Activating Mucosal-Associated Invariant T cells Induces a Broad Antitumor Response

Abstract

Mucosal-associated invariant T (MAIT) cells are MR1-resricted innate-like T cells that recognize non-peptide antigens including riboflavin derivates. Although in vitro–activated MAIT cells show antitumor activity, the in vivo role of MAIT cells in cancer is still unclear. Here, we have shown that MAIT cells have antitumor function in vivo when activated by a combination of the synthetic riboflavin synthesis pathway–derived antigen 5-OP-RU (5-(2-oxopropylideneamino)-6-D-ribitylaminouracil) and the Toll-like receptor 9 (TLR9) agonist CpG. Co-administration of 5-OP-RU and CpG induced strong systemic in vivo expansion and activation of MAIT cells with high CD69 expression, pronounced effector memory phenotype and upregulated levels of effector molecules including IFNγ, granzyme B and perforin. Activated and expanded MAITs induced a potent and broad antitumor immune response in murine models of liver metastasis and hepatocellular carcinoma (HCC), lung metastasis, and subcutaneous tumors in two different mouse strains. Such tumor inhibition was absent in MAIT-deficient Mr1^−/− mice. CRISPR/Cas9-mediated MR1-knockout in tumor cells did not affect efficacy of this MAIT-directed immunotherapy, pointing toward an indirect mechanism of action. Our findings suggest that MAIT cells are an attractive target for cancer immunotherapy.

INTRODUCTION

Mucosal-associated invariant T (MAIT) cells are a unique population of innate-like T cells [1] that share properties of both innate immune cells and conventional T cells. MAIT cells express a limited repertoire of T-cell receptors [2] and are restricted by MR1 [3], a monomorphic class I–related MHC molecule that has a highly conserved ligand-binding groove. Unlike conventional T cells, which are reactive to peptide antigens, MAITs recognize microbial nonpeptide antigens such as riboflavin derivates, suggesting they have a role in controlling microbial infection. To date, 5-(2-oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) is the most potent antigen known to activate MAITs [4]. In combination with a Toll-like receptor 9 (TLR9) agonist CpG, 5-OP-RU causes a strong activation and expansion of MAIT cells in an MR1-dependent manner [5,6]. Activation of MAIT cells by various species of bacteria and yeast can cause the cells to secrete proinflammatory cytokines and lyse bacterial and virus infected cells [7]. Homozygous point mutations in MR1 resulting in a lack of MAITs can cause primary immunodeficiency in humans, which manifests with viral and bacterial infections that are refractory to therapy [8]. This indicates that MAIT cells may play an early role in protection against infections [9]. Consistent with a proposed antimicrobial function, MAIT cells are enriched in many organs with high microbial exposure, such as the intestine, lung, and liver. In humans, MAIT cells can represent the most common T-cell subpopulation (up to ~50%) in the liver [10].

MAITs can be detected in both primary cancers and metastasis [11–15], but their exact function in cancer remains to be elucidated. Emerging data suggests that MAIT cells are critical for tumor progression, however, both pro- and antitumor functions have been reported [16–18]. Decreased MAIT cell frequencies are seen in tumor lesions of patients with hepatocellular carcinoma (HCC) compared with normal liver tissue [14]. Importantly, high numbers of MAIT cells in HCC lesions are associated with a poor prognosis, suggesting the cells have a tumor-promoting function [14]. Consistent with the human data, tumor initiation, growth, and metastasis are reduced in MAIT deficient Mr1^−/− mice [17]. In that study, MAITs are shown to promote tumor growth by suppressing T cells and NK cells through an IL-17A–mediated mechanism of action [17]. In contrast, MAITs exhibit cytolytic activity in vitro against multiple myeloma cell lines pulsed with 5-OP-RU [18], suggesting that MAITs also possess antitumor properties. We suggest that context-dependent effector functions of MAITs explain the dichotomous observations.

MAITs can be selectively activated by exposure to 5-OP-RU and CpG, which increases their levels of IFNγ and cytotoxic effector molecules (granzyme B and perforin). This suggests that MAITs are potential targets for antitumor immunotherapy. However, in vivo data on activating MAIT cells to boost anticancer immunity is lacking.

Here, we report in vivo evidence that boosting MAIT cells can be deployed to treat tumors of various origins. Administration of 5-OP-RU and CpG led to robust systemic MAIT-cell activation and expansion with high expression of CD69, a pronounced effector memory phenotype, and upregulated effector molecules including IFNγ, granzyme B and perforin. Activated and expanded MAITs induced a potent and broad antitumor response in various tumor models in two different mouse strains. This effect was not seen in MAIT-deficient Mr1^−/− mice. Loss of MR1 on tumor cells did not result in decreased antitumor function, indicating an indirect mechanism of action. Thus, our findings demonstrate that activating MAIT cells are an attractive target for cancer immunotherapy.

MATERIAL AND METHODS

Mice and cell lines

Seven-to-twelve-week-old female C57BL/6 mice (strain code #556) were purchased from Charles River Laboratories. Female 7–10 week old albino B6(Cg)-Tyr<c-2J>/J mice (IMSR Cat# JAX:000058, RRID:IMSR_JAX:000058) were obtained from the Jackson Laboratory. Mr1^−/− mice were originally generated and described [3] by Dr. Susan Gilfillan (Washington University, St Louis School of Medicine, MO) and were kindly provided by Dr. Daniel Barber (NIAID/NIH, Bethesda, MD). Male and female Mr1^−/− mice between 7–16 weeks of age were used for the experiments. Loss of MR1 was confirmed by genotyping of Mr1^−/− mice using PCR with the following primers: MR1 5 8763–8783: AGC TGA AGT CTT TCC AGA TCG, MR1 9188–9168 rev: ACA GTC ACA CCT GAG TGG TTG, MR1 10451–1043: GAT TCT GTG AAC CCT TGC TTC. All animals were randomized between cages at least one week before start of the experiments. Mice were housed at CRC animal facility at NCI in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals. All technical procedures and experimental endpoints were approved by the NCI Division of Intramural Research Animal Care and Use Committee and listed in the animal study proposal TGOB-013.

The B16-F10 GFP and luciferase-expressing melanoma cell line (B16F10-GFP+LUC) was a gift from Prof. Dr. Ugur Sahin (Mainz, Germany) [19]. Cells were cultured in RPMI1640 GlutaMax (Thermofisher, cat. #61870127) +10% FCS (CORNING, cat. #MT35010CV) + 1% So-Pyruvate (Thermofisher, cat. #11360070) +1% 1M HEPES (Thermofisher, cat. #15630080) +1% NEAA (Thermofisher, cat. #11140050) and 500 ng/mL Puromycin (InvivoGen, cat. #ant-pr-1). The CT26 colon cancer cell line (ATCC Cat# CRL-2638, RRID:CVCL_7256) was obtained from ATCC and cultured in RPMI GlutaMax (+10% FCS). The luciferase-expressing HCC cell line RIL-175 has previously been described [20] and was cultured in RPMI1640 GlutaMax (+10% FCS). P19 cells were obtained from the ATCC (cat. #CRL-1825) and were cultured in standard DMEM Glutamax (Thermofisher, cat. #10564029) with 10% FBS (ThermoFisher, cat. #16140071) and 1% Penstrep (Thermofisher, cat. #15140122).

All cell lines used in experiments were cultured for 3 to 10 days and for 1 to 5 passages prior to implantation. Routine testing for murine pathogens including Mycoplasma was last performed in March 2019 and was negative for all cell lines. The cell lines used in this manuscript were not authenticated in the past year.

In vivo imaging

Bioluminescence imaging allowed us to monitor intrahepatic tumor growth of luciferase expressing tumors (B16F10-GFP+LUC and RIL-175 LUC). Non-invasive visualization and intrahepatic tracking of tumor cell activity was performed using an in vivo bioluminescence imaging system (IVIS) (Xenogen IVIS 100 Imaging System, RRID:SCR_020901). Briefly, mice received 150mg/kg luciferin (REGIS Technologies, cat. #2591-17-5) i.p. and bioluminescence of intrahepatic tumors was measured 8 minutes after injection and analyzed using Xenogen’s IVIS living image program.

Tumor Models

Intrahepatic tumor cell injections were performed as described in detail elsewhere [21]. In brief, cell suspensions of luciferase expressing B16F10-GFP+Luc and RIL-175-Luc or CT26 cell lines were prepared and resuspended in a 1:1 mix of PBS and Matrigel (Corning, cat. #354230). Intrahepatic tumor establishment was achieved by injecting 20 μL containing 2–2.5 × 10⁵ tumor cells/animal into the left lateral liver lobe.

For the subcutaneous tumor model, 1×10⁶ B16F10-GFP+LUC) cells suspended in 100μL PBS were injected into the right flank of 8-week-old C57BL/6 females or 8–20 week old Mr1^−/− males. Mice were randomized prior to treatment initiation. Tumor size was measured as greatest diameter bi-weekly by a blinded examiner using a caliper. At d21, tumors were excised and weighed.

For the lung metastasis model, 2×10⁵ B16F10-GFP+LUC) cells suspended in 200 μL of PBS were injected intravenously into the tail vein of 8-week-old C57BL/6 mice. At d14, lungs were flushed with PBS to remove circulating blood cells and surface metastasis were counted by a blinded examiner.

Intraperitoneal injection of 5-OP-RU and CpG

The riboflavin pathway–derived antigen 5-OP-RU was synthesized as previously described [6]. 10 μg of Class B CpG Oligonucleotide (ODN 1826, Invivogen, cat. #tlrl-1826–1) was diluted in 100 μL of sterile PBS +/− 1 μM 5-OP-RU, which was diluted from a 10 mM stock solution immediately prior to intraperitoneal administration.

Isolation of hepatic, pulmonary and tumor-infiltrating mononuclear cells (MNCs)

Isolation of liver and tumor-infiltrating mononuclear cells was performed using previously reported protocols [22]. Briefly, after necropsy, tumor-bearing livers were removed and tumor nodules excised. Tumors and livers were weighed separately before livers were homogenized and filtered through 70μm nylon mesh. MNCs were separated from hepatocytes by density-gradient centrifugation using 90% Percoll (Cytiva, cat. #17089109). Intrahepatic tumors were excised from the surrounding liver tissue and isolation of tumor-infiltrating lymphocytes followed a separate protocol to distinguish between hepatic and tumor-infiltrating lymphocytes. Briefly, tumors were dissociated using a gentleMACS Octo Dissociator (Miltenyi gentleMACS Octo Dissociator Tissue Dissociator, RRID:SCR_020272). Samples were filtered through 100 μm and then 40 μm mesh filters prior to density-gradient centrifugation with Lympholyte Cell Separation Media (Cedarlane Laboratoriescat. #CL5035). Red blood lysis was achieved using ACK-lysis buffer (Quality Biologicals, cat. #118-156-101).

For the isolation of pulmonary MNCs, lungs were flushed with PBS prior to harvest. Lungs were then minced, followed by enzymatic digestion in RPMI (Thermofisher, cat. #21875034) containing 1 mg/ml Collagenase IV (Sigma Aldrich, cat. #C5138–1G), 1 mg/ml hyaluronidase (Sigma-Aldrich, cat. #H3506) and 50 U/ml DNase I (Stemcell Technologies, cat. #100–0762). After filtering through nylon mesh, pulmonary MNCs were separated from other parenchymal cells by density gradient centrifugation using 37% Percoll.

Flow cytometry

MR1-tetramers loaded with 5-OP-RU were kindly provided by the NIH tetramer core facility (Emory University). MHC class-I AH1_423–431/L^d tetramers (AH-1 tetramer) allowed us to detect antigen-specific CD8⁺ T cells reactive to the immunodominant antigen of the CT26 colon cancer cell line, gp70_423–431 (AH1) [23]. AH1 tetramers were also provided by the NIH tetramer core facility.

Fixable Viability dye ZOMBIE-UV (Biolegend, cat. #423108) was applied to cell suspensions for 20 min at 4 °C. After Fc-blocking (Biolegend, cat. #101302) for 15 minutes at 4°C, surface staining including tetramers was performed by incubating 1–2 × 10⁶ cells at 37°C for 30 min in staining buffer (BD Bioscience, cat. #554656). The following commercially available antibodies were used: anti-CD62L-PerCP/Cy5.5 (BioLegend, cat. #104432, RRID:AB_2285839), anti-CD44-PE/Cy7 (BioLegend, cat. #103030, RRID:AB_830787), anti-CD69-BV650 (BioLegend, cat. #104541, RRID:AB_2616934), anti-TCRβ-APC/Fire 750 (BioLegend, cat. #109246, RRID:AB_2629697), anti-NK1.1-PE (BioLegend, cat. #108708, RRID:AB_313395), anti-F4/80-Alexa Fluor 700 (BioLegend, cat. #123130, RRID:AB_2293450), anti-B220-Alexa Fluor 700 (BioLegend, cat. #103232, RRID:AB_493717), anti-CD11b-Alexa Fluor 700 (BioLegend, cat. #101222, RRID:AB_493705), anti-CD3-Alexa Fluor 594 (BioLegend, cat. #100240, RRID:AB_2563427), anti-CD4-BV605 (BioLegend, cat. #100451, RRID:AB_2564591), anti-CD4-AF700 (BD Biosciences, cat. #557956, RRID: AB_396956), anti-CD8-BV786 (BD Biosciences, cat. #563332, RRID:AB_2721167), anti-CD11b-Pacific Blue (BioLegend, cat. #101224, RRID:AB_755986), anti-Ly-6G-Alexa Fluor 700 (BioLegend, cat. #127622, RRID:AB_10643269), anti-Ly-6C-APC/Cy7 (BioLegend, cat. #128026, RRID:AB_10640120), and anti-FOXP3-APC (Thermo Fisher Scientific, cat. #17-5773-82, RRID:AB_469457).

For intracellular cytokine staining, cells were stimulated for 4h at 37°C with a commercially available leukocyte activation cocktail (BD Biosciences, cat. #550583) containing PMA and ionomycin as well as brefeldin A at a concentration of 2 μL/mL. After surface staining, cells were fixed and permeabilized using a Fixation/Permeabilization Solution Kit (eBioscience, cat. #88-8824-00). Cells were incubated in permeabilization buffer (part of the abovementioned kit) containing the following fluorochrome-labeled antibodies for half an hour at 4°C: anti-IFN-γ-APC (BioLegend, cat. #505810, RRID:AB_315404), anti-Perforin-APC (BioLegend, cat. #154304, RRID:AB_2721463), anti-Granzyme B-FITC (BioLegend, cat. #515403, RRID:AB_2114575), anti-IL17A-FITC (BioLegend, cat. #506908, RRID:AB_536010).

Data for all samples were collected on a CytoFLEX LX flow cytometer (Beckman Coulter CytoFLEX Flow Cytometer, RRID:SCR_019627) and analyzed using FlowJo software (FlowJo, RRID:SCR_008520).

In vivo stimulation using 5-OP-RU + CpG

Three weeks after implantation of orthotopic RIL-175, tumor-bearing mice were injected intravenously with 1 μM 5-OP-RU, 10 μg Class B CpG Oligonucleotide (ODN 1826) and Brefeldin A (500 μg/mouse) diluted in 200 μL PBS or DMSO control + Brefeldin A (also 500 μg/mouse) diluted in 200 μL PBS. Three hours after injection, mice were sacrificed and liver-infiltrating MNCs were isolated and stained for intracellular cytokines as outlined above.

MR1 expression on tumor cell lines

Tumor cell lines CT26, RIL-175 and B16F10-GFP+LUC were stimulated with 5-OP-RU at indicated molarities (see figure legends) dissolved in RPMI containing 10% FCS or left unstimulated in cell culture media for 4 hours prior to harvest as previously described [17]. MR1 surface expression was determined by flow cytometry using anti-MR1-APC (BioLegend, cat. #361108, RRID:AB_2563204) or isotype control (mouse IgG2a, κ, Biolegend, cat. #400222, RRID:AB_2891178) for surface staining.

Targeted knockout of MR1 in B16F10-GFP+LUC cells using CRISPR/Cas9-mediated gene editing

The B16F10-GFP+LUC melanoma cell line was selected for targeted knockout of MR1 due to increased surface expression upon 5-OP-RU stimulation. Single-guide RNAs (sgRNA) targeting protein coding exons of Mr1 (ENSMUST00000027744.9) were designed using sgRNA Scorer 2.0 [24]. Five candidates were selected for in vitro testing (Supplementary table S1). Briefly, in vitro transcribed sgRNAs were generated using the NEB HiScribe T7 Quick High Yield Synthesis Kit (NEB, cat. #E2050S), complexed with recombinant Cas9 protein (gift from Protein Expression Laboratory, Frederick National Lab), and subsequently transfected into P19 cells using Lipofectamine 2000 (Thermofisher, cat. #11668019). Seventy-two hours later, genomic DNA was harvested using Quick Extract (Lucigen, cat. #QE09050) and assessed for editing efficiency using Illumina sequencing, as previously described [24][25]. The analysis pipeline used is available here: https://github.com/rajchari2/ngs_amplicon_analysis. Oligonucleotides encoding the top candidate, Mr1-1913, as well as a non-targeting sgRNA (GTGTCGTGATGCGTAGACGG) were annealed and then ligated into the LentiCRISPRv2-mCherry vector using the T4 rapid ligase according to the manufacturer’s instructions (Enzymatics, cat. #L6030-HC-L). LentiCRISPRv2-mCherry was a gift from Agata Smogorzewska (Addgene plasmid #99154; http://n2t.net/addgene:99154; RRID:Addgene_99154). The cloned guide RNA plasmid targeting Mr1 as well as the non-targeting plasmid have been deposited into Addgene (Addgene #172525 and #172526, respectively).

Analysis of Mr1 knockout clones

Lentiviral vectors encoding the CRISPR/Cas9 construct, the sgRNA (either targeting the Mr1 gene locus or control sgRNA) and mCherry were transfected into B16F10-GFP+LUC cells using Lipofectamine3000 (Invitrogen, cat. #L3000015) according to the manufacturer’s instructions. 72 hours post transfection, cells were harvested and single, live, mCherry⁺ cells were sorted into single wells of a 96-well plate on a BD Influx (BD). Monoclonal B16F10-GFP+LUC-Mr1^−/− or B16F10-GFP+LUC-Mr1^WT cell lines were generated and loss of MR1 protein surface expression was confirmed by flow cytometry after stimulation with 5-OP-RU (see MR1 expression on tumor cell lines).

Additionally, indel occurrence was confirmed by targeted next-generation sequencing (NGS) of genomic DNA (gDNA). Isolation of gDNA from tumor cells was performed using a AllPrep DNA/RNA Mini Kit (Qiagencat. #80204) according to the manufacturer’s instruction. 20 ng of gDNA from knockout clones and control clones were amplified using the primers listed in Supplementary Table S2 and analyzed using Illumina sequencing to confirm the presence of insertions/deletions using the analysis pipeline described earlier [24,25]. Illumina sequencing was performed using the Illumina MiSeq machine using the MiSeq Nano 300 cycle kit and 2 × 150 bp read length configuration. The summary of edited alleles is listed in Supplementary Table S3.

Statistical analysis

Sample sizes for animal studies were guided by previous studies with similar or identical tumor models. For all readouts, examiners were blinded. Statistical analysis was performed using GraphPad Prism 9 (GraphPad Prism, RRID:SCR_002798). The differences between groups were tested either by an unpaired Student’s t test or one-way ANOVA (with a Tukey’s multiple comparison post-test). P<0.05 was considered statistically significant.

RESULTS

A 5-OP-RU + CpG combination induces MAIT-cell expansion and activation in vivo.

To stimulate and expand MAIT cells in vivo, we used a combination of 5-OP-RU and the TLR9 agonist CpG (ODN1826) [6]. Naïve mice received intraperitoneal 5-OP-RU + CpG or each reagent alone twice a week for three weeks. MAIT cells were detected using mouse MR1 tetramers loaded with 5-OP-RU and defined as B220⁻F4/80⁻CD11b⁻CD3⁺TCRβ^intMR1-5-OP-RU tetramer⁺ by flow cytometry analysis (Fig.1A, gating strategy displayed in Supplementary Fig.S1A). We focused our study primarily on hepatic MAIT cells given the relative abundancy of MAIT cells in human livers. Consistent with previous reports [5,6], neither 5-OP-RU nor CpG alone expanded MAIT cells, but the 5-OP-RU + CpG combination resulted in up to 70-fold expansion of hepatic MAIT cells (Fig.1B). The hepatic MAIT cells significantly upregulated expression of the surface activation marker CD69 (Fig.1C) and showed a pronounced effector memory (CD44⁺CD62L⁻) phenotype (Fig.1D). These findings indicated a change of functional status upon MAIT-cell activation. MAIT cells produce both antitumor molecules such as granzymes, perforin and IFNγ [26], and potentially tumor-promoting factors such as IL17A, which has been reported to lead to NK-cell dysfunction and mediate MAIT cell–driven tumor progression [17]. Therefore, we studied the expression of these molecules in MAIT cells. After treatment with 5-OP-RU + CpG, hepatic MAIT cells significantly increased production of IFNγ, granzyme B and perforin, whereas IL17A expression decreased (Fig.1E–H). These findings point toward MAIT cells switching from a Th₁₇-like phenotype to a Th₁/NK-like phenotype as a result of co-stimulation using 5-OP-RU + CpG.

Figure 1: 5-OP-RU and CpG co-stimulation induces systemic MAIT-cell expansion and activation in vivo.

(A) C57BL/6 mice were treated intraperitoneally (i.p.) with PBS (Control, n=6) or a combination of 5-OP-RU (1 μM in 100 μL PBS) and 10 μg CpG (n=8) starting on day 0 and then twice a week. At d21, livers were harvested and analyzed by flow cytometry. Shown are representative flow cytometry dot plots of one mouse per group showing hepatic MAIT cells (defined as B220⁻F4/80⁻CD11b⁻CD3⁺TCRβ^intMR1-5-OP-RU tetramer⁺, see Supplementary Fig.S1A for gating strategy).

(B) C57BL/6 mice were treated i.p. with PBS (Control, n=6), CpG 10 μg (n=6), 1 μM 5-OP-RU in 100 μL PBS (n=6) or the combination 5-OP-RU + CpG (n=8) on d0 and then twice weekly. At d21, livers were harvested, and MAIT-cell numbers were determined by flow cytometry. ****p<0.0001, one-way ANOVA.

(C, D) C57BL/6 mice were treated i.p. with PBS (Control, n=7) or CpG + 5-OP-RU (n=7) for 21 days (treatment schedule as in B), at which point livers were harvested and analyzed by flow cytometry. (C) Frequency of CD69⁺ hepatic MAIT cells. ****p<0.0001, Student’s t test. (D) Frequency of CD62L⁻/CD44⁺ hepatic MAIT cells. ****p<0.001, Student’s t test.

(E-H) Treatment schedule setup as in (A). Hepatic MAIT cells (defined as B220⁻F4/80⁻CD11b⁻CD3⁺TCRβ^intMR1-5-OP-RU tetramer⁺) were stimulated ex vivo with PMA/Ionomycin in the presence of Brefeldin A and then analyzed by flow cytometry. Shown are representative flow cytometry dot plots (left) or summary graphs (right) for indicated cytokines/effector molecules (E) IFNγ, (F) granzyme B (for both: control n=8 vs. 5-OP-RU + CpG n=8) i.p. treatment is shown), (G) perforin (control n=5 vs. 5-OP-RU + CpG n=4)and (H) IL17A Control (n=4) and 5-OP-RU + CpG (n=5) i.p. treatment is shown. *p<0.05, **p<0.01, ****p<0.0001, Student’s t test.

(I, J) C57BL/6 mice were treated i.p. with PBS (Control, n=9) or the combination of 5-OP-RU + CpG (n=10) starting from d0 and then twice weekly. At d14 lungs were harvested and analyzed by flow cytometry. (I) MAIT-cell frequency. ****p<0.0001, Student’s t test. (J) Frequency of CD69⁺ MAIT cells. ****p<0.0001, Student’s t test.

All data presented as mean ± SEM. Pooled data from two independent experiments is shown in B–F, I, and J, data from one representative experiment is shown in G and H.

MAIT-cell expansion and activation were also assessed in other organs. The lung is another site with an enrichment of MAIT cells, and 5-OP-RU + CpG treatment significantly increased MAIT-cell frequency in the lung (Fig.1I). Like expanded hepatic MAIT cells, expanded pulmonary MAIT cells had higher CD69 expression (Fig.1J). Taken together, our results demonstrate that 5-OP-RU + CpG intraperitoneal administration results in systemic expansion and activation of MAIT cells in vivo.

Activating MAIT cells inhibits tumor growth

Next, we tested whether stimulating MAIT cells using 5-OP-RU + CpG can be used to treat malignant tumors. An established liver metastasis model was used in which B16F10-GFP+LUC melanoma cells were introduced by intrahepatic implantation into C57BL/6 WT mice [22]. The B16F10-GFP+LUC tumor cells express luciferase, which allowed us to monitor tumor burden using a non-invasive imaging assay [19]. The treatment schedule of tumor-bearing mice is illustrated in Fig.2A. Endpoint measurement of tumor weight showed a significant reduction of liver tumor burden upon combination therapy but not with CpG or 5-OP-RU monotherapy (Fig.2B). We saw that growth of intrahepatic B16F10-GFP+LUC tumors was significantly delayed in 5-OP-RU + CpG treated mice when tumor growth was measured by in vivo bioluminescence imaging over time (Fig.2C). 5-OP-RU + CpG treatment also significantly prolonged survival of tumor-bearing mice (Fig.2D). To investigate whether the antitumor function of 5-OP-RU + CpG treatment was dependent on MAIT cells, we repeated the study including MAIT cell–deficient Mr1^−/− mice. As hypothesized, in the absence of MAIT cells, 5-OP-RU + CpG treatment failed to inhibit hepatic B16F10-GFP+LUC tumor growth (Fig.2E). In accordance with previous reports [17], tumor burden in untreated Mr1^−/− mice was significantly lower compared with tumor burden in untreated WT mice, indicating that without activation, MAIT cells may have tumor-promoting functions.

Figure 2: Activating MAIT cells inhibits tumor growth in a B16F10-GFP+LUC liver metastasis model.

(A) Experimental setup: 2–2.5 × 10⁵ B16F10-GFP+LUC tumor cells were injected intrahepatically in C57BL/6 or Mr1^−/− mice on d0. Mice were injected i.p. with PBS (Control), CpG 10 μg (CpG mono), 1 μM 5-OP-RU in 100 μL PBS (5-OP-RU mono) or combination 5-OP-RU + CpG (5-OP-RU + CpG) at the indicated time points.

(B) 21 days after intrahepatic tumor-cell inoculation, tumor-bearing livers were harvested, and the weights of the intrahepatic tumors were measured. Comparison between control (n=19), CpG mono (n=16), 5-OP-RU mono (n=16) vs 5-OP-RU + CpG (n=23). The photo on the right shows a representative image of intrahepatic tumors at d21 (n=4 per group). Pooled data from 3 independent experiments is shown. ***p<0.001, ****p<0.0001, one-way ANOVA.

(C) Tumor growth of intrahepatic B16F10-GFP+LUC tumor cells using bioluminescence in vivo imaging comparing control (n=12) vs treatment (5-OP-RU + CpG, n=13). Growth curve represents pooled data from two independent experiments. Representative bioluminescence images of 4 mice per group at d20 are shown. **p<0.01, Student’s t test.

(D) Kaplan-Meier curves comparing survival of C57BL/6 mice with intrahepatic B16F10-GFP+LUC tumors. ***p<0.001, log-rank (Mantel–Cox) test.

(E) C57BL/6 (Wildtype) mice or Mr1^−/− with intrahepatic B16F10-GFP+LUC) cells. Comparison between control vs treatment (5-OP-RU + CpG, n=15 in all groups). On day 14 relative to tumor-cell inoculation, tumor-bearing livers were harvested, and the weights of intrahepatic tumors were determined. Pooled data from three independent experiments is shown. ****p<0.0001, p<0.05, one-way ANOVA.

To test if the observed antitumor effect was limited to the liver, we extended our study to other tumor models. Lung metastases were induced by intravenous delivery of B16F10-GFP+LUC tumor cells. Consistent with our findings in the liver, 5-OP-RU + CpG treatment significantly reduced the number of lung surface metastases (Fig.3A). Beyond this, tumor growth of subcutaneous B16F10-GFP+LUC tumors was significantly suppressed by 5-OP-RU + CpG combination treatment, but not by CpG monotherapy (Fig.3B, left). Such reduction of tumor growth was absent in Mr1^−/− mice (Fig.3B, right).

Figure 3: Activating MAIT cells inhibits tumor growth in various tumor models across different mouse strains.

(A) C57BL/6 mice received 2 × 10⁵ B16F10-GFP+LUC cells intravenously on d0. Intraperitoneal treatment with PBS (n=6) or a combination of 5-OP-RU (1 μM in 100 μL PBS) and 10 μg CpG (n=7) was initiated the same day. On d14 relative to tumor-cell inoculation, lungs were harvested, and metastases were counted on the lung surface. Data from one representative experiment is shown, the experiment was repeated twice. *p<0.05, Student’s t test.

(B) Female C57BL/6 mice (left panel) or male Mr1^−/− mice (right panel were injected with 1 × 10⁶ B16F10-GFP+LUC in the right flank. Intraperitoneal treatment with PBS (WT: n=18, Mr1^−/−: n=6), CpG 10 μg (CpG mono, WT n=15, Mr1^−/−: n=4), or a combination of 5-OP-RU + CpG (5-OP-RU + CpG, WT: n=18, Mr1^−/−: n=5) was administered starting d0 and then twice a week. Tumor size was measured at the indicated time points using a caliper. The data show the mean tumor size (mm) at the largest diameter. Pooled data from three independent experiments are shown for WT mice and two independent experiments for Mr1^−/− mice. **p<0.01, one-way ANOVA.

(C) Intrahepatic injection of 2.5 × 10⁵ RIL-175 luciferase-expressing HCC cells into female albino B6(Cg)-Tyr<c-2J>/J mice (left panel) or male Mr1^−/− mice (right panel). Intraperitoneal treatment with PBS (WT: n=12, Mr1^−/−: n=6), CpG 10 μg (CpG mono, WT n=6, Mr1^−/−: n=5), or a combination of 5-OP-RU + CpG (5-OP-RU + CpG, WT: n=14, Mr1^−/−: n=5) was administered starting d0 and then twice a week. On day 19 relative to tumor-cell inoculation, tumor-bearing livers were harvested and weighed. Pooled data from two independent experiments are shown for WT mice and one experiment for Mr1^−/− mice. **p<0.01, one-way ANOVA.

(D) Intrahepatic injection of 2.5 × 10⁵ CT26 cells into BALB/c mice. Intraperitoneal treatment with PBS (Control, n=6) 5-OP-RU + CpG (n=5) was given bi-weekly starting d0. On day 19 relative to tumor-cell inoculation, tumor-bearing livers were harvested and weighed. Data from one representative experiment is shown, the experiment was repeated twice. *p<0.05, Student’s t test.

All data presented in (A–D) as mean ± SEM.

HCCs comprise the majority (75–85%) of primary liver malignancies. As such, we used a murine orthotopic HCC model to test the efficacy of MAIT cell–activating immunotherapy to treat liver cancer. Murine HCC tumor cells, RIL-175, were injected into livers of C57BL/6 mice, and tumor-bearing mice were given either control treatment, CpG monotherapy or combination 5-OP-RU + CpG. Consistently, 5-OP-RU + CpG combination treatment caused a robust reduction of RIL-175 tumor weight, whereas CpG monotherapy had very little effect on intrahepatic RIL-175 tumor growth (Fig.3C, left). In accordance with the findings in our other tumor models, addition of 5-OP-RU to CpG treatment did not significantly reduce RIL-175 tumor burden in mice that lack MAIT cells (Fig.3C, right).

To rule out strain-specific effects, a similar study was performed using BALB/c mice. These mice received intrahepatic injection of syngeneic colon cancer CT26 cells. Again, activating MAIT cells using 5-OP-RU + CpG decreased CT26 intrahepatic tumor weights significantly (Fig.3D).

Taken together, these findings suggest that activating MAIT cells using a combination of 5-OP-RU + CpG but not either agent alone results in broad antitumor function in several tumor models and across different mouse strains.

MAIT-cell activation alters the immune-cell tumor microenvironment

Immune-cell monitoring using flow cytometric analysis of tumor-infiltrating cells was performed to monitor numeric and functional changes of potential effector cells. As expected, an increased infiltration of MAIT cells into hepatic B16F10-GFP+LUC tumors was found after 5-OP-RU + CpG treatment in C57BL/6 mice but not in Mr1^−/− mice (Fig.4A, Supplementary Fig.S1B). In addition, the number of tumor-infiltrating MAIT cells per gram of tumor was negatively correlated with tumor weight (Fig.4B) supporting their antitumor role. Next, MAIT cells were stimulated in vivo with 5-OP-RU + CpG in the presence of Brefeldin A to study cytokine production in vivo in tumor-bearing mice. We found that IFNγ production by MAIT cells derived from mice treated with 5-OP-RU + CpG was increased compared with IFNγ production by MAIT cells derived from mice not treated with 5-OP-RU + CpG (Fig.4C). No change in IFNγ production was observed in CD8⁺ T cells (Supplementary Fig.S1C).

Figure 4: Immune-cell monitoring after MAIT-cell activation in tumor-bearing mice.

(A, B) The same experimental setup described in Fig.2A was used. In brief, C57BL/6 mice were administered intrahepatic injections of B16F10-GFP+LUC tumor cells. On d21 relative to tumor-cell inoculation, tumors were harvested, and the number of tumor-infiltrating MAIT cells was determined by flow cytometry (A). Comparison between control (n=20) vs treatment (5-OP-RU + CpG, n=23). **p<0.01, Student’s t test. (B) Correlation between number of tumor-infiltrating MAIT cells and tumor weight is shown. Linear regression, Spearman correlation coefficients and p values for comparison of MAIT-cell number per gram tumor and tumor weights are shown. Each point represents one tumor sample, with corresponding MAIT counts.

(C) Three weeks after inoculation with orthotopic RIL-175, tumor-bearing mice were injected i.v. with 1 μM 5-OP-RU, 10 ug CpG and Brefeldin A (500 μg/mouse) diluted in 200 μL PBS (n=6) or DMSO control + Brefeldin A (also 500 μg/mouse, n=5) diluted in 200 μL PBS. Mice were sacrificed 3 hrs post injection. Intracellular expression of IFNy in MAIT cells was determined by flow cytometry without further ex vivo stimulation. Representative dot plot (left) and summary graph (right) is shown. Comparison between control (n=5) vs 5-OP-RU + CpG (n=6). **p<0.01. Student’s t test

(D, E) Experimental setup and groups as in (A). Number of tumor-infiltrating CD4⁺ (D) and CD8⁺ (E) T cells is shown.

(F, G) Experimental setup as in Fig.3D. On d19 relative to tumor-cell inoculation, tumors were harvested, and the frequency of hepatic AH1 tetramer⁺ CD8⁺ T cells was determined by flow cytometry (F). Comparison between control (n=13) vs treatment (5-OP-RU + CpG, n=13). *p<0.05. student’s t-test. (G) Correlation between number of hepatic AH1 tetramer⁺ CD8⁺ T cells and tumor weight is shown. Linear regression, Spearman correlation coefficients and p values for comparison of hepatic antigen-specific CD8⁺ T cell number and tumor weights are shown. Each point represents one tumor sample, with corresponding MAIT-cell numbers. Data from one representative experiment is shown.

(H, I) Experimental setup as in A. Number of hepatic iNKT cells (H) as determined by CD1d-tetramer staining and number of tumor-infiltrating NK cells (I) is shown. Comparison between control (n=14) vs treatment (5-OP-RU + CpG, n=15). *p<0.05. Student’s t test.

(J) Experimental setup as in (A). Shown are representative flow cytometry dot plots for Perforin⁺ NK cells (left) and summary plot (right) displaying frequency of Perforin⁺ hepatic NK cells after treatment with CpG + 5-OP-RU for 14 days. Comparison between control (n=4) vs treatment (5-OP-RU + CpG, n=5). *p<0.05, Student’s t test.

All data presented as mean ± SEM. Pooled data from three independent experiments are shown for A, B, D, H, and I, two independent experiments for F and G. Data from one representative experiment is shown for C and J, the experiment was repeated twice.

Increased numbers of CD8⁺ T cells but not CD4⁺ cells were detected in hepatic B16F10-GFP+LUC tumors after 5-OP-RU + CpG treatment in C57BL/6 mice (Fig.4D&E). CD8⁺ T cells play a critical role in antitumor immunity. Using the CT26 tumor model, tumor antigen gp70_423–431 (AH1) specific CD8⁺ T cells were detected via MHC class-I AH1_423–431/L^d tetramers (AH-1 tetramer) [23]. The frequency of tumor-specific, AH1-tertramer⁺ CD8⁺ T cells in the liver increased after 5-OP-RU + CpG treatment (Fig.4F). Moreover, the presence of these hepatic AH1-tetramer⁺ CD8⁺ T cells strongly correlated with reduced tumor burden in this model (Fig.4G), suggesting that CD8⁺ T cells may contribute to the antitumor effects of 5-OP-RU + CpG combination treatment at least in the CT26 tumor model. Another important and potential cytotoxic effector cell that is abundant in murine livers, invariant Natural Killer T (iNKT) cells, did not accumulate in hepatic B16F10-GFP+LUC tumors upon combination 5-OP-RU + CpG treatment in C57BL/6 mice (Fig.4I). We also investigated the role of hepatic NK cells in our model, since the cross-talk between CD8⁺ T cells, NK cells and MAIT cells has been reported to modulate tumor progression [17]. In our study, tumor-infiltrating NK cells accumulated in hepatic B16F10-GFP+LUC tumors after combination 5-OP-RU + CpG treatment in C57BL/6 mice (Fig.4I) and hepatic NK cells produced more perforin in tumor-bearing mice treated with 5-OP-RU + CpG, indicating an enhanced antitumor cytotoxicity of these cells (Fig.4J). Immune-cell monitoring of potentially immunosuppressive cells revealed that regulatory T cells were increased in the livers of mice treated with 5-OP-RU + CpG, whereas M-MDSCs and PMN-MDSCs showed no changes (Supplementary Fig.S2A). We also investigated the immune-cell tumor microenvironment (TME) of Mr1^−/− tumor bearing mice upon 5-OP-RU + CpG treatment. Here, we detected no changes in CD4⁺ T cell, CD8⁺ T cell, iNKT or NK cell infiltrates compared with mock treatment, pointing toward a MAIT cell–mediated effect that was observed in the WT mice (Supplementary Fig.S2B).

Taken together, our results indicate that MAIT cell-mediated protection against tumors is accompanied by complex changes in the immune tumor environment with an accumulation of a variety of potential cytotoxic cells, including CD8 T cells and NK cells.

MAIT cell–mediated antitumor immunity is independent of tumor-cell MR1 expression

To investigate whether the observed inhibition of tumor growth by combination 5-OP-RU + CPG treatment was mediated by a direct interaction of the MAIT-cell TCR with MR1 on tumor cells, we first measured baseline expression of MR1 on the cancer cell lines used in this manuscript. We found all three cell lines (B16F10-GFP+LUC, RIL-175 and CT26) expressed low but detectable levels of MR1 on the cell surface as determined by flow cytometry (Fig.5A). As previously described [17], stimulation with increasing concentrations of 5-OP-RU led to upregulation of MR1 on the surface of the B16F10-GFP+LUC melanoma cell line in a dose dependent manner. Such effects were not be seen for the RIL-175 and CT26 cell lines (Fig.5A). As previously reported [17,27,28], we found baseline surface expression of MR1 on other potential antigen-presenting cells, including macrophages, B cells, MDSCs and dendritic cells, hard to detect by flow cytometry (Supplementary Fig.S2C).

Figure 5: MAIT cell–mediated antitumor immunity is independent of MR1 expression on tumor cells.

(A) B16-F10, RIL-175 and CT26 tumor cells were stimulated in vitro with increasing concentrations of 5-OP-RU for 4h or left unstimulated. MR1 expression on the surface of tumor cells was determined by flow cytometry and compared to isotype control staining.

(B) An MR1-deficient B16F10-GFP+LUC [sgRNA(MR1^−/−)] tumor cell line was generated using CRISPR/Cas9 guided gene editing and compared to parenteral B16F10 (WT) cells and an empty-vector [sgRNA(MR1^WT)] clonal cell line. Loss of MR1 surface expression on clonal cells was confirmed by flow cytometry after 5-OP-RU ligand stimulation.

(C) C57BL/6 mice were administered intrahepatic injections of 2 × 10⁵ B16F10-GFP+LUC [sg(MR1^−/−)] cells or empty vector control tumor cells (B16F10-GFP+LUC [sgRNA(MR1^WT)]). Treatment with 5-OP-RU + CpG (n=9 for Mr1^WT and n=10 for Mr1^−/−) as in Fig.2A or control (n=9 for Mr1^WT and n=10 for Mr1^−/−) starting d0 and then twice a week. Tumors were harvested at d14 post implantation. Pooled data from two independent experiments are shown. **p<0.01, ****p<0.0001, one-way ANOVA.

Data presented in (C) as mean ± SEM.

Thus, we decided to knockout Mr1 in B16F10-GFP+LUC cells using CRISPR/Cas9-mediated gene editing. We generated a clonal MR1-deficient B16F10-GFP+LUC-Mr1^−/− (sgRNA(MR1^−/−)) tumor cell line as well as a B16F10-GFP+LUC-Mr1^WT (sgRNA(MR1^WT)) clonal cell line using an empty-vector sgRNA. Successful knockout was confirmed by targeted NGS sequencing of the Mr1 locus (Supplementary Tables S1–S3). Loss of MR1 surface expression on clonal cells was confirmed by flow cytometry after 5-OP-RU stimulation and compared with the parenteral B16F10 cell line (Fig.5B). Next, we tested the effect of 5-OP-RU + CpG treatment on Mr1-knockout tumor cells. 5-OP-RU + CpG effectively decreased disease burden in both B16F10-GFP+LUC-Mr1^−/− and B16F10-GFP+LUC-Mr1^WT tumor models (Fig.5C), indicating that the MAIT cell–mediated antitumor effect was independent of direct engagement of the MAIT-cell TCR and MR1 on tumor cells.

DISCUSSION

Tumor-infiltrating MAIT cells are found in various cancers [11,12,14]. Although the function of MAIT cells in cancer remains unclear, in vitro stimulated MAIT cells produce increased levels of antitumor effector molecules and possess a tumor-lytic function suggesting that activating MAIT cells could be potentially used to treat cancer. The MAIT cell–activating approach is particularly interesting because MAITs can be selectively stimulated with a combination of 5-OP-RU and a TLR9 agonist. In this study, we have provided in vivo evidence that activated and expanded MAIT cells promote broad antitumor immunity.

First, we used a combination of the riboflavin synthesis pathway–derived antigen 5-OP-RU and the TLR9 agonist CpG to activate these cells. Our findings confirmed that monotherapy 5-OP-RU or CpG was not sufficient to expand the MAIT-cell fraction in mice [5,6]. This may reflect a requirement for co-stimulation or the fact that 5-OP-RU is unstable in nature and might fail to produce sufficient MAIT-cell stimulation without adjuvant treatment. We showed that TCR-mediated and co-stimulation-dependent activation of MAIT cells licensed them to increase Th₁-cytokine production and enhanced expression of cytolytic perforin and granzyme B, a mechanism known from infectious disease models [29] [30]. IL17A produced by MAIT cells has previously been attributed to mediating NK-cell dysfunction in murine tumor models [17]. We found IL17A expression in activated MAIT cells to be downregulated upon combination treatment with 5-OP-RU and CpG, indicating that fine-tuned, context-dependent mechanisms determine MAIT-cell function in vivo.

Next, we found that in three different murine tumor models (liver tumors, lung metastases and subcutaneous tumors) as well as two different mouse strains, MAIT cell–directed 5-OP-RU + CpG combination treatment, but not treatment with CpG or 5-OP-RU monotherapy, showed pronounced and consistent antitumor activity and prolonged survival. Antitumor effects of MAIT cells have thus far only been observed in in vitro experiments by co-culturing activated MAIT cells with tumor cells [14,18]. The antitumor effects seen here are surprising given the fact that mice have extremely low overall MAIT-cell counts at baseline compared with humans. In mice, increased numbers of activated MAIT cells correlated with favorable outcome in our studies. Our findings have revealed the vast potential of licensed and educated MAIT cells for cancer immunotherapy. This is of interest, since unlike conventional T cells that are restricted by the HLA-barrier, MAIT cell–directed, MR1-captured ligands could work beyond HLA restriction in genetically diverse populations [16].

In our study, we demonstrated that the efficacy of MAIT cell–directed immunotherapy using 5-OP-RU + CpG did not depend on MR1 expression on tumor cells, indicating an indirect mechanism of action, rather than MAIT-TCR engagement with MR1 on tumor cells. In a previous study, loss of MR1 expression on B16F10 cells decreased their potential to form lung metastasis [17], indicating that MAIT-cell inhibition might be mediated by tumor cells via MR1, whereas MAIT-cell activation might be mediated by another antigen-presenting cell that has not yet been determined.

Our results show that 5-OP-RU + CpG combination treatment of murine tumors increased immune-cell infiltration and improved cytotoxic function of various potential immune effector cells. NK cells and CD8⁺ T cells might, thus, be additional intermediaries of this MAIT cell–mediated therapeutic effect. It has previously been proposed that MAIT cell–NK cell interactions inhibit NK-cell function in the absence of MAIT-cell stimulation [17]. Here, we provide further insight into this interaction and show that this interplay is context-dependent and, importantly, could potentially be reversed by MAIT-cell activation.

To sum up, we provide a framework for how a TCR-dependent pathogenic role of MAIT cells in malignancies can be overcome using stimulatory agents. These findings pave the way for further development of MAIT cell–directed immunotherapeutic approaches for cancer.

Synopsis:

In vitro evidence suggests mucosal-associated invariant T (MAIT) cells can have antitumor function. This study shows MAIT cells stimulated in vivo using 5-OP-RU and CpG orchestrate potent antitumor responses, suggesting these cells as potential targets for cancer immunotherapy.