be expressed by the 10 suspected glutamatergic sensory neurons (Supplementary file 1). Upon treatment with ced-3 and gld-1 RNAi, all of the mutants had high levels of abnormal nuclei in their gonads under ER stress conditions (Figure 2C, gray bars). Strikingly, one neuropeptide mutant—flp-6(ok3056)—exhibited high levels of abnormal nuclei under non-stress conditions as well (Figure 2C, white bars). Similarly high levels of abnormal nuclei under non-stress conditions were obtained by treatment with flp-6 RNAi (Figure 2D). Furthermore, flp-6 RNAi treatment induced the expression of the Punc-119::gfp neuronal marker and the Pmyo-3::gfp muscle marker within the gonads of gld-1(RNAi)-treated ced-3(-)mutants, confirming the presence of somatic cells with neuronal and muscle characteristics with the gonads of the animals (Figure 2F). This indicates that the FLP-6 neuropeptide is a negative regulator of GED, consistent with the notion that ER stress may interfere with a fundamental germline pluripotency-promoting signal in the tumorous germline of gld-1-deficient animals.

FLP-6 is a secreted neuropeptide with putative hormonal activity, previously implicated in lifespan regulation (Chen et al., 2016). It is part of a family of genes encoding FMRF amide-related peptides (FaRPs), which regulate many aspects of behavior (Li et al., 1999; Li and Kim, 2014). FLP-6 is produced in six neurons (ASE, ASG, AFD, ADF, I1, PVT; Kim and Li, 2004). AFD-derived FLP-6 has been implicated in temperature-related longevity regulation (Chen et al., 2016). Nevertheless, only ASE and ASG are included in the group of sensory neurons that overlap with the che-12 and eat-4 promoters’ expression pattern. Therefore, we further assessed ASE and ASG involvement in GED.

Since flp-6 depletion was sufficient to induce GED in the absence of ER stress, we hypothesized that depletion of its producing cells will have a similar effect. To this end, we genetically inactivated the ASE and ASG cells and examined if this was sufficient to induce GED in gld-1 and ced-3 RNAi-treated animals. We examined two che-1 mutants, which lack a critical transcription factor involved in ASE fate specification, and thus are ASE deficient (Sarin et al., 2007). We observed high levels of ectopic nuclei in the gonads of ASE(-) che-1 mutants compared to wild-type animals in the absence of ER stress, similar to those observed in flp-6(-) mutants (Figure 2E). In contrast, two lin-11 mutants, which lack a critical transcription factor involved in ASG fate specification and are thus ASG defective (Amon and Gupta, 2017), exhibited low levels of ectopic nuclei in their gonads, similar to wild-type animals (Figure 2E). These observations suggest that the ASE sensory neuron actively prevents GED in gld-1(RNAi); ced-3(RNAi) animals.

Taking together the requirement of both ASE and flp-6 for GED prevention, we hypothesized that ASE-produced FLP-6 suppresses GED in gld-1(RNAi); ced-3(RNAi) animals. To examine this, we generated flp-6(-) animals expressing a flp-6 rescuing construct under the ASE-specific promoter Pche-1. Unlike flp-6(-); gld-1(RNAi); ced-3(RNAi) mutants, which had high levels of abnormal nuclei in their gonads, transgenic animals expressing ASE-produced FLP-6 exhibited low levels of abnormal nuclei in their gonads, similarly to wild-type animals (Figure 2E).

Finally, since FLP-6 is a secreted neuropeptide, we wondered whether its secretion by other FLP-6-producing cells may be sufficient for the suppression of GED in gld-1(-); ced-3(-) animals. Hence, we examined the levels of GED in flp-6(-); gld-1(RNAi); ced-3(RNAi) mutants upon restoration of flp-6 expression in ADF, one of the six known FLP-6-producing neurons. In contrast to the animals expressing flp-6 specifically from the ASE neurons, flp-6(-) animals expressing flp-6 rescuing construct under an ADF-specific promoter (Psrh-142) exhibited high GED levels similarly to flp-6(-) animals (Figure 2E). Under the assumption that flp-6 expression was driven to a similar extent in the two sensory neurons, these results suggest that ASE-produced FLP-6 is a critical signaling moiety in GED regulation in gld-1(RNAi); ced-3(RNAi) animals. Furthermore, the fact that FLP-6 production by different sensory neurons leads to distinct phenotypes suggests that FLP-6 may act locally, through synaptic transmission, rather than distally, as a hormone distributed throughout the body cavity of the organism.

flp-6 deficiency induces GED independently of ER stress or ire-1

Since ER stress promotes GED, we checked whether flp-6 deficiency is associated with ER stress. First, we examined the possibility that flp-6 deficiency generates ER stress. To this end, we measured the levels of the IRE-1/UPR reporter Phsp-4::gfp, whose transcription is increased under conditions of ER stress in an xbp-1-dependent manner. We found that the fluorescence level of the Phsp-4::gfp reporter did not increase in animals that lack flp-6. Specifically, the level of the IRE-1/UPR reporter was comparable to that of animals with intact flp-6 when measured throughout the body of the animals (p=0.49, Figure 3—figure supplement 1A). Likewise, the level of the Phsp-4::gfp reporter measured specifically in the ASE cell body did not increase upon flp-6 RNAi treatment (in fact, a slight decrease was observed, p=0.0056, Figure 3—figure supplement 1B). This data indicates that IRE-1 is not hyperactivated in flp-6-deficient animals. To further verify the notion that flp-6 deficiency-induced GED is not the result of ER stress, we examined if flp-6 deficiency-induced GED is mediated by ire-1, similarly to ER stress-induced GED. We found that flp-6(-); ire-1(-) double mutants treated with gld-1 and ced-3 RNAi exhibited high levels of abnormal nuclei in their gonads under non-stress conditions, similarly to flp-6(-); gld-1(RNAi); ced-3(RNAi) animals (Figure 3A). Together, these results show that flp-6 deficiency can induce GED independently of ER stress or ire-1, indicating that flp-6 acts in parallel or downstream to ire-1 to regulate GED.

Figure 3. IRE-1 acts upstream of flp-6 and controls its transcript stability.

(A) flp-6 ok3056 mutation increased the levels of ectopic somatic cells in the gonads upon treatment with gld-1 and ced-3 RNAi independently of ire-1 (n = 200 gonads per genotype, N = 4). The ire-1 ok799 deletion mutant was examined. Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 as indicated. Germline ectopic differentiation (GED) levels were assessed by DAPI staining of day 4 animals. Consistent with the lack of dependency on ire-1 for GED induction, flp-6 deficiency did not induce expression of the Phsp-4::gfp endoplasmic reticulum (ER) stress reporter throughout the body or within the ASE neuron (see Figure 3—figure supplement 1). (B, C) flp-6 transcript levels were assessed by qRT-PCR and normalized to actin transcript levels. flp-6 transcript levels were significantly reduced in xbp-1 mutants compared to wild-type animals but not in ire-1 mutants. flp-6 transcript levels were also did not significantly change in ire-1; xbp-1 mutants compared to wild-type animals. Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 compared to wild-type animals (B). flp-6 transcript levels were also reduced upon treatment with tfg-1 RNAi (see Figure 3—figure supplement 2A). flp-6 transcript levels were significantly reduced in Pche-1::ire-1 animals, overexpressing ire-1 in the ASE neurons compared to wild-type animals. Asterisks indicate Student’s t-test p-value of <0.05 (C). (D) L4-staged animals were treated with either 25 µg/ml tunicamycin (TM) or with DMSO till day 2 of adulthood and then scored. TM treatment significantly reduced the fluorescence levels of the translation reporter Pche-1::flp-6::gfp compared to DMSO treatment, whereas it did not significantly change the fluorescence levels of Pche-1::flp-6::gfp; ire-1(-) animals compared to DMSO. n = 65 gonads per genotype, N = 2. p<0.001 of one-way nested ANOVA followed by Tukey’s post hoc analysis is indicated. Means represented by ‘X.’ tfg-1 RNAi treatment also reduced the fluorescence levels of the translation reporter Pche-1::flp-6::gfp (see Figure 3—figure supplement 2C). In contrast, the fluorescence levels of the Pflp-6::gfp and Pche-1::mcherry transcriptional reporters were not significantly altered by tfg-1 RNAi or TM treatment (see Figure 3—figure supplement 2B,D,E). (E) Purified recombinant human IRE-1α comprising the kinase and RNase domains (IRE1-KR) was incubated with in vitro-transcribed flp-6 RNA fragment in the presence of vehicle or 4µ8c (5 µM). Cleavage products of the flp-6 RNA fragment (marked by asterisks) were observed upon its incubation with IRE1-KR, but not in the presence of the specific IRE-1 ribonuclease inhibitor 4μ8C. Cleavage products of the flp-6 RNA fragment were not observed upon scrambling the predicted hairpin sequence (see Figure 3—figure supplement 3B). (F) flp-6 transcript levels were assessed by qRT-PCR and normalized to actin transcript levels (N = 3). flp-6 transcript levels were significantly reduced by tfg-1 RNAi treatment, but not in flp-6(biu100) mutants, in which the putative stem-loop structure has been disrupted while preserving the coding sequence. Negligible levels of flp-6 transcript were detected in flp-6(ok3056) deletion mutants. Asterisks mark nested one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 compared to the corresponding control RNAi treatment. (G) Representative micrographs of whole-body DAPI stained day 4 animals treated with either a mixture of control, gld-1, and ced-3 RNAi or with a mixture of tfg-1, gld-1, and ced-3 RNAi. tfg-1 RNAi treatment increased the levels of ectopic somatic cells in the gonads of animals with a wild-type flp-6 transcript (wt) but not in animals with a stem-loop disrupted flp-6 transcript (biu100) (see Figure 3—figure supplement 3C for quantifications). (H) Treatment with a mixture of gld-1; ced-3; tfg-1 RNAi (g.c.t) failed to increase the levels of ectopic somatic cells in the gonads in the absence of functional ire-1 (n = 210 gonads per genotype, N = 5). ok799 is an ire-1 deletion mutation. wy762 is an IRE-1 endoribonuclease missense mutation. wy782 is an IRE-1 kinase missense mutation. Asterisks mark two-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 as indicated. (I) Rescue of ire-1 expression in the ASE neuron (Pche-1::ire-1) restored ER stress-induced GED upon treatment with a mixture of gld-1; ced-3; tfg-1 RNAi (g.c.t), whereas expression of ire-1 in the ASG neuron (Pops-1::ire-1) did not (n = 110 gonads per genotype, N = 3). g.c.c indicates treatment with a mixture of gld-1; ced-3; control RNAi. Asterisks mark two-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals treated with gld-1; ced-3; control RNAi (g.c.c). In all panels, triple asterisks mark significant results resulting in a twofold change or more.

Figure 3.

Figure 3—figure supplement 1. Phsp-4 expression is not increased by flp-6 deficiency.

Figure 3—figure supplement 1.

(A) The whole-body fluorescence levels of the Phsp-4::gfp IRE-1 reporter were comparable in flp-6(ok3056) and wild-type flp-6(+) day 1 animals (Student’s t-test p=0.49, n = 130 gonads per genotype, N = 3). (B) The fluorescence levels of the Phsp-4::GFP endoplasmic reticulum (ER) stress reporter in the ASE neuron were not increased and were even slightly reduced by flp-6 RNAi treatment (Student’s t-test p=0.0056, n = 95 animals per genotype, N = 3). To measure the reporter’s fluorescence specifically in ASE, the selected areas for fluorescence measurements were manually selected based on their overlap with the Pche-1::mcherry marker.
Figure 3—figure supplement 2. ire-1 regulates flp-6 transcript levels post-transcriptionally.

Figure 3—figure supplement 2.

(A) flp-6 transcript levels were assessed by qRT-PCR and normalized to actin transcript levels (N = 3). Endoplasmic reticulum (ER) stress induced by tfg-1 RNAi reduced flp-6 transcript levels in wild-type animals but not in ire-1 mutants. Triple asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to the corresponding animals treated with control RNAi. (B) tfg-1 RNAi treatment did not change the fluorescence levels of the Pflp-6::gfp transcriptional reporter (n = 205 gonads per genotype, N = 4). p-Values of one-way ANOVA followed by Tukey’s post hoc analysis are indicated. (C) tfg-1 RNAi treatment reduced the levels of the Pche-1::flp-6::gfp translational reporter in ire-1(+) animals, but not in ire-1(-) animals. Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 as indicated (n = 205 gonads per genotype, N = 4). (D) The fluorescence levels of the Pche-1::mcherry transcriptional reporter were not significantly altered by tfg-1 RNAi treatment (Student’s t-test p=0.1258, n = 120 animals per genotype, N = 3). (E) L4-staged animals were treated with either 25 µg/ml tunicamycin (TM) or with DMSO till day 2 of adulthood and then scored. Normalized average mean fluorescence levels of the Pche-1::mcherry transcriptional reporter were not significantly altered by TM treatment compared to DMSO. ire-1 mutated background did not significantly change on either TM or DMSO. Nested one-way ANOVA followed by Tukey’s post hoc analysis indicated no significant difference between groups. Means represented by ‘X.’ n = 60 animals per genotype, N = 2.
Figure 3—figure supplement 3. The flp-6 hairpin motif is required for ER stress-induced GED in gld-1; ced-3 deficient animals.

Figure 3—figure supplement 3.

(A) The lowest free energy predicted secondary RNA structure for the given fragment of the flp-6 transcript sequence as calculated by the RNA structure web server (Reuter and Mathews, 2010), before and after scrambling. The conserved residues in the nucleotide loop of putative RIDD substrates (Moore and Hollien, 2015) are highlighted in yellow. Black triangle marks putative cleavage site by IRE1 based on the wild-type transcript sequence. In the scrambled in vitro cleavage substrate, the loop structure has been extended and the conserved nucleotides within the loop have been altered. In the scrambled CRISPR cleavage substrate, corresponding to the biu100 mutation, the entire stem-loop structure has been disrupted using silent mutations to preserve the coding sequence. (B) Purified recombinant human IRE-1α comprising the kinase and RNase domains (IRE1-KR) was incubated with wild-type or scrambled in vitro-transcribed flp-6 RNA fragments. Cleavage products of the flp-6 RNA fragment (marked by asterisks) were observed upon the incubation of the wild-type transcript with IRE1-KR. These fragments were not observed upon incubation of the in vitro-scrambled flp-6 transcript with IRE1-KR. (C) Treatment with a mixture of gld-1; ced-3; tfg-1 RNAi (g.c.t) failed to increase the levels of ectopic somatic cells in the gonads of hairpin-mutated flp-6(biu100) animals (n = 80 gonads per genotype, N = 3). See (A) for the description of the biu100 mutation. Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 compared to the corresponding control RNAi treatment. Triple asterisks mark significant results resulting in a twofold change or more.

IRE-1 acts upstream of FLP-6 and controls its transcript abundance via RIDD

GED induction by ER stress in gld-1(-) animals is ire-1-dependent but xbp-1-independent (Levi-Ferber et al., 2015). A key xbp-1-independent output of ire-1 is RIDD (Hollien and Weissman, 2006), which degrades transcripts based on their proximity to the ER and the presence of a specific hairpin motif (Oikawa et al., 2010). Although RIDD is conserved from yeast to human, surprisingly, no RIDD target has been demonstrated thus far in C. elegans. We hypothesized that ER stress activates ire-1, which in turn degrades flp-6 transcripts encoding a protein that normally prevents GED. To test this hypothesis, we measured the mRNA levels of flp-6 under non-stress and under ER stress conditions using qRT-PCR. Consistent with our hypothesis, ER stress conditions (i.e., tfg-1 RNAi treatment or mutation in the ER homeostasis-promoting transcription factor xbp-1) reduced the levels of the flp-6 transcript in an ire-1-dependent manner (Figure 3—figure supplement 2A and Figure 3B). As expected, deficiency in ire-1 itself did not reduce flp-6 transcript levels (Figure 3—figure supplement 2A and Figure 3B). Furthermore, overexpression of ire-1 specifically in the ASE neuron resulted in a significant reduction in flp-6 transcript levels relatively to wild-type animals (Figure 3C). Together, these data indicate that flp-6 transcript levels are downregulated by ire-1 activation in an xbp-1-independent manner, as would be expected for a target of RIDD.

The RIDD process destabilizes select RNAs post-transcriptionally. To examine whether the ER stress-related changes in flp-6 transcript levels are due to transcriptional or post-transcriptional regulation, we first analyzed the expression of a Pflp-6::gfp transcriptional reporter. No significant change was observed in the levels of the flp-6P transcriptional reporter upon ER stress (i.e., tfg-1 RNAi treatment) or upon ire-1 depletion (Figure 3—figure supplement 2B). Furthermore, a reduction in the levels of a flp-6::gfp translational reporter, under the control of the heterologous ASE-specific che-1 promoter, was observed upon ER stress (i.e., tfg-1 RNAi or tunicamycin treatment) in wild-type animals, but not in ire-1(-) animals (Figure 3—figure supplement 2C and Figure 3D). Notably, the reduction in levels of the FLP-6::GFP protein reporter in ER-stressed wild-type animals was not due to a decrease in activity of the driving promoter, which was unaltered by the ER stress treatments (Figure 3—figure supplement 2D,E). This data indicates that ire-1 decreases FLP-6 levels post-transcriptionally, consistent with the hypothesis that flp-6 transcript is a RIDD substrate.

RIDD substrates typically harbor an xbp-1-like stem-loop structure comprising a seven nucleotide loop (-C-X-G-C-X-X-X-) with three conserved residues and a stem of at least four base pairs (Moore and Hollien, 2015; Hooks and Griffiths-Jones, 2011; Peschek et al., 2015). Within the spliced flp-6 sequence, we identified one potential xbp-1-like stem-loop structure (Figure 3—figure supplement 3A). Although the identified structure contains only six (rather than the typical seven) nucleotides in the loop, it has all the conserved residues (-C-x-G-C-X-X-) followed by a relatively strong putative stem structure. To test whether this RNA molecule could indeed be cleaved directly by the IRE-1 endoribonuclease, we incubated a 513 bp RNA segment harboring this stem loop with a phosphorylated form of purified human IRE-1 kinase-RNase domain (IRE-1 KR-3P) (Lu et al., 2014). Indeed, incubation of the flp-6 stem-loop RNA fragment with recombinant IRE-1 KR-3P generated detectable cleavage products of the expected sizes Figure 3E. Furthermore, the cleavage was blocked by the IRE-1-specific RNAse inhibitor 4μ8c (Cross et al., 2012; Figure 3E) and did not occur upon disruption of the RNA stem-loop structure by nucleotide scrambling (Figure 3—figure supplement 3A,B). These data indicate that the flp-6 RNA can be directly cleaved within its stem-loop structure by IRE-1 RNAse in vitro, thus supporting the possibility that flp-6 is a direct RIDD substrate.

Next, we used a CRISPR/Cas9 genome engineering protocol to generate flp-6(biu100) mutants in which the typical xbp-1-like stem-loop structure was destroyed using a set of silent mutations that preserved the coding sequence of the FLP-6 protein (Figure 3—figure supplement 3A). We found that unlike the control wild-type animals, the transcript levels of flp-6 were not decreased by tfg-1 RNAi-induced ER stress once the stem-loop structure of the transcript was disrupted (Figure 3F). Furthermore, we examined how the stem-loop-disrupting mutation affected GED levels in the animals. We found that similarly to wild-type animals with wild-type flp-6 transcript, treatment with a gld-1, ced-3, control RNAi mix did not increase the levels of ectopically large nuclei in the gonads of flp-6(biu100) mutants (Figure 3G and Figure 3—figure supplement 3C). This attests to the integrity of the FLP-6 product, whose deficiency results in GED induction (Figure 2C). Strikingly, unlike animals with wild-type flp-6 transcript, treatment with a gld-1, ced-3, tfg-1 RNAi mix did not induce ectopic large nuclei in the gonads of flp-6(biu100) mutants (Figure 3G and Figure 3—figure supplement 3C). This indicates that the stem-loop motif in the flp-6 transcript is critical for ER stress-induced GED induction.

Finally, given that it is ASE-produced FLP-6 that is critical for GED prevention, if flp-6 levels are downregulated by IRE-1’s RIDD activity, then the ribonuclease activity of IRE-1 should be essential for ER stress-induced GED. Furthermore, IRE-1 expression specifically in the ASE sensory neuron should be sufficient for restoration of ER stress-induced GED in otherwise ire-1-deficient mutants. Indeed, analysis of a kinase-dead (wy782) and a ribonuclease-dead (wy762) ire-1 mutant (Wei et al., 2015) indicated that both the kinase and ribonuclease activities of IRE-1 were required for ER-stress induction of GED (Figure 3H). Note that the kinase activity is required for the ribonuclease activity, which directly executes RIDD (Harnoss et al., 2019). Furthermore, we individually restored ire-1 expression in ASE or ASG (two FLP-6-producing glutamatergic sensory neurons). As expected, Pche-1::ire-1; ire-1(-) transgenic animals, which express ire-1 specifically in the ASE neuron and consequently destabilize the flp-6 transcript (Figure 3C), had high levels of abnormal nuclei in their gonads upon exposure to ER stress. In contrast, Pops-1::ire-1; ire-1(-) transgenic animals, which express ire-1 in the ASG and ADL sensory neurons, did not have high levels of abnormal nuclei in their gonads upon exposure to ER stress (Figure 3I). Altogether, these findings further support the conclusion that IRE-1 limits FLP-6 protein levels in the ASE neuron by destabilizing flp-6 transcripts via RIDD.

AIY prevents GED by acetylcholine (ACh) signaling

ASE is one of the head amphid neurons, and it does not synapse with the gonad. Hence, we examined the putative involvement of four interneurons (AIA, AIB, AIY, RIA) known to synapse with ASE (Chen et al., 2006) in the GED process. Our data support the hypothesis that ER stress conditions promoting GED formation interfere with an existing germline pluripotency-inducing signal. Accordingly, inactivation/interference of the critical signaling cells should also lead to the generation of GED, even in the absence of ER stress, as seen in ASE(-)/flp-6(-) animals (Figure 2D–F). Hence, we used a system for inducible silencing of specific neurons based on transgenic nematodes engineered to produce the inhibitory Drosophila histamine-gated chloride channel (HisCl1) in each of the four suspected interneurons (AIA, AIB, AIY, RIA; Pokala et al., 2014). Presence of aberrant nuclei in the gonads of the animals was assessed in each of the strains, with or without histamine, upon treatment with gld-1 and ced-3 RNAi. Whereas histamine-induced inactivation of AIA, AIB, and RIA resulted in low levels of abnormal nuclei in the gonads, animals in which the AIY neuron was inactivated displayed high levels of abnormal nuclei in their gonads (Figure 4A). This result implicates AIY in GED regulation.

Figure 4. AIY produces acetylcholine (ACh) to prevent germline ectopic differentiation (GED).

Figure 4.

Percent of gonad area occupied by ectopic somatic cells determined by DAPI staining of day 4 animals treated with a mixture of gld-1 and ced-3 RNAi. (A) Four histamine-inducible interneurons silencing mutants (AIA, AIB, AIY, RIA) were examined (n = 170 gonads per genotype, N = 3). While AIA, AIB, and RIA histamine-treated animals exhibited low levels of ectopic somatic cells in the gonads, AIY histamine-treated animals had high GED levels. Asterisks mark two-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals without histamine treatment. (B) flp-6 RNAi did not additively increase GED levels in AIY histamine-treated animals (n = 180 gonads per genotype, N = 4). p-Values were determined by one-way ANOVA followed by Tukey’s post hoc analysis. All strains were grown in the presence of histamine. (C) Animals deficient in both flp-6(ok3056) and mex-3 additively increased GED (n = 215 gonads per genotype, N = 3). Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to animals treated with the gld-1, ced-3, control RNAi mix. (D) cha-1(p1152) and unc-17(e113) mutants had high levels of ectopic somatic cells upon gld-1 and ced-3 RNAi treatment (n = 190 gonads per genotype, N = 3). These were suppressed upon expression of the corresponding transgenes in the AIY neuron (Pttx-3::cha-1 and Pttx-3::unc-17). Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to wild-type animals unless indicated otherwise. In all panels, triple asterisks mark significant results resulting in a twofold change or more.

In order to see if ASE-produced flp-6 and AIY act in a common pathway to regulate GED, we compared the levels of abnormal nuclei between flp-6 and AIY-defective animals in a gld-1(-); ced-3(-) genetic background. We found that each perturbation, individually or in combination, resulted in occupation of ~40% of the gonad with abnormal nuclei (Figure 4B). In contrast, treatment of flp-6 mutants with mex-3 RNAi (previously reported to increase GED in gld-1(-) animals; Ciosk et al., 2006) did increase the occupancy of the gonad with GED beyond 40% in an additive manner (Figure 4C), demonstrating that the analysis of GED levels in this system is not limited by saturation. Together, these results suggest that the AIY interneuron and flp-6 act in a common pathway to control GED, whereas mex-3 deficiency promotes GED via an independent pathway.

We next investigated how the signal is relayed from AIY to the gonad. AIY communicates mainly with flp-1, flp-18 or ACh. However, neither deficiencies in flp-1 nor in flp-18 resulted in high levels of abnormal nuclei in the gonads (Figure 4D), suggesting that these neuropeptides are not individually necessary for GED. Next, we examined ACh involvement in this signaling pathway using mutations that partially perturb ACh synthesis. Upon treatment with gld-1 and ced-3 RNAi, we found high levels of abnormal nuclei in the gonads of cha-1(p1152) mutants, in which Ach synthesis is defective (Cohen et al., 2014), as well as in unc-17(e113) mutants, in which synaptic vesicle Ach transport is defective (Zhu et al., 2001; Figure 4D). Furthermore, expression of a rescuing construct of cha-1 or unc-17 under the AIY-specific Pttx-3promB promoter (Altun-Gultekin et al., 2001) led to low levels of abnormal cells in the gonads, similarly to the wild-type level (Figure 4D). Altogether, these findings implicate ACh signaling by AIY in the regulation of GED.

HSN produces serotonin to prevent GED

How is the signaling cascade transmitted downstream to the gonad? AIY communicates via synapses with a few sensory neurons (AWA, AWC, ADF) and a few interneurons (RIA, RIB, AIZ). In addition, AIY synapses with the HSN-R motor neuron, which innervates the vulva muscles (Chen et al., 2006). Based on its anatomical location near the vulva, HSN was the strongest candidate for further examination. Indeed, high levels of abnormal nuclei were identified upon treatment with gld-1 and ced-3 RNAi in two HSN-deficient mutants (her-1 and sem-4) as well as in three HSN migration-defective mutants (Figure 5A). In addition, an epistasis analysis between flp-6 and sem-4 or her-1 HSN-deficient animals showed no additive effect on the levels of abnormal nuclei in the gonad (Figure 5A). Together, these results suggest that HSN and flp-6 act in a common pathway to regulate GED.

Figure 5. HSN produces serotonin to prevent germline ectopic differentiation (GED).

(A–C) Gonad area occupied by ectopic somatic cells determined by DAPI staining of day 4 animals treated with a mixture of gld-1 and ced-3 RNAi. All HSN deficiency and migration mutants had high levels of ectopic somatic cells in their gonads. flp-6 deletion did not further increase GED levels in HSN-defective animals (n = 175 gonads per genotype, N = 3) (A). HSN-related neuropeptide mutants had low levels of GED, similar to wild-type animals (n = 200 gonads per genotype, N = 3) (B). Both tph-1(mg280) and bas-1(tm351) serotonin mutants had high levels of ectopic somatic cells in their gonads, similarly to flp-6 mutants (n = 185 gonads per genotype, N = 3) (C). See Figure 5—figure supplement 1 for the analysis of serotonin receptor mutants. (D) Treatment with 20 mM serotonin (5-HT) suppressed the high ectopic somatic fluorescence of the neuronal reporter Punc-119::gfp in the gonads of gld-1(RNAi); tfg-1(RNAi) or gld-1(RNAi); flp-6(RNAi)-treated ced-3 mutants to the same extent as in the control RNAi group. However, treatment with serotonin (5-HT) did not suppress the ectopic somatic fluorescence of the neuronal reporter in gld-1(RNAi); mex-3(RNAi)-treated animals. Representative fluorescent images are shown. n = 90 gonads per genotype, N = 2. Asterisks mark nested one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals without serotonin supplementation. Means represented by ‘X.’ (E) tph-1 deficiency in HSN, but not in other serotonin-producing neurons, resulted in high levels of ectopic somatic-like cells in the gonads (n = 195 gonads per genotype, N = 4). In (A–C) and (E), asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to wild-type animals treated with gld-1 and ced-3 RNAi, unless indicated otherwise. In all panels, triple asterisks mark significant results resulting in a twofold change or more.

Figure 5.

Figure 5—figure supplement 1. Four major serotonin receptor mutants are not required for germline ectopic differentiation (GED) in gld-1; ced-3-deficient animals.

Figure 5—figure supplement 1.

Percentage of gonad area occupied by DAPI-labeled ectopic cells in day 4 animals treated with gld-1 and ced-3 RNAi (n = 140 gonads per genotype, N = 4). Asterisks mark one-way ANOVA values followed by Tukey’s post hoc analysis of p<0.001 relative to wild-type animals treated with gld-1 and ced-3 RNAi. mod-1, ser-1, ser-4, and ser-7 deficiencies were obtained by ok103, ok345, ok512, ok1944 mutations, respectively. Triple asterisks mark significant results resulting in a twofold change or more.
Figure 5—figure supplement 2. Treatment with 20 mM serotonin (5-HT) decreased the levels of abnormal nuclei in the gonads of gld-1 and ced-3 RNAi-treated tph-1(mg280) and flp-6(ok3056) mutants (n = 165 gonads per genotype, N = 3).

Figure 5—figure supplement 2.

Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to the same animals without serotonin supplementation.

How does HSN signal to the gonad? We examined the involvement of four HSN-produced neuropeptides (nlp-3, nlp-8, nlp-15, flp-5) and the neurotransmitter serotonin. None of the mutants of the HSN-related neuropeptides induced high levels of GED upon treatment with gld-1; ced-3 RNAi (Figure 5B). In contrast, two serotonin-defective mutants (tph-1 and bas-1) did exhibit high levels of abnormal nuclei in their gonads, similarly to flp-6(-) (Figure 5C). This indicates that serotonin production is required for preventing the appearance of cells with aberrant nuclei in the gonads of gld-1(-); ced-3(-) animals.

There are four genes encoding major serotonin receptors in C. elegans. Hence, we examined whether a deficiency in any of these receptors results in GED formation in gld-1(-); ced-3(-) animals, similarly to animals deficient in serotonin production. However, we found that GED levels in mutants lacking each of the major serotonin receptors individually (ser-1(-), ser-4(-), ser-7(-), mod-1(-) in gld-1(RNAi); ced-3(RNAi) background) remained low (Figure 5—figure supplement 1). This implies that in this case serotonin affects germ cell fate by another serotonin receptor or that it is redundantly recognized by more than one of these receptors.

Next we examined whether serotonin can suppress GED formation in gld-1(RNAi); ced-3(RNAi) background. First, we examined how externally supplied serotonin affected GED by measuring ectopic somatic cells fluorescence of animals expressing the neuronal reporter Punc-119::gfp. Consistent with the putative role of serotonin in the suppression of GED, we found that supplementation with 20 mM serotonin suppressed the detection of cells expressing the neuronal marker in the gonads of tfg-1- or flp-6-deficient animals under gld-1 and ced-3 RNAi conditions (Figure 5D). In contrast, in mex-3-deficient background, serotonin supplementation did not alter the higher ectopic somatic cells’ fluorescence levels (Figure 5D). Furthermore, treatment with 20 mM serotonin also reduced the levels of abnormal nuclei in the gonads of flp-6(-) mutants treated with gld-1 and ced-3 RNAi down to wild-type level (Figure 5—figure supplement 2). Similar results were obtained in tph-1-deficient animals treated with gld-1 and ced-3 RNAi upon serotonin supplementation (Figure 5—figure supplement 2). This suggests that high levels of serotonin are sufficient to suppress GED induced by flp-6 deficiency in gld-1(-); ced-3(-) animals.

Serotonin is produced by the ADF, ASG, and HSN neurons. The fact that HSN-defective gld-1(-); ced-3(-) animals have high levels of GED suggested that serotonin production by HSN may be critical for GED suppression. To verify that serotonin production specifically from HSN regulates GED, we measured GED levels upon gld-1; ced-3 RNAi treatment in strains expressing Cre-Lox-specific knockout of tph-1 (Flavell et al., 2013). Inhibition of serotonin production in either ADF or in ASG resulted in low levels of abnormal nuclei in the gonads, similarly to those of the genomic rescue of tph-1 (Figure 5E). In contrast, inhibition of serotonin production in HSN led to high levels of abnormal nuclei in the gonads, similar to those observed in tph-1(mg280) mutants (Figure 5E). Altogether, our results suggest that HSN determines GED levels in the tumorous germline of C. elegans through serotonin signaling, and that serotonin seems to regulate GED specifically in the context of the ASE-AIY-HSN-germline circuit.

Perturbation of the ASE-AIY-HSN-gonad circuit induces GED

Thus far, our findings demonstrate that the ASE, AIY, and HSN neurons are required individually to prevent the accumulation of cells with abnormal nuclei in the tumorous gonad of gld-1-deficient animals. Previously we have shown that ER stress also results in the accumulation of cells with abnormal nuclei in the tumorous gonad of gld-1-deficient animals, and that these cells are ectopically differentiated somatic cells that arise from the tumorous germline (Levi-Ferber et al., 2015). Our new findings suggest that ER stress affects the differentiation state of the tumorous germline by compromising the pluripotency-protective ASE-AIY-HSN-germline circuit. Thus, the abnormal nuclei that arise and accumulate in the tumorous gonads upon perturbations within the ASE-AIY-HSN-germline circuit are likely to be the nuclei of differentiated somatic cells as well. To test this directly, we made use of a Punc-119::gfp pan-neuronal reporter, introduced into ASE-deficient che-1 mutants, HSN-deficient sem-4 mutants, or flp-6/cha-1/tph-1 mutants with defective flp-6/acetyl-choline/serotonin signaling, all of which have been implicated in the circuit identified herein. The Punc-119::gfp marker is normally expressed in the nerve cells of animals and is apparent from embryo to adult. However, upon GED in tumorous gonads, this marker is also observed in germ cells that acquired neuronal fate within the gonad (Levi-Ferber et al., 2015). Consistent with the phenomenon of GED, we found expression of the neuronal reporter within the tumorous gonads of animals with a perturbed ASE-AIY-HSN-germline but not in animals with an intact circuit (Figure 6A). A similar induction of the Punc-119::gfp neuronal marker was also observed in cells within the gonads upon artificial activation of ire-1 in neurons (via ire-1 overexpression; Figure 1D), upon tfg-1 RNAi-induced ER stress (Figure 5D) or upon flp-6 deficiency (Figure 2F). Taken together with the C. elegans connectome and epistasis analysis, we conclude that these neurons establish a neuronal circuit whose integrity prevents ectopic differentiation of the germline into somatic cells in the tumorous gonad.

Figure 6. A neuronal circuit actively prevents germline ectopic differentiation (GED).

Figure 6.

(A) Abnormal expression of the neuronal reporter Punc-119::gfp within the tumorous gonads of gld-1 RNAi-treated animals with a perturbed ASE-AIY-HSN-germline circuit compared to animals with an intact circuit. che-1 and sem-4 mutants are ASE and HSN-deficient, respectively. flp-6 mutants are deficient in the FLP-6 neuropeptide. cha-1 and tph-1 mutants are compromised in acetylcholine (Ach) and serotonin production. Asterisks mark one-way ANOVA followed by Tukey’s post hoc analysis of p<0.001 relative to control ced-3(-) animals treated with gld-1 RNAi. Triple asterisks mark significant results resulting in a twofold change or more. (B) Summarizing model of ASE-AIY-HSN-germline circuit which actively maintains germline pluripotency and suppresses ectopic germline differentiation in gld-1 tumorous animals. Implicated neurons and signaling molecules are indicated. Endoplasmic reticulum (ER) stress suppresses this circuit by regulated Ire1-dependent decay (RIDD)-mediated destabilization of the flp-6 transcript in the ASE neuron. This releases the inhibition from the tumorous germ cells that acquire somatic fate by default. (C) Lifespan analysis of wild-type animals and flp-6 mutants treated with either gld-1 RNAi to induce tumor formation or with control RNAi. Lifespan shortening was significantly suppressed in flp-6 mutants treated with gld-1 RNAi. Mean lifespan is indicated within each graph. Log rank (Mantel–Cox) p<0.001 between wild-type animals treated with either gld-1 RNAi or with control RNAi is indicated in purple. Log rank (Mantel–Cox) p=0.857 between flp-6 mutants treated with either gld-1 RNAi or with control RNAi is indicated in red. See Supplementary file 2 for statistical data of two additional replicates. (D) Paralysis assay in wild-type animals and flp-6 mutants treated with gld-1 RNAi. 90 synchronized adult animals per genotype were placed on gld-1 RNAi plates and their paralysis was scored on days 5, 6, 8, and 9. Bar graphs present percentage of paralyzed animals. At all timepoints, the flp-6 deficiency resulted in a significant decrease in the paralysis of the tumorous animals in comparison to wild-type animals. Proportions of paralyzed animals were compared between different genotypes in three replicates using the Cochran–Mantel–Haenszel test. Triple asterisks mark significant reduction of at least twofold change in the paralysis relative to wild-type animals treated with gld-1 RNAi. Note that in the lifespan and paralysis, experiments shown in (C) and (D) were done in ced-3(+) background to allow the apoptosis-mediated clearance of the ER stress-induced aberrant somatic cells in the gonad.

flp-6 deficiency suppresses the germline tumor in gld-1-deficient animals

We have previously demonstrated that ER stress-induced germ cell transdifferentiation renders apoptosis-resistant cells into apoptosis-sensitive cells, enabling their removal from the tumorous gonad and thus improving the health of the animals (Levi-Ferber et al., 2015). Since flp-6 deficiency also induces germ cell transdifferentiation even in the absence of ER stress, we wondered whether it would similarly improve the health of the animals. Therefore, we measured the effect of gld-1-induced germline tumor on the lifespan and mobility of wild-type and flp-6(-) animals. We found that in wild-type animals treatment with gld-1 RNAi shortened the lifespan by approximately 30% (Figure 6C). In contrast, treatment with gld-1 RNAi did not significantly alter lifespan of flp-6(-) mutants compared to control RNAi treatment (Figure 6C). One of the consequences of the expanding germline tumor is the increased rigidity of the animal’s body, which leads to a gradual paralysis. Accordingly, less paralyzed animals were detected among the flp-6-defeicient animals compared to wild-type animals upon treatment with gld-1 RNAi (Figure 6D). Altogether, these results further support the concept that GED can suppress the germline tumor and promote both lifespan and healthspan.

Discussion

Previous studies demonstrated the tendency of abnormal tumorous gonads to form germline-derived teratoma (Ciosk et al., 2006). Here, we demonstrate that cell differentiation decisions in the tumorous germline of animals deficient in the germline-specific translation repressor gld-1 can be regulated by neuronal cues that are sensitive to ER stress. Interestingly, we demonstrate that the propensity of the tumorous germline to differentiate into somatic cells rather than to maintain pluripotency is actively counteracted by neuronal cues of a newly identified germline differentiation-inhibitory signaling circuit.

The germline differentiation-inhibitory neuronal circuit identified in this study includes the sensory neuron ASE, the interneuron AIY, and the motor neuron HSN, which synapses at the vulva. Furthermore, we identified the central signaling molecules required for the active suppression of GED by this neuronal circuit. While ASE communicates via the neuropeptide FLP-6, AIY communicates via the neurotransmitter Ach and HSN communicates via serotonin. Deficiency in any of these neurons or signaling molecules comprising the germline differentiation-antagonizing circuit resulted in extreme ectopic differentiation of the germline in animals with a germline tumor (see model, Figure 6B). Interestingly, additional reproduction-related decisions are determined non-autonomously by neuronal signals. For example, the ASI sensory neuron regulates germline apoptosis, germline mitosis, and sperm activity (Levi-Ferber et al., 2014; Dalfó et al., 2012; McKnight et al., 2014). Nevertheless, in tumorous gld-1 animals, shifting germline fate from a pluripotent state to an ectopically differentiated somatic state is regulated by a distinct neuronal circuit, governed by the ASE sensory neuron. This implies that separate sets of neurons can provoke divergent responses in the C. elegans germline. ASE is a gustatory neuron, known mainly to mediate chemotaxis toward water-soluble cues, including salt ions such as Na+ and Cl(Bargmann and Horvitz, 1991). While it may be puzzling why a salt-sensing neuron would control germline fate, previous studies demonstrated that the sensing of salt may be coupled to the presence of food (Tomioka et al., 2006). In turn, food availability is an important determinant of reproductive physiology.

The most downstream signaling molecule identified in the neuronal circuit that controls germline pluripotency in the tumorous germline is the conserved neurotransmitter serotonin. In C. elegans, serotonin causes dramatic behavioral effects including inhibition of locomotion, stimulation of egg laying, and pharyngeal pumping and food-related behaviors (Weinshenker et al., 1995; Horvitz et al., 1982; Ségalat et al., 1995; Sawin et al., 2000; Rogers et al., 2001; Niacaris and Avery, 2003; Waggoner et al., 1998; Mendel et al., 1995). While all these effects are modulated by the same molecule, they lead to different independent outcomes. Interestingly, none of the four dedicated C. elegans serotonin receptors is required for GED prevention. This may be due to redundancy or due to involvement of other, less specific, serotonin receptors in this circuit. Another layer of specificity may be encoded in the local levels and production site of serotonin. In support of this, serotonin production specifically by the HSN neuron is exclusively critical for preventing GED. Furthermore, migration-defective HSN does not effectively prevent GED, highlighting the importance for the correct location of the synapse of HSN near the vulva. Altogether, this suggests that the site and local concentrations of serotonin release play a key role in GED prevention, which differentiates this function from those of other serotonin signaling events. Furthermore, given the tumor-suppressive effects of GED (Levi-Ferber et al., 2015) and consistent with studies that suggest that serotonin levels can play a crucial role in human cancer (Sarrouilhe and Mesnil, 2019), this work supports a role for the serotoninergic system in tumor progression, rendering it a potential chemotherapeutic target.

Similarly to GED induction by perturbations in any of the components of the germline differentiation-antagonizing neuronal circuit, ER stress also induces GED within the tumorous gonads, leading to suppression of the germline tumor (Levi-Ferber et al., 2015). Our present findings provide mechanistic insights into the underlying mechanism of ER stress-induced GED. Specifically, we show that ER stress-induced GED is not the consequence of ER stress per se within the germ cells, but rather the indirect result of activation of the IRE-1 endoribonuclease in the ASE neuron. We further show that the flp-6 transcript has the structural requirements for RIDD, undergoes direct 4μ8c-inhibitable and stem-loop sequence-dependent cleavage by purified recombinant IRE1 in vitro, and is destabilized in an ire-1-dependent manner in vivo, indicating that the flp-6 transcript is a target of RIDD. Furthermore, RIDD-mediated destabilization of the flp-6 transcript is essential for ER stress-induced GED as it cannot be induced in flp-6 stem-loop mutants, whose flp-6 transcripts are RIDD-resistant. To the best of our knowledge, this is the first demonstration of a RIDD substrate in C. elegans. Furthermore, since the flp-6 transcript encodes the ASE-produced neuropeptide that controls the GED regulatory circuit, this disrupts the germline differentiation-antagonizing neuronal circuit, which can no longer prevent the acquisition of somatic fate by the germline tumor cells. This model is consistent with our previous findings that it is not the stress itself that regulates germ cell fate, but rather the activation of the ER stress sensor IRE-1, which in turn transduces an xbp-1-independent signal to promote GED and limit the progression of the germline tumor (Levi-Ferber et al., 2015). Whereas our findings clearly implicate RIDD in ER stress-induced GED, this study has not explored the conceivable implication of additional xbp-1-independent signaling pathways regulated by IRE-1 such as the JNK/TRAF2 pathway (Urano et al., 2000). Altogether, this is the first evidence that neuronal circuits can be disrupted by RIDD to affect tumor progression by regulating cross-tissue communication.

What could be the benefit in a germline differentiation-inhibitory neuronal circuit? We speculate that under physiological conditions, in a non-tumorous background, such a circuit may be beneficial for preventing precocious differentiation of germline cells prior to fertilization. In the context of animals with a tumorous germline, we have previously demonstrated that acquisition of somatic fate by the tumorous germ cells limits the progression of the tumor by reducing its mitotic capacity and restoring the ability of the cells to execute apoptosis (Levi-Ferber et al., 2015). The current identification of an ER stress-regulated neuronal circuit that controls this transition in a distal tumorous tissue suggests that targeting such neuronal circuits and targeting the RNase activity of IRE1 may be useful as therapeutic interventions for tumor suppression. These findings may be relevant to human tumors as well since many human tumors, originating from a variety of major organs, are innervated, and this innervation is thought to contribute to the pathophysiology of cancer progression (Hutchings et al., 2020; Boilly et al., 2017).

Materials and methods

A list of strains and reagents used in this study is provided Appendix 1—key resources table.

RNA interference

Bacteria expressing dsRNA were cultured overnight in LB containing tetracycline and ampicillin. Bacteria were plated on NGM plates containing 5 mM IPTG and 50 μg/ml carbenicillin. RNAi clone identity was verified by sequencing. Eggs were placed on plates and synchronized at day 0 (L4). The efficacy of the tfg-1 RNAi was confirmed by the animals’ reduced body size (Witte et al., 2011) and the induction of the ER stress reporter Phsp-4::gfp (Levi-Ferber et al., 2014; Witte et al., 2011). The efficacy of the ced-3 RNAi was confirmed by the lack of apoptotic corpses in the gonads. The efficacy of the gld-1 RNAi was confirmed by the tumorigenicity of the gonads and the absence of oocytes and embryos. For double or triple RNAi mixtures, the relative amount of each RNAi bacteria was kept equal between samples by growing the bacterial cultures overnight and then supplementing the relative amount of control RNAi as needed. Note that we have previously shown that GLD-1 protein levels were efficiently and similarly reduced in all RNAi combinations involving gld-1 RNAi. including single RNAi treatment, double RNAi treatment. and triple RNAi treatment (see Figure 1—figure supplement 2 in Levi-Ferber et al., 2015).

Fluorescence microscopy and quantification

To follow expression of fluorescent transgenic markers, transgenic animals were anesthetized on 2% agarose pads containing 2 mM levamisol. Images were taken with a CCD digital camera using a Nikon 90i fluorescence microscope. For each trial, exposure time was calibrated to minimize the number of saturated pixels and was kept constant through the experiment. The NIS element software was used to quantify mean fluorescence intensity as measured by intensity of each pixel in the selected area within the gonad.

To determine the fraction of the gonad area occupied by ectopic cells, day 4 animals were fixed and stained with DAPI. The NIS element software was used to manually select and quantify the gonad area as well as the area within the gonad that was occupied by abnormal DAPI-stained nuclei in the animals. Percent of gonad area occupied by large nuclei is the ratio of these two paired measurements.

Statistical analysis

Error bars represent the standard error of the mean (SEM) of independent biological replicates unless indicated otherwise. For a simple comparison between two data sets, p-values were determined using unpaired Student’s t-test, assuming unequal variances. For multiple comparisons, between multiple data sets, groups and/or treatments were compared using one-way or two-way or nested one-way ANOVA followed by a Tukey’s post hoc analysis. Normality of residuals assumption was assessed with residuals plots. For lifespan experiments, p-values were calculated using the log rank (Mantel–Cox) analysis. For paralysis assay, p-values were calculated using the Cochran-Mantel–Haenszel test. See Supplementary file 2 for statistical data. Significance threshold was set as p<0.01 and marked with an asterisk. Significant changes beyond twofold change are marked by three asterisks.

Quantitative RT-PCR analysis for flp-6

Animals were raised at 20°C until day 1 of adulthood. On day 1, animals were collected for RNA extraction. RNA extraction, purification, and reverse transcription were carried out using standard protocols. Real-time PCR was performed using Maxima SYBR (Fermentas) in a StepOnePlus instrument. Transcript levels of act-1 were used for normalization. For act-1 and flp-6 primers, see Appendix 1—key resources table.

DAPI staining

Adult worms (at the ages of either day 1, 4, 5, or 10) were collected from agar plates and were washed with M9 solution to remove Escherichia coli bacteria. Permeabilization of the animals was performed by freezing them at –80°C. For fixation, worms were washed with cold methanol and incubated for 15 min at –20°C. The fixed animals were then washed twice with PBSTx1 and stained with 1 μg/ml 4',6-diamidino-2-phenylindole (DAPI; Sigma) solution for 30 min. Worms were washed two times with PBSTx1 to remove excess staining and observed under the fluorescent microscope to quantify ectopic differentiated nuclei within the animals' gonads.

Serotonin treatment

Nematodes were grown and assayed at room temperature on standard NGM seeded with E. coli strain OP50 as a food source till day 1 of adulthood. For drug experiments, 5-hydroxytryptamine creatinine sulfate complex (Sigma) was added to NGM agar plates to a final concentration of 20 mM. Day 1 animals were grown till day 4 on the 20 mM 5-HT plates and washed for DAPI staining procedure at day 4 of adulthood.

flp-6(biu100) generation

In order to generate the flp-6(biu100) mutated strain, we employed a previously described CRISPR/Cas9 genome engineering protocol (Paix et al., 2015). Briefly, tracrRNA and two crRNAs, targeting the dpy-10 and the flp-6 loci, were mixed with a recombinant cas9 (IDT), ssODN repair template to introduce a dominant mutation into the dpy-10 locus, and ssODN targeting flp-6 (see Appendix 1—key resources table for sequences). Rol/dpy F1 progeny were singled and screened by PCR using the primers GTAAGAGCGCTTACATGAGA and TTGAGGTCCAGATCGCTTTC with an annealing temperature of 62°C, conditions in which only the flp-6(biu100) allele is amplified but not the wild-type flp-6. Plates with a positive PCR signal were Sanger-sequenced to validate homozygosity of the flp-6(biu100) allele. Strains were outcrossed three times to remove the dpy-10 mutation and reduce other background mutations.

Histamine treatment

As previously described (Pokala et al., 2014), eggs from four histamine-inducible interneurons silencing mutants were grown on non-histamine OP50 seeded plates until L4 stage. At L4 stage, worms were moved to histamine-containing plates (represented by black bars in Figure 4A as histamine+) or to non-histamine plates (represented by gray bars in Figure 4A as histamine-) until day 4 of adulthood. At day 4 of adulthood, worms were examined for ectopic large nuclei within the gonads using DAPI staining. 1 M histamine (HA) stock was prepared by dissolving 1.85 g histamine dihydrochloride (Sigma-Aldrich H7250) per 10 ml water. Experiments were performed in plates contacting a final concentration of 10 mM histamine.

Purification of phosphorylated IRE1α KR fractions

Fully phosphorylated human IRE1α KR was produced as follows: human IRE1α KR (G547-L977) was expressed in SF9 cells as an N-terminal His6-tagged fusion protein with a TEV protease cleavage site using an intracellular BEVS expression vector. Cell pellet was resuspended in lysis buffer containing 50 mM HEPES pH 8.0, 300 mM NaCl, 10% glycerol, 1 mM MgCl2, 1:1000 benzonase, EDTA-free PI tablets (Roche), 1 mM TCEP, and 5 mM imidazole. Sample was lysed by sonication, centrifuged at 14,000 rpm for 45 min, and the supernatant filtered through a 0.8 μm Nalgene filter. Cleared supernatant was bound to Ni-NTA Superflow beads (Qiagen) by gravity filtration. Beads were washed in lysis buffer supplemented with 15 mM imidazole, followed by protein elution in lysis buffer containing 300 mM imidazole. The eluate was incubated with TEV protease overnight at 4°C. The sample of IRE1α KR protein was diluted 1:10 in 50 mM HEPES pH 7.5, 50 mM NaCl, 1 mM TCEP and then loaded onto a 5 ml pre-packed QHP column (GE Healthcare). Isolation of fully phosphorylated IRE1α KR was achieved by eluting the protein with a very shallow gradient (50–300 mM NaCl over 70 CV). Fully phosphorylated fraction was collected separately and confirmed (MW +240) by LC-MS.

RNA cleavage assay

1 μg of T7 RNA generated was digested at room temperature by 1 μg of human IRE-1α KR recombinant protein (~0.8 μM) for 15 min in RNA cleavage buffer (HEPES pH 7.5 20 mM; potassium acetate 50 mM; magnesium acetate 1 mM; TritonX-100 0.05% [v/v]). The total volume of the reaction is 25 μl. The digestion was then complemented by an equal volume of formamide and heated up at 70°C for 10 min to linearize the RNA. After linearization, the mixture was immediately placed on ice for 5 min, and then 20 μl was run on 3% agarose gel at 160 V for 50 min. If inhibitor was used, it was incubated with IRE-1α KR for 40 min on ice prior to RNA digestion. Gels were visualized on either a Bio-Rad Molecular Imager ChemiDoc ZRS+. The T7 RNA transcripts was generated from templates containing a wild-type flp-6 hairpin consensus (atCaGCgtat) or scrambled sequence replacing the original hairpin consensus (ggattacgta) templates of flp-6. cDNA was amplified, adding T7 sequence to forward (T7-FLP6-f) and BGH sequence to reverse (BGH-FLP6-r) primers, and subsequently in vitro transcribed using HiScribe T7 Quick High Yield RNA Synthesis Kit from NEB (#E2050S). The IRE-1 RNase-specific inhibitor 4μ8c was used at 5 μM.

T7-FLP6-f TAATACGACTCACTATAGGGCGGCCGGATGAACTCTCGTGGGTTGA
BGH-FLP6-r TAGAAGGCACAGTCGAGGTTATCGTCCGAATCTCATGTATGC

Molecular cloning

Pire-1::ire-1, Prgef-1::ire-1, Pdaf-7::ire-1, Pdaf-28::ire-1and Pmyo-3::ire-1 plasmids have been previously described (Levi-Ferber et al., 2014). Psrh-142::flp-6 has been previously described (Li et al., 2013).

Peat-4::ire-1, Punc-25::ire-1, Pche-12::ire-1 and Pdat-1::ire-1 plasmids have been generated as follows: the ire-1 coding sequence was amplified from cDNA and cloned into the NheI and KpnI sites in the L3691 plasmid. Genomic DNA-amplified promoters were inserted upstream of the ire-1 coding sequence (CDS) as follows: Peat-4 (∼3  kb), Punc-25 (∼1.6  kb), Pche-12 ( ~ 1 kb), and Pdat-1 (∼0.7  kb) were inserted in the SphI/NotI restriction sites. Pges-1 (∼3  kb) was inserted in the SphI/KpnI restriction sites.

To generate Pche-1::flp-6, the flp-6 coding sequence was amplified from cDNA and cloned into the XmaI and KpnI sites in the Andy-Fire L3691 vector. Pche-1 (ASE specific, ~1.4 kb) promoter was cloned into NotI and XmaI sites upstream to flp-6 cDNA, replacing the original mec-7 promoter.

To generate Pttx-3::cha-1 and Pttx-3::unc-17, the cha-1 coding sequence and the unc-17 coding sequence were amplified from cDNA and cloned into the KpnI/SphI sites downstream of the Pttx-3promB regulatory element in the Pttx-3::ire-1 vector, previously described (Levi-Ferber et al., 2014), replacing the ire-1 coding sequence.

Germline transformations were performed by injection of 25 ng/ml plasmids and 100 ng/ml of rol-6(su1006) as a co-transformation marker.

Acknowledgements

Some nematode strains were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources and by Dr. Shohei Mitani, National Bioresource Project for the nematode, Tokyo Women’s Medical University School of Medicine, Japan. We thank Prof. Cori Bargmann (Rockefeller University, USA) for the HisCl-related strains as well as for the Cre-Lox-specific knockouts of tph-1. We thank Prof. Kang Shen (Stanford University, USA) for IRE-1 structure function strains (wy782, wy762). We thank Prof. Hannes E Bulow (Albert Einstein College of Medicine, USA) for helpful discussions. We thank Prof. Dayong Wang (Southeast University, China) for the flp-6 rescue in ADF construct (Psrh-142::flp-6). We thank Prof. Chris Li (The City College of New York, USA) for flp-4(yn35) mutant strain. This work was supported by the Israel Science Foundation (grant number 1571/15 to SHK). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Caenorhabditiselegans) N2 Caenorhabditis Genetics Center Wild type
Strain, strain background (C. elegans) SHK124 This paper rrf-1(pk1417) I x4 outcrosses, strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) CF2473 Cynthia Kenyon lab ire-1(ok799) II x3 outcrosses, strain created in C. Kenyon lab
Strain, strain background (C. elegans) SHK27 Levi-Ferber et al., 2015 PMID:25340700 ire-1(ok799) II; biuEx2[pRF4(rol-6(su1006)); Pire-1::ire-1(cDNA)]; svls69[Pdaf-28::daf-28::gfp] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK185 Levi-Ferber et al., 2014 PMID:25340700 ire-1(ok799) II; biuEx49[pRF4(rol-6(su1006)); Prgef-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK14 Levi-Ferber et al., 2014 PMID:25340700 ire-1(ok799) II; biuEx5[pRF4(rol-6(su1006)); Pmyo-3::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK703 This paper ire-1(ok799) II wdIs52 [F49H12.4::GFP + unc-119(+)]; biuEx50[pRF4(rol-6(su1006)); Pges-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK4 Levi-Ferber et al., 2014 PMID:25340700 biuEx2[pRF4(rol-6(su1006)); Pire-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK182 Levi-Ferber et al., 2014 PMID:25340700 biuEx49[pRF4(rol-6(su1006)); Prgef-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK8 Levi-Ferber et al., 2014 PMID:25340700 biuEx5[pRF4(rol-6(su1006)); Pmyo-3::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK282 This paper biuEx50[pRF4(rol-6(su1006)); Pges-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK268 This paper ire-1(ok799) II; biuEx11[Pgrd-10::gfp; Pche-12::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK271 This paper ire-1(ok799) II; biuEx14[Pgrd-10::gfp; Peat-4::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK270 This paper ire-1(ok799) II; biuEx13[Pgrd-10::gfp; Pdat-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK266 This paper ire-1(ok799) II; biuEx10[Pgrd-10::gfp; Punc-25::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK15 Levi-Ferber et al., 2014 PMID:25340700 ire-1(ok799) II; biuEx4[pRF4(rol-6(su1006)); Pdaf-28::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK256 This paper ire-1(ok799) II; biuEx51[pRF4(rol-6(su1006)); Pdaf-7::gfp; Pdaf-7::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK592 This paper ire-1(ok799) II; biuEx57[pRF4(rol-6(su1006)); Pche-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK593 This paper ire-1(ok799) II; biuEx58[pRF4(rol-6(su1006)); Pops-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) OH10434 Caenorhabditis Genetics Center otls232 [che-1p::mcherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]
Strain, strain background (C. elegans) DA572 Caenorhabditis Genetics Center eat-4(ad572)
Strain, strain background (C. elegans) MT6308 Caenorhabditis Genetics Center eat-4(ky5)
Strain, strain background (C. elegans) NY119 Chris Li lab flp-4(yn35) II
Strain, strain background (C. elegans) VC2324 Caenorhabditis Genetics Center flp-6(ok3056) V
Strain, strain background (C. elegans) FX02427 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan flp-13(tm2427) IV
Strain, strain background (C. elegans) PT505 Caenorhabditis Genetics Center flp-20(pk1596) X
Strain, strain background (C. elegans) VC1982 Caenorhabditis Genetics Center flp-25(gk1016) III
Strain, strain background (C. elegans) FX03023 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan nlp-3(tm3023) X
Strain, strain background (C. elegans) RB1609 Caenorhabditis Genetics Center nlp-5(ok1981) II
Strain, strain background (C. elegans) FX1880 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan nlp-14(tm1880) X
Strain, strain background (C. elegans) FX1888 Caenorhabditis Genetics Center ins-1(tm1888) IV
Strain, strain background (C. elegans) RB2594 Caenorhabditis Genetics Center ins-22(ok3616) III
Strain, strain background (C. elegans) FX14756 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan ins-26(tm1983) I
Strain, strain background (C. elegans) FX06109 Caenorhabditis Genetics Center ins-32(tm6109) II
Strain, strain background (C. elegans) RB982 Caenorhabditis Genetics Center flp-21(ok889) V
Strain, strain background (C. elegans) RB1340 Caenorhabditis Genetics Center nlp-1(ok1469) X
Strain, strain background (C. elegans) FX02984 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan nlp-7(tm2984) X
Strain, strain background (C. elegans) VC1309 Caenorhabditis Genetics Center nlp-8(ok1799) I
Strain, strain background (C. elegans) FX06232 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan nlp-10(tm6232) III
Strain, strain background (C. elegans) VC1063 Caenorhabditis Genetics Center nlp-15(ok1512) I
Strain, strain background (C. elegans) SHK497 This paper biuEx52[pRF4(rol-6(su1006)); Pche-1::flp-6(cDNA)]; flp-6(ok3056) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK498 This paper biuEx53[pRF4(rol-6(su1006)); Psrh-142::flp-6]; flp-6(ok3056) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) PR672 Caenorhabditis Genetics Center che-1(p672) I
Strain, strain background (C. elegans) PR674 Caenorhabditis Genetics Center che-1(p674) I
Strain, strain background (C. elegans) MT633 Caenorhabditis Genetics Center lin-11(n389) I; him-5(e1467)V
Strain, strain background (C. elegans) MT1196 Caenorhabditis Genetics Center lin-11(n566) I
Strain, strain background (C. elegans) CF2260 Cynthia Kenyon lab Zcls4[Phsp-4::gfp] V
Strain, strain background (C. elegans) SHK314 This paper Zcls4[Phsp-4::gfp] V; flp-6(ok3056) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK315 This paper ire-1(ok799) II, flp-6(ok3056) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) NY2067 Caenorhabditis Genetics Center ynIs67[Pflp-6::gfp] III; him-5(e1490) V
Strain, strain background (C. elegans) SHK403 This paper ynIs67[Pflp-6::gfp] III; ire-1(ok799) II Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK474 This paper biuEx54[pRF4(rol-6(su1006)); Pche-1::flp-6(cDNA)::gfp] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK491 This paper biuEx52[pRF4(rol-6(su1006)); Pche-1::flp-6(cDNA)]; ire-1(ok799) II Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) TV13656 Kang Shen lab ire-1(wy782) II
Strain, strain background (C. elegans) TV13763 Kang Shen lab ire-1(wy762) II
Strain, strain background (C. elegans) NY7 Caenorhabditis Genetics Center flp-1(yn2) IV
Strain, strain background (C. elegans) NY16 Caenorhabditis Genetics Center flp-1(yn4) IV
Strain, strain background (C. elegans) AX1410 Caenorhabditis Genetics Center flp-8(db99) X
Strain, strain background (C. elegans) VC2016 Caenorhabditis Genetics Center flp-18(gk3063) X
Strain, strain background (C. elegans) PR1152 Caenorhabditis Genetics Center cha-1(p1152) IV
Strain, strain background (C. elegans) SHK605 This paper biuEx55[pRF4(rol-6(su1006)); Pttx-3::cha-1]; cha-1(p1152) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) GG201 Caenorhabditis Genetics Center ace-2(g72) I; ace-1(p1000) X
Strain, strain background (C. elegans) PR1300 Caenorhabditis Genetics Center ace-3(dc2) II
Strain, strain background (C. elegans) CB113 Caenorhabditis Genetics Center unc-17(e113) IV
Strain, strain background (C. elegans) SHK586 This paper biuEx56[pRF4(rol-6(su1006)); Pttx-3::unc-17]; unc-17(e113) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) MT9668 Caenorhabditis Genetics Center mod-1(ok103) V
Strain, strain background (C. elegans) DA1814 Caenorhabditis Genetics Center ser-1(ok345) X
Strain, strain background (C. elegans) AQ866 Caenorhabditis Genetics Center ser-4 (ok512) III
Strain, strain background (C. elegans) RB1585 Caenorhabditis Genetics Center ser-7(ok1944) X
Strain, strain background (C. elegans) MT1446 Caenorhabditis Genetics Center her-1(n695) V
Strain, strain background (C. elegans) MT5825 Caenorhabditis Genetics Center sem-4(n1378) I
Strain, strain background (C. elegans) MT3969 Caenorhabditis Genetics Center mig-1(n1652) I
Strain, strain background (C. elegans) NF69 Caenorhabditis Genetics Center mig-19(k142) II
Strain, strain background (C. elegans) NF78 Caenorhabditis Genetics Center mig-20(k148) X
Strain, strain background (C. elegans) SHK492 This paper flp-6(ok3056) V; sem-4(n1378) I Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK490 This paper flp-6(ok3056) V; her-1(n695) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) FX30280 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan flp-5(tm10075) X
Strain, strain background (C. elegans) LC33 Dr. Shohei Mitani, National Bioresource Project for the nematode, Japan bas-1(tm351) III
Strain, strain background (C. elegans) CX13228 Cori Bargman Lab tph-1(mg280) II; kySi56[ tph-1 genomic rescue] IV Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX13576 Cori Bargman Lab tph-1(mg280) II; kySi56[ tph-1 genomic rescue] IV; kyEx4107[egl6::nCre] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX13571 Cori Bargman Lab tph-1(mg280) II; kySi56[ tph-1 genomic rescue] IV; kyEx4077[srh142::nCre] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX13574 Cori Bargman Lab tph-1(mg280) II; kySi56[ tph-1 genomic rescue] IV; kyEx4081[ops1::nCre] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX14909 Cori Bargman Lab kyEx4925 [ttx-3::hisCl1*::sl2::GFP; myo-3::mCherry] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX14849 Cori Bargman Lab kyEx4867 [ins-1::HisCl1::sl2mCherry; unc-122::GFP] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX14908 Cori Bargman Lab kyEx4924 [inx1::hisCl1*::sl2::GFP; myo-3::mCherry] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) CX16069 Cori Bargman Lab kyEx5493 [pNP443 (glr3::HisCl1::SL2::mCherry); elt-2:mCherry] Strain created in C. Bargman Lab
Strain, strain background (C. elegans) DP132 Caenorhabditis Genetics Center edIs6 (punc-119::GFP) IV
Strain, strain background (C. elegans) SHK659 This paper che-1(p679) I; edIs6 (punc-119::GFP) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK361 This paper edIs6 (punc-119::GFP) IV; flp-6(ok3056) V Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK660 This paper cha-1(p1152) edIs6 (punc-119::GFP) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK661 This paper sem-4(n1378) I; edIs6 (punc-119::GFP) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK662 This paper tph-1(mg280) II; edls6 (punc-119::GFP) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK663 This paper Zcls4[Phsp-4::gfp] V; otls232 [che-1p::mcherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]
Strain, strain background (C. elegans) CF3208 Cynthia Kenyon lab xbp-1(tm2457) III X4 outcrosses
Strain, strain background (C. elegans) SHK62 Levi-Ferber et al., 2014 PMID:25340700 xbp-1(tm2457) III; ire-1(ok799) II Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK152 Levi-Ferber et al., 2015 PMID:26192965 edIs6 (punc-119::GFP) IV; ced-3(n1286) IV Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK86 Levi-Ferber et al., 2015 PMID:26192965 Pmyo-3::GFP; ced-3(n1286) Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK697 This paper flp-6(biu100) Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK698 This paper ire-1(ok799) II; otls232 [che-1p::mcherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK699 This paper edIs6 (punc-119::GFP) IV; ced-3(n1286) IV; biuEx49[pRF4(rol-6(su1006)); Prgef-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Strain, strain background (C. elegans) SHK584 This paper biuEx57[pRF4(rol-6(su1006)); Pche-1::ire-1(cDNA)] Strain created in S. Henis-Korenblit lab
Sequence-based reagent act-1 Fw Cohen-Berkman et al., 2020 PMID:32213289 qPCR primer CCAATCCAAGAGAGGTATCCTTAC
Sequence-based reagent act-1 Bw Cohen-Berkman et al., 2020 PMID:32213289 qPCR primer CATTGTAGAAGGTGTGATGCCAG
Sequence-based reagent flp-6 Fw This paper qPCR primer GTGAAGTGGAGAGAGAAATGATGA
Sequence-based reagent flp-6 Bw This paper qPCR primer CCGCTACTTCTCTTTCCAAAACG
Chemical compound, drug TRIzol Ambion 15596026
Chemical compound, drug Maxima SYBR GREEN Thermo Scientific K0221
Chemical compound, drug IPTG Gold Bio I2481C
Chemical compound, drug DAPI Sigma D9542
Chemical compound, drug Serotonine creatinine sulfate monohydrate Sigma H7752
Chemical compound, drug Histamine dihydrochloride Sigma H7250
Chemical compound, drug Levamisol hydrochloride Sigma 31742
Chemical compound, drug Tunicamycin Cayman 11445
Other CFX-96 real time system Bio-Rad

Software, algorithm SPSS SPSS

Software, algorithm R statistical environment R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/.
RRID:SCR_001905
Sequence-based reagent tracrRNA IDT

Sequence-based reagent cas9 enzyme IDT

Sequence-based reagent dpy-10 crRNA IDT
GCTACCATAGGCACCACGAG
Sequence-based reagent flp-6 crRNA IDT
AAATCAGCGTATATGCGTTT
Sequence-based reagent dpy-10 ssODN IDT
CACTTGAACTTCAATACGGCAA GATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT
Sequence-based reagent flp-6 (biu100) ssODN IDT
tcaaaaatatgttttgcagAAATGATGAAGCGTAAgagcGCtTAcATGaGaTTCGGACGTTCTGACGGTGGAAACCCAATGGAAATGGAAA

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Sivan Henis-Korenblit, Email: sivan.korenblit@biu.ac.il.

Julie Hollien, University of Utah, United States.

David Ron, University of Cambridge, United Kingdom.

Funding Information

This paper was supported by the following grant:

  • Israel Science Foundation 1571/15 to Sivan Henis-Korenblit.

Additional information

Competing interests

none.

Adrien Le-Thomas is affiliated with Genentech. The author has no other competing interests to declare.

None.

Avi Ashkenazi is affiliated with Genentech. The author has no other competing interests to declare.

Author contributions

Conceptualization, Formal analysis, Investigation, Methodology, Visualization, Writing - original draft.

Investigation.

Investigation, Visualization.

Investigation.

Investigation.

statistical analysis and data presentation.

Investigation, Methodology, Writing – review and editing.

Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Writing - original draft.

Additional files

Supplementary file 1. List of sensory neurons included under the che-1 promoter.
elife-65644-supp1.xlsx (11.1KB, xlsx)
Supplementary file 2. Statistical data.
elife-65644-supp2.xlsx (29.6KB, xlsx)
Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript.

References

  1. Altun-Gultekin Z, Andachi Y, Tsalik EL, Pilgrim D, Kohara Y, Hobert O. A regulatory cascade of three homeobox genes, CEH-10, ttx-3 and CEH-23, controls cell fate specification of a defined interneuron class in C. elegans. Development. 2001;128:1951–1969. doi: 10.1242/dev.128.11.1951. [DOI] [PubMed] [Google Scholar]
  2. Amon S, Gupta BP. Intron-specific patterns of divergence of lin-11 regulatory function in the C. elegans nervous system. Developmental Biology. 2017;424:90–103. doi: 10.1016/j.ydbio.2017.02.005. [DOI] [PubMed] [Google Scholar]
  3. Bargmann CI, Horvitz HR. Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron. 1991;7:729–742. doi: 10.1016/0896-6273(91)90276-6. [DOI] [PubMed] [Google Scholar]
  4. Biedermann B, Wright J, Senften M, Kalchhauser I, Sarathy G, Lee MH, Ciosk R. Translational repression of cyclin e prevents precocious mitosis and embryonic gene activation during C. elegans meiosis. Developmental Cell. 2009;17:355–364. doi: 10.1016/j.devcel.2009.08.003. [DOI] [PubMed] [Google Scholar]
  5. Boilly B, Faulkner S, Jobling P, Hondermarck H. Nerve dependence: From regeneration to cancer. Cancer Cell. 2017;31:342–354. doi: 10.1016/j.ccell.2017.02.005. [DOI] [PubMed] [Google Scholar]
  6. Byrd DT, Kimble J. Scratching the niche that controls Caenorhabditis elegans germline stem cells. Seminars in Cell & Developmental Biology. 2009;20:1107–1113. doi: 10.1016/j.semcdb.2009.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen BL, Hall DH, Chklovskii DB. Wiring optimization can relate neuronal structure and function. PNAS. 2006;103:4723–4728. doi: 10.1073/pnas.0506806103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Developmental Cell. 2016;39:209–223. doi: 10.1016/j.devcel.2016.08.021. [DOI] [PubMed] [Google Scholar]
  9. Ciosk R, DePalma M, Priess JR. Translational regulators maintain totipotency in the Caenorhabditis elegans germline. Science. 2006;311:851–853. doi: 10.1126/science.1122491. [DOI] [PubMed] [Google Scholar]
  10. Coelho DS, Domingos PM. Physiological roles of regulated ire1 dependent decay. Frontiers in Genetics. 2014;5:76. doi: 10.3389/fgene.2014.00076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cohen E, Chatzigeorgiou M, Husson SJ, Steuer-Costa W, Gottschalk A, Schafer WR, Treinin M. Caenorhabditis elegans nicotinic acetylcholine receptors are required for nociception. Molecular and Cellular Neurosciences. 2014;59:85–96. doi: 10.1016/j.mcn.2014.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cohen-Berkman M, Dudkevich R, Ben-Hamo S, Fishman A, Salzberg Y, Waldman Ben-Asher H, Lamm AT, Henis-Korenblit S. Endogenous Sirnas promote proteostasis and longevity in germline-less Caenorhabditis elegans. eLife. 2020;9:e50896. doi: 10.7554/eLife.50896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cross BCS, Bond PJ, Sadowski PG, Jha BK, Zak J, Goodman JM, Silverman RH, Neubert TA, Baxendale IR, Ron D, Harding HP. The molecular basis for selective inhibition of unconventional mrna splicing by an ire1-binding small molecule. PNAS. 2012;109:E869. doi: 10.1073/pnas.1115623109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dalfó D, Michaelson D, Hubbard EJA. Sensory regulation of the C. elegans germline through tgf-β-dependent signaling in the niche. Current Biology. 2012;22:712–719. doi: 10.1016/j.cub.2012.02.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ellis HM, Horvitz HR. Genetic control of programmed cell death in the nematode C. elegans. Cell. 1986;44:817–829. doi: 10.1016/0092-8674(86)90004-8. [DOI] [PubMed] [Google Scholar]
  16. Flavell SW, Pokala N, Macosko EZ, Albrecht DR, Larsch J, Bargmann CI. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell. 2013;154:1023–1035. doi: 10.1016/j.cell.2013.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gumienny TL, Lambie E, Hartwieg E, Horvitz HR, Hengartner MO. Genetic control of programmed cell death in the Caenorhabditis elegans hermaphrodite germline. Development. 1999;126:1011–1022. doi: 10.1242/dev.126.5.1011. [DOI] [PubMed] [Google Scholar]
  18. Guydosh NR, Kimmig P, Walter P, Green R. Regulated Ire1-dependent mRNA decay requires no-go mRNA degradation to maintain endoplasmic reticulum homeostasis in S. pombe. eLife. 2017;6:e29216. doi: 10.7554/eLife.29216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Harnoss JM, Le Thomas A, Shemorry A, Marsters SA, Lawrence DA, Lu M, Chen Y-CA, Qing J, Totpal K, Kan D, Segal E, Merchant M, Reichelt M, Ackerly Wallweber H, Wang W, Clark K, Kaufman S, Beresini MH, Laing ST, Sandoval W, Lorenzo M, Wu J, Ly J, De Bruyn T, Heidersbach A, Haley B, Gogineni A, Weimer RM, Lee D, Braun M-G, Rudolph J, VanWyngarden MJ, Sherbenou DW, Gomez-Bougie P, Amiot M, Acosta-Alvear D, Walter P, Ashkenazi A. Disruption of IRE1α through its kinase domain attenuates multiple myeloma. PNAS. 2019;116:16420–16429. doi: 10.1073/pnas.1906999116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hollien J, Weissman JS. Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science. 2006;313:104–107. doi: 10.1126/science.1129631. [DOI] [PubMed] [Google Scholar]
  21. Hollien J, Lin JH, Li H, Stevens N, Walter P, Weissman JS. Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. The Journal of Cell Biology. 2009;186:323–331. doi: 10.1083/jcb.200903014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hooks KB, Griffiths-Jones S. Conserved RNA structures in the non-canonical Hac1/Xbp1 intron. RNA Biology. 2011;8:552–556. doi: 10.4161/rna.8.4.15396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Horvitz HR, Chalfie M, Trent C, Sulston JE, Evans PD. Serotonin and octopamine in the nematode Caenorhabditis elegans. Science. 1982;216:1012–1014. doi: 10.1126/science.6805073. [DOI] [PubMed] [Google Scholar]
  24. Hutchings C, Phillips JA, Djamgoz MBA. Nerve input to tumours: Pathophysiological consequences of a dynamic relationship. Biochimica et Biophysica Acta. Reviews on Cancer. 2020;1874:188411. doi: 10.1016/j.bbcan.2020.188411. [DOI] [PubMed] [Google Scholar]
  25. Kelly WG, Xu S, Montgomery MK, Fire A. Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics. 1997;146:227–238. doi: 10.1093/genetics/146.1.227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kim K, Li C. Expression and regulation of an fmrfamide-related neuropeptide gene family in Caenorhabditis elegans. The Journal of Comparative Neurology. 2004;475:540–550. doi: 10.1002/cne.20189. [DOI] [PubMed] [Google Scholar]
  27. Kimata Y, Ishiwata-Kimata Y, Ito T, Hirata A, Suzuki T, Oikawa D, Takeuchi M, Kohno K. Two regulatory steps of ER-stress sensor Ire1 involving its cluster formation and interaction with unfolded proteins. The Journal of Cell Biology. 2007;179:75–86. doi: 10.1083/jcb.200704166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kimmig P, Diaz M, Zheng J, Williams CC, Lang A, Aragón T, Li H, Walter P. The unfolded protein response in fission yeast modulates stability of select mRNAs to maintain protein homeostasis. eLife. 2012;1:e00048. doi: 10.7554/eLife.00048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kumsta C, Hansen M. C. elegans rrf-1 mutations maintain RNAi efficiency in the soma in addition to the germline. PLOS ONE. 2012;7:e35428. doi: 10.1371/journal.pone.0035428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kuwabara PE. The multifaceted C. elegans major sperm protein: An ephrin signaling antagonist in oocyte maturation. Genes & Development. 2003;17:155–161. doi: 10.1101/gad.1061103. [DOI] [PubMed] [Google Scholar]
  31. Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S. It’s all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans. PLOS Genetics. 2014;10:e1004747. doi: 10.1371/journal.pgen.1004747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Levi-Ferber M, Gian H, Dudkevich R, Henis-Korenblit S. Transdifferentiation mediated tumor suppression by the endoplasmic reticulum stress sensor ire-1 in C. elegans. eLife. 2015;4:e08005. doi: 10.7554/eLife.08005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Li C, Nelson LS, Kim K, Nathoo A, Hart AC. Neuropeptide gene families in the nematode Caenorhabditis elegans. Annals of the New York Academy of Sciences. 1999;897:239–252. doi: 10.1111/j.1749-6632.1999.tb07895.x. [DOI] [PubMed] [Google Scholar]
  34. Li H, Korennykh AV, Behrman SL, Walter P. Mammalian endoplasmic reticulum stress sensor ire1 signals by dynamic clustering. PNAS. 2010;107:16113–16118. doi: 10.1073/pnas.1010580107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li Y, Zhao Y, Huang X, Lin X, Guo Y, Wang D, Li C, Wang D. Serotonin control of thermotaxis memory behavior in nematode Caenorhabditis elegans. PLOS ONE. 2013;8:e77779. doi: 10.1371/journal.pone.0077779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li C, Kim K. Family of FLP peptides in Caenorhabditis elegans and related nematodes. Frontiers in Endocrinology. 2014;5:150. doi: 10.3389/fendo.2014.00150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lu M, Lawrence DA, Marsters S, Acosta-Alvear D, Kimmig P, Mendez AS, Paton AW, Paton JC, Walter P, Ashkenazi A. Opposing unfolded-protein-response signals converge on death receptor 5 to control apoptosis. Science. 2014;345:98–101. doi: 10.1126/science.1254312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Maurel M, Chevet E, Tavernier J, Gerlo S. Getting ridd of RNA: Ire1 in cell fate regulation. Trends in Biochemical Sciences. 2014;39:245–254. doi: 10.1016/j.tibs.2014.02.008. [DOI] [PubMed] [Google Scholar]
  39. McKnight K, Hoang HD, Prasain JK, Brown N, Vibbert J, Hollister KA, Moore R, Ragains JR, Reese J, Miller MA. Neurosensory perception of environmental cues modulates sperm motility critical for fertilization. Science. 2014;344:754–757. doi: 10.1126/science.1250598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RH, Sternberg PW. Participation of the protein go in multiple aspects of behavior in C. elegans. Science. 1995;267:1652–1655. doi: 10.1126/science.7886455. [DOI] [PubMed] [Google Scholar]
  41. Moore K, Hollien J. Ire1-mediated decay in mammalian cells relies on mrna sequence, structure, and translational status. Molecular Biology of the Cell. 2015;26:2873–2884. doi: 10.1091/mbc.E15-02-0074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Niacaris T, Avery L. Serotonin regulates repolarization of the C. elegans pharyngeal muscle. The Journal of Experimental Biology. 2003;206:223–231. doi: 10.1242/jeb.00101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ohlstein B, Kai T, Decotto E, Spradling A. The stem cell niche: Theme and variations. Current Opinion in Cell Biology. 2004;16:693–699. doi: 10.1016/j.ceb.2004.09.003. [DOI] [PubMed] [Google Scholar]
  44. Oikawa D, Tokuda M, Hosoda A, Iwawaki T. Identification of a consensus element recognized and cleaved by ire1 alpha. Nucleic Acids Research. 2010;38:6265–6273. doi: 10.1093/nar/gkq452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Paix A, Folkmann A, Rasoloson D, Seydoux G. High efficiency, homology-directed genome editing in Caenorhabditis elegans using crispr-cas9 ribonucleoprotein complexes. Genetics. 2015;201:47–54. doi: 10.1534/genetics.115.179382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Peschek J, Acosta-Alvear D, Mendez AS, Walter P. A conformational RNA zipper promotes intron ejection during non-conventional xbp1 mrna splicing. EMBO Reports. 2015;16:1688–1698. doi: 10.15252/embr.201540955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Pokala N, Liu Q, Gordus A, Bargmann CI. Inducible and titratable silencing of Caenorhabditis elegans neurons in vivo with histamine-gated chloride channels. PNAS. 2014;111:2770–2775. doi: 10.1073/pnas.1400615111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Reuter JS, Mathews DH. Rnastructure: Software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 2010;11:129. doi: 10.1186/1471-2105-11-129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Rogers CM, Franks CJ, Walker RJ, Burke JF, Holden-Dye L. Regulation of the pharynx of Caenorhabditis elegans by 5-ht, octopamine, and fmrfamide-like neuropeptides. Journal of Neurobiology. 2001;49:235–244. doi: 10.1002/neu.1078. [DOI] [PubMed] [Google Scholar]
  50. Safra M, Ben-Hamo S, Kenyon C, Henis-Korenblit S. The ire-1 ER stress-response pathway is required for normal secretory-protein metabolism in C. elegans. Journal of Cell Science. 2013;126:4136–4146. doi: 10.1242/jcs.123000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Salzberg Y, Coleman AJ, Celestrin K, Cohen-Berkman M, Biederer T, Henis-Korenblit S, Bülow HE. Reduced Insulin/Insulin-Like Growth Factor Receptor Signaling Mitigates Defective Dendrite Morphogenesis in Mutants of the ER Stress Sensor IRE-1. PLOS Genetics. 2017;13:e1006579. doi: 10.1371/journal.pgen.1006579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sarin S, O’Meara MM, Flowers EB, Antonio C, Poole RJ, Didiano D, Johnston RJ, Chang S, Narula S, Hobert O. Genetic screens for Caenorhabditis elegans mutants defective in left/right asymmetric neuronal fate specification. Genetics. 2007;176:2109–2130. doi: 10.1534/genetics.107.075648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sarrouilhe D, Mesnil M. Serotonin and human cancer: A critical view. Biochimie. 2019;161:46–50. doi: 10.1016/j.biochi.2018.06.016. [DOI] [PubMed] [Google Scholar]
  54. Sawin ER, Ranganathan R, Horvitz HR. C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway. Neuron. 2000;26:619–631. doi: 10.1016/s0896-6273(00)81199-x. [DOI] [PubMed] [Google Scholar]
  55. Schlesinger S, Meshorer E. Open Chromatin, Epigenetic Plasticity, and Nuclear Organization in Pluripotency. Developmental Cell. 2019;48:135–150. doi: 10.1016/j.devcel.2019.01.003. [DOI] [PubMed] [Google Scholar]
  56. Ségalat L, Elkes DA, Kaplan JM. Modulation of serotonin-controlled behaviors by Go in Caenorhabditis elegans. Science. 1995;267:1648–1651. doi: 10.1126/science.7886454. [DOI] [PubMed] [Google Scholar]
  57. Seydoux G, Braun RE. Pathway to totipotency: Lessons from germ cells. Cell. 2006;127:891–904. doi: 10.1016/j.cell.2006.11.016. [DOI] [PubMed] [Google Scholar]
  58. Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y. The insulin/pi 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron. 2006;51:613–625. doi: 10.1016/j.neuron.2006.07.024. [DOI] [PubMed] [Google Scholar]
  59. Tursun B, Patel T, Kratsios P, Hobert O. Direct conversion of C. elegans germ cells into specific neuron types. Science. 2011;331:304–308. doi: 10.1126/science.1199082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Ulbright TM. Germ cell Tumors of the gonads: A selective review emphasizing problems in differential diagnosis, newly appreciated, and controversial issues. Modern Pathology. 2005;18 Suppl 2:S61. doi: 10.1038/modpathol.3800310. [DOI] [PubMed] [Google Scholar]
  61. Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, Ron D. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase ire1. Science. 2000;287:664–666. doi: 10.1126/science.287.5453.664. [DOI] [PubMed] [Google Scholar]
  62. Waggoner LE, Zhou GT, Schafer RW, Schafer WR. Control of alternative behavioral states by serotonin in Caenorhabditis elegans. Neuron. 1998;21:203–214. doi: 10.1016/s0896-6273(00)80527-9. [DOI] [PubMed] [Google Scholar]
  63. Walter P, Ron D. The unfolded protein response: From stress pathway to homeostatic regulation. Science. 2011;334:1081–1086. doi: 10.1126/science.1209038. [DOI] [PubMed] [Google Scholar]
  64. Wei X, Howell AS, Dong X, Taylor CA, Cooper RC, Zhang J, Zou W, Sherwood DR, Shen K. The unfolded protein response is required for dendrite morphogenesis. eLife. 2015;4:e06963. doi: 10.7554/eLife.06963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Weinshenker D, Garriga G, Thomas JH. Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans. The Journal of Neuroscience. 1995;15:6975–6985. doi: 10.1523/JNEUROSCI.15-10-06975.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Witte K, Schuh AL, Hegermann J, Sarkeshik A, Mayers JR, Schwarze K, Yates JR, Eimer S, Audhya A. TFG-1 function in protein secretion and oncogenesis. Nature Cell Biology. 2011;13:550–558. doi: 10.1038/ncb2225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Wright JE, Ciosk R. RNA-based regulation of pluripotency. Trends in Genetics. 2013;29:99–107. doi: 10.1016/j.tig.2012.10.007. [DOI] [PubMed] [Google Scholar]
  68. Yoneda T, Imaizumi K, Oono K, Yui D, Gomi F, Katayama T, Tohyama M. Activation of caspase-12, an endoplastic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. The Journal of Biological Chemistry. 2001;276:13935–13940. doi: 10.1074/jbc.M010677200. [DOI] [PubMed] [Google Scholar]
  69. Zhu H, Duerr JS, Varoqui H, McManus JR, Rand JB, Erickson JD. Analysis of point mutants in the Caenorhabditis elegans vesicular acetylcholine transporter reveals domains involved in substrate translocation. The Journal of Biological Chemistry. 2001;276:41580–41587. doi: 10.1074/jbc.M103550200. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Julie Hollien1

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Acceptance summary:

This paper describes how the ER stress sensor Ire1 modulates the ability of C. elegans to maintain pluripotency in the germline. Surprisingly, Ire1 regulates ectopic differentiation of germline cells through the degradation of an mRNA substrate in the nervous system. The authors describe both the regulation of this novel substrate of Ire1 and the neural circuit that links Ire1 activity to gonad pluripotency.

Decision letter after peer review:

Thank you for submitting your article "Neuronal regulated Ire1-dependent mRNA decay controls germline differentiation in C. elegans" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen David Ron as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential Revisions:

1. As pointed out by reviewer 3 below, is unclear whether all of the effects resulting in abnormal nuclei (as visualized by DAPI staining) are a result of ectopic differentiation. The authors should repeat the key experiments underlying the main findings regarding neuronal control of GED, and examine differentiation markers in the gonad.

2. The reviewers agreed that more evidence is needed to demonstrate that flp6 is a target of RIDD. The suggestions for experiments to support this conclusion are as follows: (a) measure flp6 RNA levels upon inducing ER stress, and when Ire1 is expressed in ASE, with the prediction that flp6 RNA levels should decrease; (b) if possible (given potential difficulties with the Xbp1 mutants), demonstrate that flp6 RNA degradation is independent of Xbp; (c) indicate whether the in vitro cleavage assay results in cleavage at the putative cleavage site described by the authors, and test whether mutation of this site prevents degradation of the flip6 RNA in vitro and in vivo.

3. The authors should test the specificity of serotonin for the ASE-AIY-HSN-germline circuit. Can the effects of tgf-1 RNAi on GED also be blocked by serotonin? Does serotonin interfere with the mex-3 RNAi GED phenotype?

4. Given the potential therapeutic aspect of this work and the previous findings that Ire1 activation allows animals with tumors to live longer, the authors should test how the flp6 mutant affects survival and/or paralysis in gld-1-RNAi treated animals.

Reviewer #1 (Recommendations for the authors):

My main suggestion for an aspect of this paper that could be strengthened is included in my public review. To address this, I would suggest that the authors determine whether flp6 degraded when Ire1 is specifically expressed in the ASE as in figure 3H.

A second suggestion is about the in vitro assay. The authors also show an experiment where Ire1 appears to cleave the FLP6 RNA in Figure 3D. To further support that this is a specific cleavage event, it would be nice to know if the sizes of the cleavage products in Figure 3D are consistent with cleavage at the stem loop structure described by the authors. Even more conclusive would be if the authors showed that mutating the critical nucleotide(s) in the cleavage sites prevented cleavage, or that a second RNA without such a site is not cleaved in this assay.

Reviewer #2 (Recommendations for the authors):

1. A central point of the article is to show for the first time a RIDD target in C. elegans. Although their findings are consistent with this conclusion, more evidence is required to firmly establish flp-6 as a RIDD target. Measuring the levels of flp-6 in other ER stress conditions, such as tunicamycin treatment, would help to build a convincing case that flp-6 is a genuine RIDD target. The authors establish that flp-6 can act as a direct target of the IRE-1 endoribonuclease in vitro, but not that it is actually a direct target in vivo; mutating the predicted stem loop structure and demonstrating an inhibition of flp-6 loss and downstream effects on GED would solidify the authors argument. It is also important to exclude any potential role of the XBP-1-mediated UPR in flp-6 loss, by measuring flp-6 levels in xbp-1(-) mutants – although this might be a difficult result to interpret as previous author data indicates that xbp-1(-) mutants already display a basal increase in the ER stress levels (Safra M et al., 2013; Levi-Ferber M et al., 2015). Also, in addition to RIDD and xbp-1 splicing, IRE-1 has other functions in the cell, such as regulating JNK/TRAF2 signaling. Authors should exclude (or at least discuss) any potential role of JNK/TRAF2 in the regulation of GED by IRE-1.

2. The authors did a fantastic job in mapping the neuronal circuits controlling GED. Testing whether the effects of tgf-1 RNAi on GED can also be blocked by serotonin would help to support the model proposed in Figure 6. In addition, checking whether serotonin interferes with the mex-3 RNAi GED phenotype would help demonstrate serotonin specificity for the ASE-AIY-HSN-germline circuit.

3. The authors emphasize in the discussion the potential therapeutic aspect of the work. In their previous paper, they were able to show that IRE-1 activation allows animals with tumors to live longer (Levi-Ferber et al., 2015). To further support the therapeutic aspect of this work, I suggest that the authors test the effects of flp-6 mutant in survival and/or paralysis in gld-1-RNAi treated animals.

Reviewer #3 (Recommendations for the authors):

Figure 1: The rrf-1(pk1417) I used, according to the publications cited by the authors, can undergo at least partial RNAi mediated knockdown in the intestine, and show elevated expression of, at least some, transgenic arrays. In addition, other artifacts of triple RNAi have not been excluded in the studies shown here.

The images are low resolution, and the germline looks largely disturbed and DAPI is used as a proxy for GED. While it is possible some of the cells are differentiating ectopically (vis-a-vie the authors' previous publication), that needs to be shown.

Authors should not use 'abnormal nuclei' interchangeably with GED (eg. nuclei in tph-1 mutants in Figure 5)

IRE-1 is supposed to be required for GED. However, Figure 1B, tgf-1 (RNAi); ire-1 (-) animals appear to have GED.

The effects of IRE-1 manipulation on ER stress needs to be carefully assayed using qRT-PCR, XBP-1 splicing etc., before one can conclude, as the authors do that " active IRE-1 signaling rather than ER stress" modulates GED. In this regard, it would be important for the authors to spell out what they mean by ER stress. Where? Which sensors etc.

Controls for o/e of ire-1 in each of the tissues alone should be shown.

Figure 2: Previous studies by other groups have shown that overexpressing spliced XBP-1 in neurons of C. elegans induced ER stress in other tissues (shown in intestine) through neurotransmitter release (unc-13 mechanism). Even though the authors believe that the phenomenon they are studying is XBP-1 independent, and dependent on IRE-1 RIDD activity, the use a mutant IRE-1 unable to splice XBP-1 would be the conclusive way to demonstrate this. In its absence, the observations could be due to IRE-1 induced XBP-1 splicing.

Figure 3: It is unclear why the ire-1(-) animals not show the same phenotype as flp-6 (-) animals? Without flp-6, GED is constitutive (in a gld-1, ced-3 background). Without ire-1 GED is inhibited (in same background). Yet in a flp-6; ire-1(-) strain GED is activated similar to flp-6 null-the reason for this is not clear.

How do authors reconcile ire-1 independence of GED in flp-6 mutants with an ire-1 dependent hsp-4::GFP is a transgene that is expressed mainly in intestine, and as such is an incomplete readout of ER stress. Therefore, its sole use to establish that flp-6(-) animals do not activate ER stress is not supported.

Neuronal expression of the Zcls4s has not been previously established. Images of expression that was quantified in ASE should therefore be shown.

Is the FLP-6 translational reporter expression levels restored in the wy762 mutant?

IRE-1 RIDD activity has not been demonstrated in C. elegans, and if FLP-6 is indeed an IRE-1 RIDD target, this would be exciting new advance in the field. Therefore these data while provocative, should be validated in independent ways. A convincing method to show IRE-1 RIDD activity would be to re-express an IRE-1 kinase domain only (or mutant without nuclease activity) to see if does not decrease expression of the flp-6 translational reporter. For instance, does is flp-6 lacking the stem loop also a RIDD substrate in the in vitro assays? What is the efficacy of flp-6 processing the RIDD reaction ? How well would known RIDD substrates be cleaved in this assay? If ER-UPR is activated in the FLP-6 translational reporter could be downregulated and explain the results.

eLife. 2021 Sep 3;10:e65644. doi: 10.7554/eLife.65644.sa2

Author response


Essential Revisions:

1. As pointed out by reviewer 3 below, is unclear whether all of the effects resulting in abnormal nuclei (as visualized by DAPI staining) are a result of ectopic differentiation. The authors should repeat the key experiments underlying the main findings regarding neuronal control of GED, and examine differentiation markers in the gonad.

To further demonstrate that the conditions resulting in accumulation of abnormal nuclei (as visualized by DAPI staining) in the gonads are a result of ectopic differentiation we added experiments demonstrating expression of somatic markers within the gonad, under similar conditions. Expression of a neuronal marker within the gonads of animals over-expressing ire-1 in their neurons is shown in Figure 1D. Expression of a neuronal and a muscle marker within the gonads of treated with flp-6 RNAi is shown in Figure 2F. Expression of a neuronal marker within the gonads of treated with tfg-1 RNAi is shown in Figure 5D, as well as its suppression by serotonin supplementation. Expression of a neuronal marker within the gonads of animals in which the ASE-AIY-HSN neuronal circuit has been impaired by altering the identity of ASE or ablating HSN is shown in Figure 6A. Figure 6A also demonstrates expression of a neuronal within the gonads upon disruption of the communication within the neuronal circuit by interfering with the production of the neuropeptide FLP-6 and of the neurotransmitters serotonin and Ach.

2. The reviewers agreed that more evidence is needed to demonstrate that flp6 is a target of RIDD. The suggestions for experiments to support this conclusion are as follows: (a) measure flp6 RNA levels upon inducing ER stress, and when Ire1 is expressed in ASE, with the prediction that flp6 RNA levels should decrease;

We now show by qRT-PCR that flp-6 RNA levels are reduced under different ER stress conditions. Figure 3B shows that flp-6 RNA levels are reduced by xbp-1 depletion, in an ire1-dependent manner. Note that xbp-1 and ire-1 deficiencies by themselves induce ER stress. Figure 3-supp 2A shows that flp-6 RNA levels are reduced upon ER stress induced by tfg-1 RNAi (in an ire-1-dependent manner). Note that tfg-1 RNAi induces ER stress. Figure 3C shows that flp-6 RNA levels are reduced by ire-1 overexpression in the ASE neuron (note that ire-1 overexpression is enough to drive its activation).

(b) if possible (given potential difficulties with the Xbp1 mutants), demonstrate that flp6 RNA degradation is independent of Xbp;

We now show in Figure 3B that flp-6 RNA levels are reduced in xbp-1 mutants, but not in ire-1; xbp-1 double mutants. Note that xbp-1 and ire-1 deficiencies by themselves induces ER stress, but only the xbp-1 deficiency destabilizes flp-6 RNA.

(c) indicate whether the in vitro cleavage assay results in cleavage at the putative cleavage site described by the authors, and test whether mutation of this site prevents degradation of the flip6 RNA in vitro and in vivo.

In-vitro: “Indeed, incubation of the flp-6 stem-loop RNA fragment with purified recombinant IRE-1 KR-3P generated clearly detectable cleavage products of the expected fragments (Figure 3E).” – Page 11. Furthermore introduction of a scrambled sequence instead of the sequence encoding the conserved loop motif diminished the in-vitro cleavage of the transcript by IRE1 in vitro (Figure 3 - sup3B).

In-vivo: We have also added experiments to show that ire-1's effects on GED are mediated primarily through FLP-6. This has been achieved by generating CRISPR-designed worms harboring silent mutations in the flp-6 gene that disrupt the sequence and structure of the predicted cleavage site while preserving the CDS. We find that this mutation stabilizes the flp-6 transcript under ER stress conditions and protects from ER stress-induced GED in otherwise WT animals.

3. The authors should test the specificity of serotonin for the ASE-AIY-HSN-germline circuit. Can the effects of tgf-1 RNAi on GED also be blocked by serotonin? Does serotonin interfere with the mex-3 RNAi GED phenotype?

We demonstrate the specificity of serotonin for the ASE-AIY-HSN-germline circuit-induced GED. We show that serotonin supplementation blocks the GED induction by flp-6 deficiency (Figure 5-supp2) or by tfg-1RNAi (i.e. ER stress) -induced GED (Figure 5D), but does not interfere with the mex-3 RNAi GED phenotype (Figure 5D).

4. Given the potential therapeutic aspect of this work and the previous findings that Ire1 activation allows animals with tumors to live longer, the authors should test how the flp6 mutant affects survival and/or paralysis in gld-1-RNAi treated animals.

Our previous work showed that IRE-1/ER stress-induced transdifferentiation of the tumorous germline in gld-1(-) animals limits the expansion of tumor. In Figure 6C,D we now show that flp-6 deficiency, which induces transdifferentiation of the tumorous germline, also improves survival and reduces paralysis in gld-1-RNAi treated tumorous animals.

Reviewer #1 (Recommendations for the authors):

My main suggestion for an aspect of this paper that could be strengthened is included in my public review. To address this, I would suggest that the authors determine whether flp6 degraded when Ire1 is specifically expressed in the ASE as in figure 3H.

We now show in Figure 3C that over-expression of an ire-1 transgene specifically in the ASE neuron under the che-1P reduces the levels of the flp-6 transcript as assessed by qRT-PCR.

A second suggestion is about the in vitro assay. The authors also show an experiment where Ire1 appears to cleave the FLP6 RNA in Figure 3D. To further support that this is a specific cleavage event, it would be nice to know if the sizes of the cleavage products in Figure 3D are consistent with cleavage at the stem loop structure described by the authors. Even more conclusive would be if the authors showed that mutating the critical nucleotide(s) in the cleavage sites prevented cleavage, or that a second RNA without such a site is not cleaved in this assay.

This is a great suggestion! Indeed, the sizes of the cleavage products in Figure 3E are consistent with cleavage at the predicted stem loop structure. Furthermore introduction of a scrambled sequence instead of the sequence encoding the conserved loop motif diminished the in-vitro cleavage of the transcript by IRE1 in vitro (Figure 3 – sup3B).

Reviewer #2 (Recommendations for the authors):

1. A central point of the article is to show for the first time a RIDD target in C. elegans. Although their findings are consistent with this conclusion, more evidence is required to firmly establish flp-6 as a RIDD target. Measuring the levels of flp-6 in other ER stress conditions, such as tunicamycin treatment, would help to build a convincing case that flp-6 is a genuine RIDD target.

flp-6 levels were reduced by several different ER stress conditions:

ire-1-dependent downregulation of the flp-6::gfp translational reporter upon tunicamycin treatment is shown in Figure 3D.

ire-1-dependent downregulation of the flp-6::gfp translational reporter upon induction of ER stress by tfg-1 RNAi treatment is now shown in (Figure 3-sup2C).

ire-1-dependent downregulation of the flp-6 RNA upon induction of ER stress by tfg-1 RNAi treatment is now shown in (Figure 3-sup2A).

ire-1-dependent downregulation of the flp-6 RNA upon induction of ER stress by xbp-1 deficiency is shown in (Figure 3B).

The authors establish that flp-6 can act as a direct target of the IRE-1 endoribonuclease in vitro, but not that it is actually a direct target in vivo; mutating the predicted stem loop structure and demonstrating an inhibition of flp-6 loss and downstream effects on GED would solidify the authors argument.

This is a great suggestion! As requested, we mutated the predicted stem loop structure (altering the RNA sequence using silent mutations that preserve the coding sequence). We confirmed that these mutations stabilize the flp-6 transcript under ER stress conditions (Figure 3F) and show that ER stress induced by tfg-1 RNAi does not induce GED in these flp-6 stem-loop mutants (Figure 3G and Figure 3 – supp3C).

It is also important to exclude any potential role of the XBP-1-mediated UPR in flp-6 loss, by measuring flp-6 levels in xbp-1(-) mutants – although this might be a difficult result to interpret as previous author data indicates that xbp-1(-) mutants already display a basal increase in the ER stress levels (Safra M et al., 2013; Levi-Ferber M et al., 2015).

We followed flp-6 transcript levels using qRT-PCR and found that they decrease in xbp-1(-) background, and that this decrease is dependent on ire-1 (Figure 3B).

Also, in addition to RIDD and xbp-1 splicing, IRE-1 has other functions in the cell, such as regulating JNK/TRAF2 signaling. Authors should exclude (or at least discuss) any potential role of JNK/TRAF2 in the regulation of GED by IRE-1.

We now note on page 18 of the discussion that:

“Whereas our findings clearly implicate RIDD in ER stress-induced GED, this study has not explored the possible implication of additional xbp-1-independent signaling pathways regulated by IRE-1 such as the JNK/TRAF2 pathway.”

2. The authors did a fantastic job in mapping the neuronal circuits controlling GED. Testing whether the effects of tgf-1 RNAi on GED can also be blocked by serotonin would help to support the model proposed in Figure 6. In addition, checking whether serotonin interferes with the mex-3 RNAi GED phenotype would help demonstrate serotonin specificity for the ASE-AIY-HSN-germline circuit.

This is a great suggestion! We now show in Figure 5D that serotonin supplementation indeed blocks both ER stress-induced GED and flp-6 deficiency-induced GED, but does not affect mex-3-induced GED. Thus serotonin seems to regulate GED specifically in the context of the ASE-AIY-HSN-germline circuit.

3. The authors emphasize in the discussion the potential therapeutic aspect of the work. In their previous paper, they were able to show that IRE-1 activation allows animals with tumors to live longer (Levi-Ferber et al., 2015). To further support the therapeutic aspect of this work, I suggest that the authors test the effects of flp-6 mutant in survival and/or paralysis in gld-1-RNAi treated animals.

Our previous work showed that IRE-1/ER stress-induced transdifferentiation of the tumorous germline in gld-1(-) animals limits the expansion of tumor. We now show that flp-6 deficiency, which also induces transdifferentiation of the tumorous germline, improves survival and reduces paralysis in gld-1-RNAi treated tumorous animals.

Reviewer #3 (Recommendations for the authors):

Figure 1: The rrf-1(pk1417) I used, according to the publications cited by the authors, can undergo at least partial RNAi mediated knockdown in the intestine, and show elevated expression of, at least some, transgenic arrays.

We state in the text on page 5 that:

“we used mutants in the rrf-1 gene, whose RNAi activity is compromised in most somatic tissues but whose germline RNAi activity is intact”.

Since we found that tfg-1 RNAi treatment failed to induce GED in the rrf-1 background, we can safely conclude that tfg-1 RNAi treatment in the germline (and in whatever somatic tissues that still partially respond to the RNAi treatment in this background) is not sufficient to induce GED. Hence a wider RNAi response is required for the induction of the GED phenotype. Had the result been that tfg-1 RNAi treatment was sufficient to induce GED – then it would have been important to further dissect whether the phenotype is due to RNAi responsiveness in the germline or in the weakly responding somatic tissues – however this was not the case.

The conclusion that the critical site of action of ER stress in this case is the soma and not the germline is further supported by a wide-range of IRE-1-rescue experiments demonstrating that rescue of IRE-1 expression in the soma/all neurons/sensory neurons/ASE are each sufficient to support ER stress-induced GED.

In addition, other artifacts of triple RNAi have not been excluded in the studies shown here.

The effectiveness of triple RNAi has been confirmed in several ways:

1) Experimentally – based on the phenotypes of the germline tumor (gld-1 RNAi), reduced animal size (tfg-1 RNAi) and lack of apoptosis (SYTO12 staining of ced-3 RNAi animals).

2) As shown in Figure 1 sup 2 in Levi-Ferber M et al., 2015, western blot has also confirmed the efficiency of the gld-1 RNAi treatment in the context of single/double/triple RNAi experiments.

3) Triple RNAi was used only in the beginning of the paper (Figure 1 and some of Figure 2). After that, the experiments were done in a less complex setting in which one of the RNAi treatments was omitted and/or replaced by mutations, giving similar results. Specifically, ced-3 RNAi was replaced by a ced-3(n1286) mutation in Figure 1D, Figure 1F, Figure 5D, Figure 6A. In many experiments (Figure 2E and onwards) the neuronal circuit was disrupted via various mutations and the animals were treated only with a mixture of ced-3 and gld-1 RNAi.

The images are low resolution, and the germline looks largely disturbed and DAPI is used as a proxy for GED.

Figure resolution may have dropped in the PDF format. Original figures of higher resolution are now attached. Note that the analysis is done at day 3-4 of adulthood. The germline at this time point is not as nice as in day1 animals. The issue of using DAPI as a proxy for GED has been addressed by adding experiments showing the expression of a neuronal marker in the gonad, and by referring to GED only after seeing this expression. Otherwise, we clarify that the aberrant DAPI-stained nuclei are only a proxy for GED.

While it is possible some of the cells are differentiating ectopically (vis-a-vie the authors' previous publication), that needs to be shown.

We have added experiments using somatic markers to confirm the induction of somatic cells in the gonads have been added:

Figure 1D shows neuronal cells filling the gonads upon neuronal over-expression of ire-1.

Figure 2F shows induction of neuronal and muscle cells within the gonad upon flp-6 RNAi treatment.

Figure 5D shows neuronal cells filling the gonads upon tfg-1, flp-6 or mex-3 RNAi treatment.

Figure 6 shows neuronal cells filling the gonads upon disruption of the ASE-AIY-HSN neuronal circuit using a variety of mutations (che-1, flp-6, cha-1, sem-4 and tph-1).

Authors should not use 'abnormal nuclei' interchangeably with GED (eg. nuclei in tph-1 mutants in Figure 5)

We are now careful to use the term 'abnormal nuclei' when referring to the DAPI staining results, and GED when referring to the more direct experiment using the neuronal marker to demonstrate the somatic nature of the observed cells.

IRE-1 is supposed to be required for GED. However, Figure 1B, tgf-1 (RNAi); ire-1 (-) animals appear to have GED.

It is correct that IRE-1 is supposed to be required for GED. In Figure 1B, tfg-1 (RNAi); ire-1 (-) animals do not have GED. It may have appeared so due to the high density of the tumorous germline in the gonad. We replaced the specific picture with a clearer one. As noted in the figure legend, we analyzed hundreds of ire-1(-) animals for this phenotype, and they do not display ER stress-induced GED.

The effects of IRE-1 manipulation on ER stress needs to be carefully assayed using qRT-PCR, XBP-1 splicing etc., before one can conclude, as the authors do that " active IRE-1 signaling rather than ER stress" modulates GED. In this regard, it would be important for the authors to spell out what they mean by ER stress. Where? Which sensors etc.

The statement that "active IRE-1 signaling rather than ER stress" modulates GED refers specifically to the experiments in which overexpression of IRE-1 was sufficient to induce GED. We now added a reference of our published work showing that overexpression of the ire-1 transgene in C. elegans drives its activation as assessed by the induction of xbp-1 splicing.

Controls for o/e of ire-1 in each of the tissues alone should be shown.

The tissue-specific expression of ire-1 in the different tissues has been achieved by driving its expression using commonly used tissue specific promoters (Prgef-1, Pmyo-3 and Pges-1). Relevance of specific neurons to GED induction has been further demonstrated using mutants that interfere with the identity/pattern of specific neurons, with the production of their communication molecules.

Figure 2: Previous studies by other groups have shown that overexpressing spliced XBP-1 in neurons of C. elegans induced ER stress in other tissues (shown in intestine) through neurotransmitter release (unc-13 mechanism). Even though the authors believe that the phenomenon they are studying is XBP-1 independent, and dependent on IRE-1 RIDD activity, the use a mutant IRE-1 unable to splice XBP-1 would be the conclusive way to demonstrate this. In its absence, the observations could be due to IRE-1 induced XBP-1 splicing.

This is an excellent suggestion, however there is no good way to manipulate ire-1 in C. elegans such that xbp-1 splicing is prevented while RIDD is preserved. Thus the only way to eliminate the role of xbp-1 in the ER-stress induced GED process is to conduct the experiments in xbp-1(-) animals. Indeed, in our 2015 eLife paper which is the basis for the current paper, we clearly demonstrate that ER-stress induced GED occurs independently of xbp-1. Thus, xbp-1 (spliced or unspliced) is not required for this phenomenon to occur.

Figure 3: It is unclear why the ire-1(-) animals not show the same phenotype as flp-6 (-) animals? Without flp-6, GED is constitutive (in a gld-1, ced-3 background). Without ire-1 GED is inhibited (in same background). Yet in a flp-6; ire-1(-) strain GED is activated similar to flp-6 null-the reason for this is not clear.

Our suggested model is that ire-1 promotes ER-stress induced GED by destabilizing the flp-6 transcript, which encodes a protein (FLP-6) that prevents GED. Thus, the consequence of ER stress is ire-1 activation and consequently flp-6 depletion (or at least reduction in flp-6 levels). In the absence of ire-1, flp-6 transcript levels remain high in spite of the ER stress (as there is no IRE-1 to perform RIDD) and therefore GED is inhibited. In the flp-6(-) background, there is no need for ire-1-mediated removal of flp-6 as there is no flp-6 to begin with, therefore GED cannot be prevented under these conditions (and it even does not require ER stress).

How do authors reconcile ire-1 independence of GED in flp-6 mutants with an ire-1 dependent hsp-4::GFP is a transgene that is expressed mainly in intestine, and as such is an incomplete readout of ER stress. Therefore, its sole use to establish that flp-6(-) animals do not activate ER stress is not supported.

The hsp-4::gfp transgene is widely accepted as a marker for activation of the ire-1/xbp-1 arm of the UPR. I agree that it is predominantly observed in the intestine and the spermatheca, however, we now specifically analyzed its expression is ASE (where it is expressed, although not the main site of expression). We focused on ASE since our data indicate that it is the cell in which ire-1 is required to promote ER stress-induced GED.

We agree that while the lack of hsp-4 induction is consistent with the idea that the IRE-1/XBP-1 arm of the UPR is not hyperactivated in these animals, it could be that it is an irrelevant marker for ER stress in this case. That is why we also asked if the observed GED in flp-6(-) animals is ire-1 dependent. The idea was that if flp-6 deficiency induces ER stress which then leads to GED, then GED induction should be ire-1 dependent (as ER stress-induced GED is ire-1 dependent). However, we found that ire-1 is not required for GED induction upon flp-6 deficiency. Hence ER stress does not act downstream to flp-6 deficiency to induce GED.

Neuronal expression of the Zcls4s has not been previously established. Images of expression that was quantified in ASE should therefore be shown.

Please see Author response image 1.

Author response image 1.

Author response image 1.

Is the FLP-6 translational reporter expression levels restored in the wy762 mutant?

We only looked at the dependency of ER stress-induced GED on the wy762 ire-1 mutant (Figure 3H).

The analysis of the FLP-6 translational reporter was done in the ire-1(ok799) null background (Figure 3D and Figure 3 – sup2c).

IRE-1 RIDD activity has not been demonstrated in C. elegans, and if FLP-6 is indeed an IRE-1 RIDD target, this would be exciting new advance in the field. Therefore these data while provocative, should be validated in independent ways. A convincing method to show IRE-1 RIDD activity would be to re-express an IRE-1 kinase domain only (or mutant without nuclease activity) to see if does not decrease expression of the flp-6 translational reporter. For instance, does is flp-6 lacking the stem loop also a RIDD substrate in the in vitro assays? What is the efficacy of flp-6 processing the RIDD reaction ? How well would known RIDD substrates be cleaved in this assay? If ER-UPR is activated in the FLP-6 translational reporter could be downregulated and explain the results.

As discussed above, we provide more in-vivo and in-vitro evidence demonstrating that flp-6 is a target of RIDD.

In-vitro: We confirmed that the in vitro cleavage assay results in cleavage products of the expected sizes, and that mutation of the predicted cleavage site prevents degradation of the flp-6 RNA. The in-vitro cleavage of the flp-6 RNA substrate is detectable in this assay, although it is a weak substrate. This may be due to a variety of reasons such as a limiting co-factor or cross-species compatibility issues (the IRE1-KR domain is of human origin and the RNA to be cleaved is from C. elegans). It could also be that the recognition motif is not perfect compared to conventional mRNAs. Nevertheless, some cleavage of the substrate is observed, it is of the predicted size and it is dependent on the consensus loop sequence and hairpin. Furthermore, the in-vivo experiments following the endogenous levels of the flp-6 transcript support the in-vitro results.

In-vivo: We now show that flp-6 RNA levels are reduced under different ER stress conditions in an ire-1-dependent xbp-1 independent manner. We show that over-expression of IRE-1 in ASE is sufficient to reduce flp-6 transcript levels. We show that CRISPR-designed worms harboring silent mutations in the flp-6 gene, that disrupt the predicted cleavage site while preserving the coding sequence, protect the stability of the transcript under ER stress conditions and protect the animals from ER stress-induced germline differentiation.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Supplementary file 1. List of sensory neurons included under the che-1 promoter.
    elife-65644-supp1.xlsx (11.1KB, xlsx)
    Supplementary file 2. Statistical data.
    elife-65644-supp2.xlsx (29.6KB, xlsx)
    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES