Abstract
Background and Objectives:
Brucella is an intracellular pathogen that causes brucellosis in humans and animals. This study aimed to assess the results of brucellosis seroprevalence among participants of the Famenin brucellosis cohort with molecular investigation technique and determine Brucella-approved species.
Materials and Methods:
Following the first phase of the Famenin brucellosis cohort in 2016 which investigated the seroprevalence of brucellosis among 2367 participants in Famenin city, a total of 575 people including all seropositive and some seronegative people were examined again by wright serological tests in 2019. The PCR assay was accomplished on all cases that have wright titers ≥ 1/20 for tracing Brucella DNA using BCSP31 target gene and IS711 locus.
Results:
Out of 575 studied cases, 145 people had wright titers ≥ 1/20. The PCR reactions of these 145 blood samples were positive in 63/145 (43.44%) tested samples using primers (B4/B5) for Brucella genus detection. In the second PCR assay using specific-primers for Brucella abortus and Brucella melitensis, 18/63 (28.57%) of the samples were diagnosed as B. abortus, and 18/63 (28.57%) were diagnosed as B. melitensis.
Conclusion:
In this study, using the selected specific genes for the diagnosis of Brucella in the genus and species levels, the PCR technique was evaluated as a promising method for the rapid and safe detection of brucellosis besides the serological test for more accurate detection of brucellosis especially in cases that are not definitive.
Keywords: Polymerase chain reaction, Serological test, Brucella abortus, Brucella melitensis, Brucellosis
INTRODUCTION
Brucellosis is one of the most important zoonotic and economically important disease in productive animals worldwide that causes abortion and infertility (1). Brucellosis in Iran, like in many developing countries is endemic. Of the 12 Brucella species which have been known until now, only four species (Brucella melitensis, Brucella abortus, Brucella suis, and Brucella canis) are pathogenic to humans in decreasing order of severity (2). Brucellosis usually occurs when humans are exposed to infected food or product of animals infected by brucella (3). In humans, brucellosis is a systemic disease that can affect many organs and tissues (4, 5). Due to diversities of clinical symptoms of brucellosis, rapid and accurate diagnosis based on laboratory findings is necessary (6, 7).
Although the definitive diagnosis of brucellosis always entails the isolation of the organism from clinical specimens, serological procedures may be the only tests available in many settings (8). There are some obstacles in confirmation of the agent through a blood culture. The growth of Brucella is very slow and due to the high risk of transmission it poses many hazards to personnel (9). Also, the sensitivity of blood culture is significantly diminished in patients with long-term clinical eras and the chance of successful isolation of the organism decreases over time. It can be isolated only in 70% of cases with acute phase of the disease and 25% of chronic cases (10, 11).
Another laboratory technique for diagnosis is measuring the antibody titers against Brucella antigens (12, 13). The standard agglutination test (14), with the classic Huddleson, Wright, and/or rose Bengal, 2-mercaptoethanol (2-ME), antihuman globulin (Coombs’), and indirect enzyme-linked immunosorbent assay (ELISA) can be used to identify antibodies associated with chronic disease (8, 15). But due to the structural similarity of Brucella cell-wall with some other Gram-negatives, IgM class cross-reaction is common. Also despite the blocking antibodies in the IgA and IgG fractions, a false-negative serum tube agglutination test may occurr too (14). Also in serological tests of the disease, determining the difference in titers between two serum samples at least two weeks apart is very valuable, which unfortunately is not always possible. Nowadays, recent advances in molecular biology have enabled the rapid and accurate detection of Brucella bacteria with high sensitivity and specificity in detecting both primary infection and relapse after treatment. PCR technique facilitates the detection and tracking of these slow-growing bacteria and authorizes differentiation between species and strains (16). So far, many studies have been accomplished on the identification of the Brucella genus and the isolation of its various species using PCR-based assay on blood or serum samples of humans and animals (17–19).
The objective of this study was to investigate the result of seroprevalence of brucellosis in the 2nd phase of the Famenin brucellosis cohort study by PCR and to identify the organism at species level. Using PCR, all samples with titers ≥1/20 in Wright’s sero-agglutination test, the accuracy, and efficiency of serological tests performed in the Famenin brucellosis cohort, particularly in seropositive cases were investigated. This is the first report of PCR-based diagnosis and identification of human pathogenic species of Brucella in a large population in a cohort study in Iran. Also, by determining the species of Brucella isolated from the participants in the brucellosis cohort, we could have more detailed information about the prevalence of Brucella in special areas and provide appropriate treatment and health strategies in the future.
MATERIALS AND METHODS
Subjects and data collection.
Following the first phase of the Famenin brucellosis cohort in 2016, which we had investigated the seroprevalence of brucellosis among 2367 participants in Famenin City (20), in the second phase at 2019, a total of 575 participants in Famenin brucellosis cohort, including all seropositive and some seronegative people were recalled from urban and suburban parts of Famenin (a city located in Hamadan, west of Iran). We first investigated all 575 cases with Wright’s sero-agglutination test. Based on clinical rules in Iran, all people who had wright titer ≥1/80 were regarded as serologically positive samples. Here in this study we more investigated all the samples with titers ≥1/80 and < 1/80 by molecular test for better interpretation.
Serological techniques.
The serological diagnosis was established by Wright’s tube agglutination test (Brucella Antigen produced by Razi Vaccine and Serum Research Institute, Iran). A titer equal to or greater than 1/80 was considered significant. Antigen mixed with physiological serum was used as the negative control. The positive serum sample was diluted (1:5) with physiologic serum and used in combination with a specific antigen as positive control (20).
DNA isolation from serum samples.
Two ml of whole blood samples from all people who had wright titers ≥1/20 were used for isolation of the Brucella DNA. In this study, using a manual protocol, 250 μL of blood was mixed thoroughly with 1000 μL of erythrocyte lysis buffer in a 1.5-mL microfuge tube. After vortexing, it was centrifuged at 13,000 rpm for 3 minutes. Then after adding 300 μL WBC lysis buffer and 30 μL SDS 10%, the microtube was vortexed briefly. Then 30 μL of protein kinase was added and the cell lysate was incubated at 56°C for 4 hrs and the suspension was chilled before adding 200 μL of NaCl (6M). Then it centrifuged at 13,000 rpm for 6 minutes to precipitate residual proteins as a tight pellet. Subsequently, the 300–400 μL of supernatant containing DNA was poured into a clean 1.5-mL microfuge tube, gently mixed with absolute cold ethanol, and finally centrifuged at 13,000 rpm for 3 minutes to precipitate purified DNA. The DNA precipitate was washed twice with ethanol 70% and dissolved in sterile distilled water, then stored at −20°C foe future tests.
Brucella genus-specific and species-specific DNA detection.
Three PCR assays were developed in 2 steps: one represented the diagnostic assay for the detection of Brucella genus, while the next two PCR, was arranged to be used for confirmation of results obtained in the first assay for the identification of Brucella species.
The specific primers used for the molecular detection of Brucella genus using PCR were BCSP31-B4-F 5′-TGGCTCGGTTGCCAATATCAA-3′, and BCSP31-B5-R 5′-CGCGCTTGCCTTTCAGGTCTG-3′ (16). This PCR assay amplifies a 223-bp sequence of the gene bcsp31 encoding an immunogenic outer membrane protein of 31 kDa of B. abortus, which is conserved in all Brucella species.
Species-specific DNA segments of B. abortus and B. melitensis were targeted for amplification by specific primers. Forward primers were derived from insertion sequence 711 (IS711) and are unique for the identification of both Brucella species but the reverse primers are different, and were derived from B. abortus and B. melitensis specific locus on chromosomal DNA. The PCR assays using the B. abortus specific-primers (IS711,B.a-F 5′TGCCGATCACTTAAGGGCCTTCAT3′, and IS711, B.a-R 5′GACGAACGGAATTTTTCCAATCCC 3′) and The B. melitensis specific-primers (IS711, B.m-F 5′TGCCGATCACTTAAGGGCCCTCAT3′ and IS711, B.m-R 5′ AAATCGCGT CTTTGCTGGTCTGA 3′) produced 498-bp and 731-bp sequences in B. abortus and B. melitensis species, respectively (21).
PCR condition and detection of the amplicons.
PCR was performed in a total volume of 12.5 μL mixture containing 6.25 μL Master mix RED (amplicon, Denmark), 4 μL DNA template, 0.5 μL of each primer, and 1.25 μL distilled water. The first PCR step was performed at 95°C for 3 min and followed by 35 cycles of denaturation (95°C for 90 s), annealing (64°C for 1 min), and extension (72°C for 1 min). The last step was performed at 72°C for 5 min. The amplified PCR products were analyzed using 2% agarose gels and stained with GelRed® nucleic acid stain. DNA of strains of B. abortus (ATCC 23455) and B. melitensis (ATCC 23457) were used as positive controls and physiological serum used as the negative control in all reactions.
Ethical considerations.
The study was approved by the Ethical Committee of Hamadan University of Medical Sciences, Iran (IR.UMSHA.REC.1397.83), and all subjects signed written informed consent. Blood sampling had no side effects for the patients and was routine for diagnosis of the disease.
RESULTS
Serological titers.
Of the 575 blood samples which collected in the second phase of the Hamadan Brucellosis Cohort Project, 145 samples had the wright serological titers (≥1/20) which were included in this study. Table 1 shows the primary results of Wright serological tests of participants in the 2nd phase of the Famenin brucellosis cohort study.
Table 1.
The results of Wright serological tests of participants in the 2nd phase of the Famenin brucellosis cohort study and molecular investigation of the all samples with titers ≥1/20 in Wright test.
|
Urban
No. (%) |
Suburban
No. (%) |
Total
No. (%) |
Brucella genus
No. (%) |
B. melitensis
No. (%) |
B. abortus
No. (%) |
||
|---|---|---|---|---|---|---|---|
| Wright test | Negative | 173 (83.98) | 257 (69.65) | 430 (74.78) | Not checked | Not checked | Not checked |
| 1/20 | 18 (3.47) | 67 (18.16) | 85 (14.785) | 36 (6.26) | 6 (91.04) | 9 (1.56) | |
| 1/40 | 10 (4.85) | 32 (8.67) | 42 (7.30) | 9 (1.56) | 3 (0.52) | 0 (0) | |
| 1/80 | 4 (1.94) | 11 (2.98) | 15 (2.61) | 15 (2.6) | 9 (1.56) | 6 (91.04) | |
| 1/160 | 1 (0.49) | 2 (0.54) | 3 (0.52) | 3 (0.52) | 0 (0) | 1 (0.17) | |
| 1/320 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | |
| 1/640 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | |
| 1/1280 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | |
| Total | 206 (100) | 369 (100) | 575 (100) | 63 (10.95) | 18 (3.13) | 16 |
Brucella genus detection with BCSP31-PCR.
PCR results of the evaluation of Brucella genus DNA with B4 and B5 primers are demonstrated in Fig. 1. As expected, the size of amplicon for bcsp31 223 bp. Among the 145 cases that had Wright titers ≥ 1/20, 63 (43.44%) samples were positive by B4 and B5 primers, and the others were negative based on PCR results in this step.
Fig. 1.
The PCR assay for detection of Brucella genus DNA. M: 1 kb Ladder, Lane 1: Negative control (physiological serum), Lane 2: Positive control (B. abortus ATTCC 23455), 3–5: Samples with Wright titer ≥1/20, 6 and 7: samples with no Wright titer
Brucella species detection with IS711 –PCR.
At the next step, among 63 samples which were positive by the first PCR reaction of Brucella genus, a 498 bp (Fig. 2) and 731 bp (Fig. 3) PCR-fragments were seen following the electrophoresis, corresponding well to the expected size of partial genes of B. abortus and B. melitensis, respectively. The isolation rate for B. melitensis was 28.57% (18/63 cases), and for B. abortus was 28.57% (18/63 cases). No bands were amplified in remaining samples using B. melitensis and B. abortus-specific primers.
Fig. 2.
The PCR assay for the detection of B. abortus DNA. M: 1 kb Ladder, Lane 1: Negative control (physiological serum), Lane 2: Positive control (B. abortus ATTCC 23455), 3 and 4: Samples with Wright titer ≥1/20, 5 and 6: samples with no Wright titer.
Fig. 3.
The PCR assay for the detection of B. melitensis DNA. M: 1 kb Ladder, Lane 1: Negative control (physiological serum), Lane 2: Positive control (B. melitensis ATCC 23457), 3 and 4: Samples with Wright titer ≥1/20, 5 and 6: samples with no Wright titer.
DISCUSSION
Brucellosis has not yet been eradicated in some countries including Iran. Rapid and accurate diagnosis of brucellosis, plays an important role in improving the disease in humans. Brucellosis diagnostic methods based on serological tests and Brucella culture are time-consuming and costly (8). Molecular techniques based on the amplification of nucleic acids, such as PCR can be a suitable alternative method for rapid and more accurate diagnosis of slow-growing pathogens, like Brucella (22). Although PCR tests are more expensive for the diagnosis of human diseases than conventional diagnostic methods, the correct and accurate diagnosis of brucellosis and decreasing the hazards for laboratory staffs by molecular tests could be used as a complementary method. Previously, some researchers have offered that standard agglutination test titers of 1/160 are not emblematic of effective infection of Brucella in endemic regions, therefore the results of these titers should not be considered without further follow-ups (14, 23, 24). In Iran, beside the appropriate clinical presentation, all cases of human brucellosis are usually diagnosed through serological testing in clinical laboratories. Adherence to the necessary standards in performing these tests is of particular importance. Otherwise, it will lead to false-positive and false-negative results. In this study, we investigated the usefulness of PCR assay for the diagnosis of Brucella DNA in people who had wright serological titers ≥ 1/20. The PCR method establishes the detection of brucellosis in a short time, and moreover minimizes the risk of exposure to bacterial isolates in Brucella cultures (6).
Different researchers examined molecular methods for identifying Brucella in different samples. According to published studies, PCR-based methods are more useful and practical than conventional methods for detecting Brucella at the species level and even at the biovars level (18, 23, 24). Besides, the extraction of DNA from clinical specimens, authorizes isolates genetic fingerprinting in epidemiological studies of brucellosis for its prevention and treatment. Also, the PCR method does not have the disadvantages of serological diagnostic methods such as little sensitivity, and the presence of cross-reactive antibodies and inefficiency in the diagnosis of chronic disease (17–19, 22).
Here in this study, three separate PCR evaluations were performed: One PCR reaction for the Brucella genus-specific detection, and two PCR reactions for the species-specific identification of B. abortus and B. melitensis species.
As mentioned before, among the 145 cases that had Wright titers ≥1/20, 63 (43.44%) samples were positive by Brucella-genus detection with BCSP31-PCR, and the other 82 (56.66%) samples were negative based on our PCR method. Among these samples, we oserved some cases with wright positive titers that were negative in PCR assay. Our results were in agreement with Garshasbi et al. that had some false-negative results for Wright-positive samples. We also observed 3 cases with serological titer =1/80 which were negative for PCR of Brucella genus DNA among 18 people who had wright titers ≥1/80 (16), and assume that these serological results arouse from antibodies that produced against other bacteria that cross-react with Brucella antigen. Also, Wright positive sera without clinical signs are often seen in people with repeated exposure to the Brucella antigen. Therefore, the results of serum tests in occupational brucellosis are of limited value. On the other hands, we saw 36 and 9 positive PCR results in people who had wright titers equal to 1/20 and 1/40 respectively, which is not clinically reliable for Iranian physicians. In these cases, we assumed that may be there are some deficiencies in the serological kit that we used for identification of Brucella antibodies in this study or may be due the inaccurate diagnosis of our research team. Our results are in agreement with the results of researchers that mentioned the results of standard agglutination tests with low titers should not be disregarded without further follow ups (24).
By the way, these results focus attention on the noteworthiness of utilizing more than one type of detective technique for the diagnosis of human brucellosis besides the clinical signs of suspected patients, especially with epidemiological intention. In western countries which brucellosis is an occupational disease and infection with B. melitensis is not common, the valuable titer for treatment is 1/160. But in an area of endemicity like Iran, titers of 1/80 and above are more valuable for treatment (25). Therefore, while the use of standard laboratory methods is recommended in the diagnosis of brucellosis, it is necessary to consider clinical, and laboratory information with epidemiological data, which in this study is of our shortcomings.
Finally In this study, owing to the specificity of selected genes for the diagnosis of Brucella in the genus and species levels, the PCR technique was evaluated as a promising method in the rapid and safe detection of Brucellosis besides the serological tests for more accurate detection of brucellosis especially in cases that are not definitive. Although we think if we wanted to select, we choose that the speed, accuracy, specificity, and sensitivity of PCR assay in the diagnosis of brucellosis are much higher than those of serology test.
ACKNOWLEDGEMENTS
This research was supported by Hamadan University of Medical Sciences, Deputy of Research and Technology (Grant No.970225985). We thank our colleagues from Famenin health center and the core facilities of Hamadan University of Medical Sciences for supporting and their assistance in this research. We especially thank Mrs. Maryam Fathi for her excellent assistance especially in collecting the samples from urban and sub-urbane parts of Famenin.
REFERENCES
- 1.Budak F, Göral G, Heper Y, Yilmaz E, Aymak F, Baştürk B, et al. IL-10 and IL-6 gene polymorphisms as potential host susceptibility factors in Brucellosis. Cytokine 2007;38:32–36. [DOI] [PubMed] [Google Scholar]
- 2.Yu WL, Nielsen K. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J 2010;51:306–313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Smith JA. Brucella Lipopolysaccharide and pathogenicity: The core of the matter. Virulence 2018;9:379–382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Refai M. Incidence and control of brucellosis in the Near East region. Vet Microbiol 2002;90:81–110. [DOI] [PubMed] [Google Scholar]
- 5.Hasanjani Roushan MR, Mohrez M, Smailnejad Gangi SM, Soleimani Amiri MJ, Hajiahmadi M. Epidemiological features and clinical manifestations in 469 adult patients with brucellosis in Babol, Northern Iran. Epidemiol Infect 2004;132:1109–1114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Elfaki MG, Uz-Zaman T, Al-Hokail AA, Nakeeb SM. Detection of Brucella DNA in sera from patients with brucellosis by polymerase chain reaction. Diagn Microbiol Infect Dis 2005;53:1–7. [DOI] [PubMed] [Google Scholar]
- 7.Scholz HC, Hubalek Z, Sedlácek I, Vergnaud G, Tomaso H, Al Dahouk S, et al. Brucella microti sp. nov., isolated from the common vole Microtus arvalis. Int J Syst Evol Microbiol 2008;58:375–382. [DOI] [PubMed] [Google Scholar]
- 8.Al Dahouk S, Nöckler K. Implications of laboratory diagnosis on brucellosis therapy. Expert Rev Anti Infect Ther 2011;9:833–845. [DOI] [PubMed] [Google Scholar]
- 9.Almuneef M, Memish ZA. Persistence of Brucella antibodies after successful treatment of acute brucellosis in an area of endemicity. J Clin Microbiol 2002;40:2313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Atluri VL, Xavier MN, de Jong MF, den Hartigh AB, Tsolis RM. Interactions of the human pathogenic Brucella species with their hosts. Annu Rev Microbiol 2011;65:523–541. [DOI] [PubMed] [Google Scholar]
- 11.Gorvel JP. Brucella: a Mr “Hide” converted into Dr Jekyll. Microbes Infect 2008;10:1010–1013. [DOI] [PubMed] [Google Scholar]
- 12.Keramat F, Karami M, Alikhani MY, Bashirian S, Moghimbeigi A, Hashemi SH, et al. Seroprevalence of Brucellosis among general population in Famenin city, western Iran in 2016: The Famenin Brucellosis cohort study. Arch Iran Med 2020;23:749–756. [DOI] [PubMed] [Google Scholar]
- 13.Keramat F, Majzobi MM, Poorolajal J, Ghane ZZ, Adabi M. Seroprevalence of Brucellosis in human immunodeficiency virus infected patients in Hamadan, Iran. Osong Public Health Res Perspect 2017;8:282–288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mantur B, Parande A, Amarnath S, Patil G, Walvekar R, Desai A, et al. ELISA versus conventional methods of diagnosing endemic brucellosis. Am J Trop Med Hyg 2010;83:314–318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Franco MP, Mulder M, Gilman RH, Smits HL. Human brucellosis. Lancet Infect Dis 2007;7:775–786. [DOI] [PubMed] [Google Scholar]
- 16.Garshasbi M, Ramazani A, Sorouri R, Javani S, Moradi S. Molecular detection of Brucella species in patients suspicious of Brucellosis from Zanjan, Iran. Braz J Microbiol 2014;45:533–538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Bahmani N, Mirnejad R, Arabestani MR, Mohajerie P, Hashemi SH, Karami M, et al. Comparison of PCRRFLP and PFGE for determining the clonality of Brucella isolates from human and livestock specimens. Saudi J Biol Sci 2019;26:256–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Navarro E, Casao MA, Solera J. Diagnosis of human brucellosis using PCR. Expert Rev Mol Diagn 2004;4:115–123. [DOI] [PubMed] [Google Scholar]
- 19.Peeridogaheh H, Golmohammadi MG, Pourfarzi F. Evaluation of ELISA and Brucellacapt tests for diagnosis of human Brucellosis. Iran J Microbiol 2013;5:14–18. [PMC free article] [PubMed] [Google Scholar]
- 20.Keramat F, Karami M, Alikhani MY, Bashirian S, Moghimbeigi A, Adabi M. Cohort profile: Famenin Brucellosis cohort study. J Res Health Sci 2019;19(3):e00453. [PMC free article] [PubMed] [Google Scholar]
- 21.Dadar M, Alamian S, Behrozikhah AM, Yazdani F, Kalantari A, Etemadi A, et al. Molecular identification of Brucella species and biovars associated with animal and human infection in Iran. Vet Res Forum 2019;10:315–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zerva L, Bourantas K, Mitka S, Kansouzidou A, Legakis NJ. Serum is the preferred clinical specimen for diagnosis of human brucellosis by PCR. J Clin Microbiol 2001;39:1661–1664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.El Kholy AA, Gomaa HE, El Anany MG, Abd El Rasheed E. Diagnosis of human brucellosis in Egypt by polymerase chain reaction. East Mediterr Health J 2009;15:1068–1074. [PubMed] [Google Scholar]
- 24.Gemechu MY, Gill JP, Arora AK, Ghatak S, Singh DK. Polymerase chain reaction (PCR) assay for rapid diagnosis and its role in prevention of human brucellosis in Punjab, India. Int J Prev Med 2011;2:170–177. [PMC free article] [PubMed] [Google Scholar]
- 25.Sofian M, Safaeipour L, Aghakhani A, Sharif MR, Banifazl M, Sharif A, et al. Screening of family members of patients with acute brucellosis in an endemic area of Iran. Iran J Microbiol 2013;5:215–219. [PMC free article] [PubMed] [Google Scholar]