Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Sep 6.
Published in final edited form as: J Clin Immunol. 2017 May 15;37(5):445–451. doi: 10.1007/s10875-017-0399-1

Deficiency of Interleukin-1 Receptor Antagonist (DIRA): Report of the First Indian Patient and a Novel Deletion Affecting IL1RN

Leonardo O Mendonca 1, Louise Malle 2, Frank X Donovan 3, Settara C Chandrasekharappa 3, Gina A Montealegre Sanchez 2, Megha Garg 2,4, Ulf Tedgard 5, Mariana Castells 6, Shiv S Saini 7, Sourabh Dutta 7, Raphaela Goldbach-Mansky 2, Deepti Suri 7, Adriana A Jesus 2
PMCID: PMC8420971  NIHMSID: NIHMS1735996  PMID: 28503715

Abstract

Purpose

Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autoinflammatory disease caused by autosomal recessive mutations in IL1RN. DIRA presents clinically with early onset generalized pustulosis, multifocal osteomyelitis, and elevation of acute phase reactants. We evaluated and treated an antibiotic-unresponsive patient with presumed DIRA with recombinant IL-1Ra (anakinra). The patient developed anaphylaxis to anakinra and was subsequently desensitized.

Methods

Genetic analysis of IL1RN was undertaken and treatment with anakinra was initiated.

Results

A 5-month-old Indian girl born to healthy non-consanguineous parents presented at the third week of life with irritability, sterile multifocal osteomyelitis including ribs and clavicles, a mild pustular rash, and elevated acute phase reactants. SNP array of the patient’s genomic DNA revealed a previously unrecognized homozygous deletion of approximately 22.5 Kb. PCR and Sanger sequencing of the borders of the deleted area allowed identification of the breakpoints of the deletion, thus confirming a homozygous 22,216 bp deletion that spans the first four exons of IL1RN. Due to a clinical suspicion of DIRA, anakinra was initiated which resulted in an anaphylactic reaction that triggered desensitization with subsequent marked and sustained clinical and laboratory improvement.

Conclusion

We report a novel DIRA-causing homozygous deletion affecting IL1RN in an Indian patient. The mutation likely is a founder mutation; the design of breakpoint-specific primers will enable genetic screening in Indian patients suspected of DIRA. The patient developed anaphylaxis to anakinra, was desensitized, and is in clinical remission on continued treatment.

Keywords: Deficiency of interleukin-1 receptor antagonist, DIRA, IL1RN, SNP array, homozygous deletion

Introduction

Autoinflammatory diseases are a group of disorders caused by dysregulation of the innate immune system, resulting in systemic inflammation [1]. Deficiency of interleukin-1 receptor antagonist (DIRA) is a very rare autosomal recessive autoinflammatory disease first described in 2009 [2, 3]. DIRA presents in early childhood with marked skin and bone involvement, and systemic inflammation with elevation of acute phase reactants. To date, no untreated patients have lived to adulthood. DIRA is caused by loss-of-function mutations in IL1RN, which encodes the endogenous interleukin-1 (IL-1) receptor antagonist (IL-1Ra). IL-1Ra deficiency results in unopposed pro-inflammatory signaling via IL-1 and the IL-1 receptor (IL-1R1) [2] that can escalate to life-threatening systemic inflammation, systemic inflammatory response syndrome (SIRS), and death if untreated [2, 4-8]. The mortality of untreated DIRA based on published reports is over 30% in early infancy (summarized in Table 1). IL-1 blockade results in complete disease remission [2, 3, 5, 7]. The detection of mutations in IL1RN is diagnostic and mandatory for a definitive diagnosis. Nineteen patients with DIRA and nine different disease-causing mutations have thus far been reported [8-10] (Table 1). In the present study, we describe the first Indian patient with DIRA, who harbors a novel homozygous 22 Kb deletion spanning four exons (two coding) of IL1RN.

Table 1.

Summary of published DIRA patients, their disease-causing mutations and outcomes

Gender
(n = 18)
Age of first
symptoms
(days)
Age or disease
outcome at time
of report
Country of
origin
Mutation Reference
Female – Aborted Turkey c.355C>T; p.Gln119* 4
Male 7 Deceased Turkey c.355C>T; p.Gln119* 4
Male 14 13 months Canada c.156_157del; p.Asn52Lysfs*25 2
Male 0 Deceased Netherlands c.229G>T; p.Gly77* 2
Female 14 7.2 years Netherlands c.229G>T; p.Gly77* 2
Male 0 Deceased Netherlands c.229G>T; p.Gly77* 2
Female 2 Deceased Netherlands c.229G>T; p.Gly77* 2
Female 17 2 months Netherlands c.229G>T; p.Gly77* 2
Male 5 1.8 years Lebanon c.160C>T; p.Gln54* 2
Male 2 4 months Lebanon c.160C>T; p.Gln54* 2
Male 8 9.5 years Puerto Rico c.−64_1696del; p.IL1F9_IL1RNdel 2
Male 10 18 months Puerto Rico c.−64_1696del; p.IL1F9_IL1RNdel 3
Male 14 15 years Puerto Rico c.−64_1696del; p.IL1F9_IL1RNdel 5
Male 60 5 months Puerto Rico c.−64_1696del; p.IL1F9_IL1RNdel 6
Female 0 30 months Brazil c.213_227delAGATGTGGTACCCAT; p.Asp72_Ile76del 7
Female 0 27 months Brazil c.213_227delAGATGTGGTACCCAT; p.Asp72_Ile76del 7
Male 12 23 days USA c.229G>T; p.Gly77* and c.140delC; p.T47TfsX4 in compound heterozygosity 8
Female 12 months 13 years Turkey c.76C>T; p.Arg26* 10

An additional DIRA patient has been included in Infevers database (http://fmf.igh.cnrs.fr/ISSAID/infevers/) as a personal communication from Berdeli A, Sozeri B, Mir S, Atan, M, and Tigli D. This patient has the following variant in Il1RN: c.396delC; p.Thr133Profs

*

118

Methods

Patient

The parents provided consent and the patient was enrolled into an IRB-approved NIH natural history protocol (NCT02974595).

Genetic Analysis

SNP Array

Peripheral blood genomic DNA was obtained from the patient and genotyped for the detection of copy number variations (CNVs) by a high-density single nucleotide polymorphism (SNP) array technique. The DNA sample (~300 ng) was genotyped following the Illumina “infinium assay” protocol [11]. This assay includes whole-genome amplification and fragmentation of DNA, hybridization to the BeadChip with specific oligonucleotide probe array (50-mers), enzymatic extension of the 3′ terminal base for incorporation of the allele-specific nucleotide, detection with fluorescently tagged reagent, and signal amplification. The allele type and intensity were collected using iScan and processed by the GenomeStudio (v2011.1, www.Illumina.com) genotyping module. The sample was run on the HumanOmniExpressExome-8v1.2_A Illumina BeadChip, containing 964,193 SNPs. After filtering by GenTrain Score, removing SNPs with a score below 0.7, there were 941,817 SNPs remaining to be used in analysis. cnvPartition v3.2 was used to call copy number aberrations using the following settings: minimum number of contiguous SNPs = 4, GC wave adjust = TRUE, and minimum confidence value = 0. Using the confidence value from the cnvPartition output, copy number variations were filtered based on the following criteria: if CN = 0, then confidence value ≥200; if CN = 1, then confidence value ≥15; if CN = 3, then confidence value ≥30. The detected aberrations were visually evaluated using Nexus Copy Number (v7.5, www.biodiscovery.com) to substantiate their validity.

PCR and Sequencing of Breakpoints

Multiple primer sets were designed using Primer3Plus, flanking the breakpoint regions as determined by SNP array. Amplification reactions were carried out with 20–200 ng of genomic DNA using GoTaq Hot Start Master Mix (Promega, Madison, WI) for 35 cycles: denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1.5 min. Amplification products were analyzed by 2% agarose gel electrophoresis, and forward and reverse primers closest to the 5′ and 3′ end of the deletion, respectively, were used to obtain new amplicons. These PCR products underwent a second PCR reaction with ABI Prism® BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and directly sequenced in both directions using ABI 3100 Genetic Analyzer (Applied Biosystems). Results were analyzed using DNAStar Lasergene software.

Results

Case Report

A 5-month-old north Indian Hindu girl born to healthy non-consanguineous parents, with a birth weight of 3.1 kg and normal Apgars, developed right hand swelling and left hip pain followed by bilateral elbow and shoulder swelling starting at 3 weeks of age. At the age of 5 weeks, she was hospitalized and bone scintigraphy showed multifocal osteomyelitis with involvement of ribs, clavicle and long bones. A bone biopsy performed on her left wrist showed a non-specific inflammatory reaction. At the age of 8 weeks, a mild pustular skin rash limited to the back of the neck and upper forehead developed. Cultures from bone aspirate and blood were persistently negative for bacteria, fungi, and mycobacteria, and immunodeficiency work-up (including lymphocyte immunophenotyping and HIV testing) was negative. During a 5-week hospitalization, the patient received broad-spectrum antibiotics with no change in clinical manifestations. Oral prednisolone was started (1 mg/kg/day) at the age of 10 weeks and increased to 2 mg/kg/day when the patient clinically improved and became asymptomatic. After 2 weeks, prednisolone was tapered by 0.5 mg every 2 weeks. The patient was clinically suspected to have DIRA and was seen at the National Institutes of Health (NIH) at the age of 5 months when her prednisolone dose was at 0.4 mg/kg/day and could not be tapered further.

On physical exam, her weight was 4.4 kg (<3rd percentile) and she had erythematous and papular skin rashes with healing crusted pustules on posterior neck and forehead extending to hairline and scalp. Her left hip had a significantly decreased range of motion with pain on motion, and the left clavicle was prominent and tender.

She was anemic with a hemoglobin (Hb) 9.3 g/dL, hematocrit (Ht) 28.8%, white blood cell (WBC) count 24,200 cells/mL (51% of neutrophils), platelet count 729,000 cells/mL, erythrocyte sedimentation rate (ESR) 113 mm/h, and C-reactive protein (CRP) 110.7 mg/L. X-ray studies demonstrated expansion of costochondral transition bilaterally at multiple levels but most prominently at levels 5–7 on the left side and 6 and 8 on the right side (Fig. 1a). She had mixed lytic/sclerotic bone lesions in the proximal portion of the right humerus, on the left proximal femur with adjacent periosteal reaction and mild periosteal reaction on the right proximal femur, and a proximal tibial lesion (Fig. 1b). The distribution and appearance of the bone lesions is pathognomonic for DIRA.

Fig. 1.

Fig. 1

Radiographic changes before and after treatment with anakinra. a Antero-posterior chest X-ray showing expansion of the ribs in the left at 5–7 levels (white stars) and widening of the right clavicle (black star). There is an osteotyic lesion with periosteal reaction on the right humerus (red arrow head). b Hip X-ray shows a mixed lytic/sclerotic bone lesion (black star) in the left proximal femur with adjacent periosteal reaction (red arrow head) and lytic bone lesion (blue arrow head) with mild periosteal reaction in the left proximal tibia. c, d Chest and hip X-rays show improvement of costal arch widening, resolution of osteolytic lesion on the right humerus, and improvement of the left femur and left tibia bone lesions

The patient started on treatment with recombinant IL-1Ra anakinra at 0.44 mL daily (1.5 mg/kg/day), and prednisolone was continued. On day 10 of the anakinra treatment, she developed a generalized urticarial rash 15 min after the injection that lasted for 45 min and responded to diphenhydramine (Benadryl®) and corticosteroids. As anakinra is an essential treatment for DIRA, “desensitization” over a period of 25 days was initiated. Anakinra was reduced to 0.025 mL (3.73 mg/day) and gradually increased while pre-medicating with Benadryl. Prednisolone was continued at 0.4 mg/kg/day (Supplemental Table I). On anakinra treatment, the patient achieved complete clinical remission. The bone lesions healed (Fig. 1c, d), she has no clinical symptoms, she is off steroids, and she has normalized inflammatory markers (Table 2).

Table 2.

Laboratory parameters before and after anakinra treatment

Laboratory
analysis
Pre-
treatment
with
anakinra
1 month
after
anakinra
treatment
1 year after
anakinra
treatment
Normal
range
Hemoglobin (g/dL) 9.3 11.4 10.7 (10.2–12.7)
Platelet (K/uL) 729 426 445 (214–459)
White blood cell (WBC) count (K/uL) 24.2 12.5 12.2 (6.48–13.02)
Neutrophil absolute (K/uL) 12.41 6.75 2.14 (1.27–7.18)
Lymphocyte absolute (K/uL) 9.9 4.87 8.29 (1.52–8.09)
Monocyte absolute (K/uL) 1.89 0.375 0.5 (0.26–1.08)
CRP (C-reactive protein) (mg/L) 110.7 4.2 6.2 <5
ESR (erythrocyte sedimentation rate) (mm/h) 113 17 33 <20

Genetic Findings

A SNP array analysis of the patient’s peripheral blood DNA showed a homozygous deletion of the centromeric end of IL1RN, spanning a region of approximately 21.4 kb to 23.7 Kb, which included the first four exons of IL1RN (NM_173843), two of which are coding (Fig. 2a). After amplifying the boundaries of the predicted deletion using multiple primer pairs 400–500 bp apart, we selected the forward and reverse primers closest to the 5′ and 3′ end of the deletion (Fig. 2b). PCR using the primers selected generated an amplicon that covered the breakpoint region of the disease-carrying allele (Fig. 2c), and Sanger sequencing of the PCR product indicated the exact breakpoints of the deletion at chr2_hg 19_113,865,011 and chr2_hg19_113,887,227 (Fig. 2d). These findings confirm a novel homozygous 22,216 bp deletion affecting IL1RN. Further analysis of patient’s SNP array demonstrated three regions of homozygosity greater than 2 Mb, suggesting a “distant” relatedness between patient’s parents and a founder effect. As the mutation is likely a founder mutation in India, the primers we designed can be used for the detection of suspected DIRA cases in India. The primer sequences are listed in Table 3. Using the primers designed, we performed a multiplex PCR assay, which showed that both parents are heterozygous for the deletion, whereas the patient is homozygous (Fig. 2c).

Fig. 2.

Fig. 2

Genetic analyses for the detection of the IL1RN deletion. a SNP array data showing a homozygous deletion of IL1RN. The region deleted is indicated by a red box on the chromosome diagram. The B allele frequency (BAF) plot conveys the zygosity of a given SNP (blue dot), while the log R ratio (LRR) plot conveys the intensity, or copy number. The homozygous deletion (shaded red) is indicated by the loss of intensity in the LRR plot and the absence of a coherent signal in the BAF plot. The deleted region includes the first four exons (two coding exons) of IL1RN (NM_173843). b Schematic representation of the deleted region of IL1RN gene predicted by SNP array. c Multiplex PCR products generated with three pairs of primers that amplify the wild-type allele the breakpoint junction of the deletion or an internal control (GAPDH) were run on a 2% agarose gel for 20 min. Upper band indicates presence of the wild-type (WT) allele, middle band indicates presence of the deleted allele (Brk pt), and lower band serves as an internal control (GAPDH). d Sanger sequencing electropherogram depicting the breakpoint of the IL1RN Indian deletion

Table 3.

Primer sequences used for the detection of homozygous and heterozygous 22 Kb Indian deletion

Primer name Oligonucleotide sequence
DIRA22-WT F TTCCTTCCTTCCATCCATTTG
DIRA22-WT R GAAAAATGGACAGCCTTGGA
DIRA22-BRK F CAACAACAACGAAAGCAAGG
DIRA22-BRK R CCTGGGACCACTGTGCCTAT
GAPDH F CAACGAATTGGCTACAGCA
GAPDH R CCCAGCAGTGAGGGTCTCT

DIRA22-WT primers amplify the wild-type sequence within the area of the novel deletion (not amplified in deleted allele)

DIRA22-BRK primers amplify the breakpoint sequence (only amplified in carriers of the deleted allele)

GAPDH primers serve as an internal amplification control

Discussion

DIRA is caused by autosomal recessive mutations in IL1RN, the gene that encodes IL-1 receptor antagonist, a natural antagonist of the IL-1 receptor that, if unopposed, results in increased IL-1 signaling and systemic inflammation. The disease presents with aseptic multifocal osteomyelitis and variable severity of skin pustulosis in the context of elevated inflammatory markers and pathergy. The clinical presentation is similar to that of septic osteomyelitis, which typically prompts treatment with antibiotics that are not beneficial. Failure to start immunosuppressive treatment with steroids results in disease escalation, an inflammatory response syndrome, and potentially death. Treatment with corticosteroids significantly improves the disease but does not result in inflammatory remission and is associated with significant side effects. Daily injections with anakinra, the recombinant IL-1 receptor antagonist is “life-saving” and results in a rapid response and complete inflammatory remission [2, 3, 5, 7]. The disease presented early in life and our reported patient had a clinical course similar to the 18 previously reported patients. Although aseptic multifocal osteomyelitis and pustulosis are the principal clinical manifestations, additional findings such as CNS vasculitis, hypotonia, respiratory distress, interstitial lung disease, and hemophagocytosis were seen in one patient each. None of these findings were present in our patient.

Most reported cases are homozygotes from areas where IL1RN mutations are founder mutations (Table 1). Here we report the first Indian girl diagnosed with DIRA, born to unrelated healthy parents. The diagnosis was confirmed by detection of a deletion of the first two coding exons of IL1RN by SNP array, PCR, and Sanger technique. The mutation is novel but the frequency in the ethnic group where both parents come from is unknown. We designed primers to detect the novel deletion that can facilitate screening in Indian patients with a clinical suspicion of DIRA and also in determining the carrier frequency of the deletion. The carrier frequency of a previously described large deletion seen in a geographically isolated Puerto Rican population is 1.3% [2]. In such areas, prenatal screening and counseling may be indicated.

The DIRA-causing mutations in IL1RN result in either no protein expression or expression of a truncated non-functional protein [2]. The absence of protein and the treatment with the recombinant IL-1 receptor antagonist, anakinra, have raised concerns about drug reactions to anakinra. Most patients with several monogenic autoinflammatory diseases tolerate anakinra well and have been on treatment with the drug for over 10 years. However, we are aware of drug reactions in two of 12 patients with DIRA who used anakinra but none of over 100 patients with the cryopyrinopathies, familial cold-induced autoinflammatory syndrome (FCAS), Muckle Wells syndrome (MWS), or neonatal-onset multisystem inflammatory disease (NOMID), who have a NLRP3-mediated autoinflammatory syndrome that responds to IL-1 inhibition. Both DIRA patients developed a systemic urticarial drug reaction that was distinct from the common injection site reactions that are observed in up to 30% of patients injected with anakinra. The allergic reaction in our patient occurred within 10 days of anakinra injection, a presentation that is strongly suggestive of a humoral response that developed after supplementation with a protein that had been deficient. The patient harbors a large deletion in chromosome 2 that spans the promoter and the first two coding exons of IL1RN that lead to non-expression of IL-1Ra. The other DIRA patient who developed a drug reaction harbors a nonsense IL1RN mutation (c.160C>T; p.Gln54*) that leads to a premature stop codon with the presumed expression of a truncated protein. Protein expression has not been tested in vitro; it is possible that the short mRNA transcript is not stable and that the mutation may also result in no protein expression [2]. These findings could indicate that absence or earlier truncations in IL-1Ra would be associated with a higher risk of developing a humoral reaction to the recombinant IL-1RA, anakinra. Given the critical importance of treatment in these patients, both DIRA patients who have developed a reaction to anakinra have been desensitized. Our patient was started on lower doses of anakinra and up-titrated (Supplemental Table I), whereas the other patient was rapidly desensitized (Supplemental Table II). Currently, both remain on anakinra treatment at 2.5 and 4 years after desensitization, respectively.

In summary, we report a novel DIRA-causing loss-of-function mutation in IL1RN and point to the importance of recognizing and diagnosing DIRA promptly, particularly in clinical circumstances where infectious osteomyelitis is not uncommon. In addition, we provide guidance to IL-1 blocking treatment with anakinra and report two desensitization regimens that were successfully used in two DIRA patients. These patients developed systemic allergic reactions to anakinra and desensitization allowed them to continue their essential treatment.

Supplementary Material

Supplementary Tables

Acknowledgements

We would like to acknowledge Dr. Ivona Aksentijevich for providing the wild type and GAPDH primer sequences and for genetic advice on the multiplex PCR protocol. We would also like to thank Dawn Chapelle, CRNP, and Wendy Goodspeed, RN, for the clinical care of the patient. This research was supported by the Intramural Research Program of the NIH, NIAID, NIAMS, and NHGRI.

Footnotes

Conflicts of Interest Dr. Leonardo O. Mendonca has received speaker fees from Novartis. All other authors declare that they have no conflicts of interest.

Compliance with Ethical Standards The parents provided consent and the patient was enrolled into an IRB-approved NIH natural history protocol (NCT02974595).

Electronic supplementary material The online version of this article (doi:10.1007/s10875-017-0399-1) contains supplementary material, which is available to authorized users.

References

  • 1.de Jesus AA, Canna SW, Liu Y, Goldbach-Mansky R. Molecular mechanisms in genetically defined autoinflammatory diseases: disorders of amplified danger signaling. Annu Rev Immunol. 2015;33: 823–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Aksentijevich I, Masters SL, Ferguson PJ, Dancey P, Frenkel J, van Royen-Kerkhoff A, et al. An autoinflammatory disease with deficiency of the interleukin-1-receptor antagonist. N Engl J Med. 2009;360(23):2426–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Reddy S, Jia S, Geoffrey R, Lorier R, Suchi M, Broeckel U, et al. An autoinflammatory disease due to homozygous deletion of the IL1RN locus. N Engl J Med. 2009;360(23):2438–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Altiok E, Aksoy F, Perk Y, Taylan F, Kim PW, Ilikkan B, et al. A novel mutation in the interleukin-1 receptor antagonist associated with intrauterine disease onset. Clin Immunol. 2012;145(1):77–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brau-Javier CN, Gonzales-Chavez J, Toro JR. Chronic cutaneous pustulosis due to a 175-kb deletion on chromosome 2q13: excellent response to anakinra. Arch Dermatol. 2012;148(3):301–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Minkis K, Aksentijevich I, Goldbach-Mansky R, Magro C, Scott R, Davis JG, et al. Interleukin 1 receptor antagonist deficiency presenting as infantile pustulosis mimicking infantile pustular psoriasis. Arch Dermatol. 2012;148(6):747–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jesus AA, Osman M, Silva CA, Kim PW, Pham TH, Gadina M, et al. A novel mutation of IL1RN in the deficiency of interleukin-1 receptor antagonist syndrome: description of two unrelated cases from Brazil. Arthritis Rheum. 2011;63(12):4007–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Stenerson M, Dufendach K, Aksentijevich I, Brady J, Austin J, Reed AM. The first reported case of compound heterozygous IL1RN mutations causing deficiency of the interleukin-1 receptor antagonist. Arthritis Rheum. 2011;63(12):4018–22. [DOI] [PubMed] [Google Scholar]
  • 9.Infevers: an online database for autoinflammatory mutations. Copyright. Available at http://fmf.igh.cnrs.fr/ISSAID/infevers/ [. [Google Scholar]
  • 10.Ulusoy E, Karaca NE, El-Shanti H, Kilicoglu E, Aksu G, Kutukculer N. Interleukin-1 receptor antagonist deficiency with a novel mutation; late onset and successful treatment with canakinumab: a case report. J Med Case Rep. 2015;9:145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gunderson KL, Steemers FJ, Lee G, Mendoza LG, Chee MS. A genome-wide scalable SNP genotyping assay using microarray technology. Nat Genet. 2005;37(5):549–54. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Tables

RESOURCES