The authors wish to introduce the following corrections to their article (1).
1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is:
TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACGTCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA
2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II.
The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.
Contributor Information
Adam Hefel, Department of Biology, The University of Iowa, Iowa City, IA 52242, USA.
Masayoshi Honda, Department of Biochemistry, The University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA.
Nicholas Cronin, Department of Biochemistry, The University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA.
Kailey Harrell, Department of Biology, The University of Iowa, Iowa City, IA 52242, USA.
Pooja Patel, Department of Biology, The University of Iowa, Iowa City, IA 52242, USA.
Maria Spies, Department of Biochemistry, The University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA.
Sarit Smolikove, Department of Biology, The University of Iowa, Iowa City, IA 52242, USA.
REFERENCES
- 1.Hefel A., Honda M., Cronin N., Harrell K., Patel P., Spies M., Smolikove S.. RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis. Nucleic Acids Res. 2021; 49:2005–2026. [DOI] [PMC free article] [PubMed] [Google Scholar]
