Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-53BP1 (Rabbit polyclonal) | Bethyl Laboratories | A300-272A | WB (1:3000) |
| Antibody | Anti-53BP1 (Rabbit polyclonal) | Novus Biologicals | NB100-305 | IF (1:1000) |
| Antibody | Anti-LIN37 (Mouse monoclonal) | Santa Cruz Biotechnology | sc-515686 | WB (1:200) |
| Antibody | Anti-BLM (Rabbit polyclonal) | Bethyl Laboratories | A300-572A | WB (1:2000) |
| Antibody | Anti-BRCA1 (Mouse monoclonal) | R and D Systems | Custom made (Andre Nussenzweig, NCI) | WB (1:1000); for mouse BRCA1 |
| Antibody | Anti-BRCA1 (Mouse monoclonal) | Millipore Sigma | 07-434 | WB (1:1000); for human BRCA1 |
| Antibody | Anti-RAD51 (Rabbit polyclonal) | Millipore Sigma | ABE257 | WB (1:2000) |
| Antibody | Anti-RAD51 (Rabbit polyclonal) | Abcam | ab176458 | IF (1:250) |
| Antibody | Anti-BARD1 (Rabbit polyclonal) | Thermo Fisher Scientific | PA5-85707 | WB (1:1000) |
| Antibody | Anti-CtIP (Rabbit polyclonal) | N/A | Custom made (Richard Baer, Columbia University) | WB (1:1000) |
| Antibody | Anti-MRE11 (Rabbit polyclonal) | Novus Biologicals | NB100-142 | WB (1:2000) |
| Antibody | Anti-RIF1 (Rabbit polyclonal) | Abcam | ab13422 | WB (1:500) |
| Antibody | Anti-RIF1 (Rabbit polyclonal) | N/A | Custom made (Davide Robbiani, Rockefeller University) | IF (1:5000) |
| Antibody | Anti-C20orf196/ SHLD1 (Rabbit polyclonal) | Thermo Fisher Scientific | PA5-559280 | WB (1:200) |
| Antibody | Anti-GAPDH (Mouse Monoclonal) | Millipore Sigma | G8795 | WB (1:10,000) |
| Antibody | Anti-KAP1 (Rabbit polyclonal) | Genetex | GTX102226 | WB (1:2000) |
| Antibody | Anti-FANCD2 (Rabbit monoclonal) |
R and D Systems | MAB93691 | WB (1:1000) |
| Antibody | Anti-BRCA2 (Rabbit polyclonal) | Proteintech | 19791-1-AP | WB (1:500); for human BRCA2 |
| Antibody | Anti-Rb1 (Mouse monoclonal) | Thermo Fisher Scientific | LF-MA0173 | WB (1:1000) |
| Antibody | Anti-Phospho -Rb (Ser780) (Rabbit polyclonal) | Cell Signaling Technology | 8180T | WB (1:1000) |
| Antibody | Anti-Phospho -Rb (Ser807/ 811) (Rabbit polyclonal) | Cell Signaling Technology | 8516T | WB (1:1000) |
| Antibody | Anti-PCNA (Rabbit polyclonal) | Bethyl Laboratories | A300-276A | WB (1:3000) |
| Antibody | Anti-CDK4 (Rabbit polyclonal) | Novus Biologicals | NBP1-31308 | WB (1:1000) |
| Antibody | Anti-CDK4 (phosphor Thr172) (Rabbit polyclonal) | GeneTex | GTX00778 | WB (1:1000) |
| Antibody | Anti-RPA32 (4E4) (Rat monoclonal) | Cell Signaling Technology | 2208S | WB (1:1000); FC (1:500) |
| Antibody | Anti-phospho-H2AX (ser139) (Mouse monoclonal) | Millipore Sigma | 05-636 | FC (1:1000) |
| Antibody | HRP, goat anti-mouse | Promega | W4021 | WB (1:5000) |
| Antibody | HRP, goat anti-rabbit IgG | Promega | W4011 | WB (1:5000) |
| Antibody | Alexa Fluor 555, donkey anti-rabbit IgG | Thermo Fisher Scientific | A-31572 | IF (1:5000) |
| Antibody | Alexa Fluor 488,goat anti-rat IgG | BioLegend | 405418 | FC (1:500) |
| Antibody | Alexa Fluor 647,goat anti-mouse IgG | BioLegend | 405322 | FC (1:500) |
| Recombinant DNA reagent | pCW-Cas9 (plasmid) | Addgene | 50661 | |
| Recombinant DNA reagent | pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid) | Addgene | 42230 | |
| Recombinant DNA reagent | pKLV-U6 gRNA(BbsI)-PGKpuro-2ABFP (plasmid) | Addgene | 50946 | |
| Recombinant DNA reagent | pLenti-CMV-Blast-PIP-FUCCI (plasmid) | Addgene | 138715 | |
| Recombinant DNA reagent | Genome-wide CRISPR guide RNA library V2 (plasmid) | Addgene | 67988 | |
| Recombinant DNA reagent | Lin37 cDNA BC013546 (plasmid) | transOMIC | TCM1004 | |
| Recombinant DNA reagent | TRE-Thy1.1 (plasmid) | This study | N/A | Available upon request |
| Recombinant DNA reagent | pHPRT-DR-GFP (plasmid) | Marian Jasin, MSKCC | N/A | |
| Recombinant DNA reagent | pCBASceI (plasmid) | Marian Jasin, MSKCC | N/A | |
| Recombinant DNA reagent | pCBA (plasmid) |
Marian Jasin, MSKCC | N/A | |
| Cell line (Homo-sapiens) | MCA10A | ATCC | CRL-10317 | |
| Cell line (Homo-sapiens) | MCA10A: iCas9 | This study | Clone 25 | Available upon request |
| Cell line (Homo-sapiens) | MCA10A: Trp53bp1−/−: iCas9 | This study | Clones 7 and 50 | Available upon request |
| Cell line (Homo-sapiens) | MCA10A: Lin37−/−:iCas9 | This study | Clones 5 and 21 | Available upon request |
| Cell line (Mus musculus) | WT:iCas9 abl pre-B cells | This study | M63.1.MG36.iCas9.302 | Available upon request |
| Cell line (M. musculus) | Trp53bp1−/−:iCas9 abl pre-B cells | This study | Clones 1 and 27 | Available upon request |
| Cell line (M. musculus) | Lin37−/−:iCas9 abl pre-B cells | This study | Clones 9 and 59 | Available upon request |
| Cell line (M. musculus) | Lig4−/−:iCas9 abl pre-B cells | This study | A5.83.MG9.iCas9.16 | Available upon request |
| Cell line (M. musculus) | Lig4−/−: Trp53bp1−/−:iCas9 abl pre-B cells | This study | Clones 81 and 82 | Available upon request |
| Cell line (M. musculus) | Lig4−/−:Lin37−/−:iCas9 abl pre-B cells | This study | Clones 6 and 42 | Available upon request |
| Chemical compound, drug | Imatinib | Selleckchem | S2475 | |
| Chemical compound, drug | Doxycycline | Sigma-Aldrich | D9891 | |
| Chemical compound, drug | Puromycin | Sigma-Aldrich | P9620 | |
| Chemical compound, drug | EGF | PeproTech | AF-100-15 | |
| Chemical compound, drug | Hydrocortisone | Sigma-Aldrich | H-0888 | |
| Chemical compound, drug | Cholera Toxin | Sigma-Aldrich | C-8052 | |
| Chemical compound, drug | Insulin | Sigma-Aldrich | I-1882 | |
| Commercial assay or kit | Cytofix/Cytoperm solution | BD Biosciences | 554722 | |
| Commercial assay or kit | Perm/Wash Buffer | BD Biosciences | 554723 | |
| Commercial assay or kit | Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit | Life Technologies | C10419 | |
| Commercial assay or kit | SG Cell Line 4D X Kit L | Lonza | V4XC-3024 | |
| Other | 7-AAD (DNA stain) | BD Biosciences | 559925 | |
| Sequence-based reagent | pKLV lib330F | This study (designed based on Tzelepis et al., 2016) | PCR primers | AATGGACTATCATATGCTTACCGT |
| Sequence-based reagent | pKLV lib490R | This study (designed based on Tzelepis et al., 2016) | PCR primers | CCTACCGGTGGATGTGGAATG |
| Sequence-based reagent | PE.P5_pKLV lib195 Fwd | This study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences) | PCR primers | AATGATACGGCGACCACCGAGATCTGGCTTTATATATCTTGTGGAAAGGAC |
| Sequence-based reagent | P7 index180 Rev | This study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences) | PCR primers | CAAGCAGAAGACGGCATACGAGATINDEXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCCAGACTGCCTTGGGAAAAGC |
| Sequence-based reagent | Lin37 iso1_5′XhoI_S | This study (designed based on cDNA BC013546) | PCR primers | GCCCTCGAGATGTTCCCGGTAAAGGTGAAAGTGG |
| Sequence-based reagent | Lin37 3′NotI_AS | This study (designed based on cDNA BC013546) | PCR primers | GCCGCGGCCGCTCACTGCCGGTCATACATCTCCCGT |
| Sequence-based reagent | Lin37 CD1_AS | This study (designed based on cDNA BC013546 and Mages et al., 2017) | PCR primers | TACAGTGGTGTGTTCTCACTGAACTGGGCCAAGTCCACAGCCCCG GCAAATAGCTTGATC |
| Sequence-based reagent | Lin37 CD2_S | This study (designed based on cDNA BC013546 and Mages et al., 2017) | PCR primers | ACTTGGCCCAGTTCAGTGAGAACACACCACTGTACCCCATCGCCGGCGCCTGGATGCGCA |
| Sequence-based reagent | BU1 | Canela et al., 2016 | PCR primers | 5′-Phos-GATCGGAAGAGCGTCGT GTAGGGAAAGAGTGUU[Biotin-dT]U [Biotin-dT]UUACACTCTTTC CCTACACGACGCTCTTCCGATC* T-3′ [*phosphorothioate bond] |
| Sequence-based reagent | BU2 | Canela et al., 2016 | PCR primers | 5′-Phos-GATCGGAAGAGCACACG TCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond] |
| Sequence-based reagent | 53 bp1 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | GAACCTGTCAGACCCGATC |
| Sequence-based reagent | Lin37 gRNA sequences | Sequence is from Tzelepis et al., 2016 | N/A | AAGCTATTTGACCGGAGTG |
| Sequence-based reagent | Brca1 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | GTCTACATTGAACTAGGTA |
| Sequence-based reagent | Ctip gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | ATTAACCGGCTACGAAAGA |
| Sequence-based reagent | Bard1 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | AAATCGTAAAGGCTGCCAC |
| Sequence-based reagent | Blm gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | GATTTAACGAAGGAATCGG |
| Sequence-based reagent | Fancd2 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | TCTTGTGATGTCGCTCGAC |
| Sequence-based reagent | Trp53bp1 (human) gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | TCTAGTGTGTTAGATCAGG |
| Sequence-based reagent | Lin37 (human) gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | TCTAGGGAGCGTCTGGATG |
| Software, algorithm | Image J | NIH | RRID:SCR_003070 | |
| Software, algorithm | FlowJo | FlowJo | RRID:SCR_008520 | |
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | SeqKit | Shen et al., 2016 | RRID:SCR_018926 | |
| Software, algorithm | Bowtie | Langmead et al., 2009 | RRID:SCR_005476 | |
| Software, algorithm | SAMtools | Li et al., 2009 | RRID:SCR_002105 | |
| Software, algorithm | BEDtools | Quinlan and Hall, 2010 | RRID:SCR_006646 | |
| Others | LSRII flow cytometer | BD Biosciences | RRID:SCR_002159 | |
| Others | FACSAria II Cell Sorter | BD Biosciences | RRID:SCR_018934 | |
| Others | Lionheart LX automated microscope | BioTex Instrument | RRID:SCR_019745 | |
| Others | 4-D Nucleofector | Lonza | NA |