Skip to main content
Neuroscience Bulletin logoLink to Neuroscience Bulletin
. 2021 Jun 6;37(9):1314–1324. doi: 10.1007/s12264-021-00696-7

Pinocembrin Promotes OPC Differentiation and Remyelination via the mTOR Signaling Pathway

Qi Shao 1, Ming Zhao 1,2,3, Wenwen Pei 1, Yingyan Pu 1, Mingdong Liu 1, Weili Liu 1, Zhongwang Yu 1, Kefu Chen 1,4, Hong Liu 1, Benqiang Deng 2,✉, Li Cao 1,✉
PMCID: PMC8423946  PMID: 34091810

Abstract

The exacerbation of progressive multiple sclerosis (MS) is closely associated with obstruction of the differentiation of oligodendrocyte progenitor cells (OPCs). To discover novel therapeutic compounds for enhancing remyelination by endogenous OPCs, we screened for myelin basic protein expression using cultured rat OPCs and a library of small-molecule compounds. One of the most effective drugs was pinocembrin, which remarkably promoted OPC differentiation and maturation without affecting cell proliferation and survival. Based on these in vitro effects, we further assessed the therapeutic effects of pinocembrin in animal models of demyelinating diseases. We demonstrated that pinocembrin significantly ameliorated the progression of experimental autoimmune encephalomyelitis (EAE) and enhanced the repair of demyelination in lysolectin-induced lesions. Further studies indicated that pinocembrin increased the phosphorylation level of mammalian target of rapamycin (mTOR). Taken together, our results demonstrated that pinocembrin promotes OPC differentiation and remyelination through the phosphorylated mTOR pathway, and suggest a novel therapeutic prospect for this natural flavonoid product in treating demyelinating diseases.

Keywords: Pinocembrin, Oligodendrocytes, Differentiation, Remyelination, MTOR

Introduction

Oligodendrocytes (OLs), the myelinating cells in the central nervous system (CNS), play an indispensable role in insulating axons, accelerating nerve conduction, and metabolically supporting axons. OLs are generated from oligodendrocyte progenitor cells (OPCs) through distinct stages governed by intrinsic and extrinsic regulatory factors [1–5]. Studies indicating the relative abundance of OPCs in chronic demyelinating lesions in multiple sclerosis (MS) inform us that the culprit of MS progression is the obstruction of OPC differentiation rather than a failure of the repopulation or migration of OPCs [6–10]. Approximately 85% of newly-diagnosed patients exhibit relapsing-remitting MS, and most of them develop progressive MS after 10–20 years [11, 12]. However, all currently approved drugs for MS exclusively function by immune suppression, which may only be effective for relapsing-remitting MS [12–15]. When the disease course enters the progressive phase, the immunomodulatory approaches become impotent [12]. Based on this knowledge, the identification of small molecules capable of promoting OPC differentiation in demyelinating lesions and enhancing remyelination would have considerable impact on the treatment of MS.

To find new compounds that promote the differentiation and maturation of endogenous OPCs, we chose a natural product library of 502 small-molecule compounds. Of all of those that promoted OPC differentiation at micromolar concentrations, we identified pinocembrin as our research priority for its anti-oxidative [16], anti-inflammatory [17, 18] and neuroprotective pharmacological activity [18–23] as well as its abundance in propolis (“bee glue”) [24], Alpinia officinarum [25], and other plant extracts [26].

Pinocembrin, also known as 5,7-dihydroxy flavanone, is a natural compound extracted from propolis. Propolis, a colloidal solid with an aromatic odor, is processed from the resin collected by bees from plant spores, tree-trunks, and its own secretions [27, 28]. The molecular weight of pinocembrin is relatively low, which can facilitate its transport across the blood-brain barrier. To date, the roles of pinocembrin in vascular endothelial cells, neurons, and macrophages have been studied. In the circulatory system, pinocembrin had been shown to inhibit vascular contraction in rat endothelium-deprived aortic rings at least partly by obstruction of the RhoA/ROCK1 (Ras homolog gene family member A/Rho-associated protein kinase 1) pathway [29]. Pinocembrin also remarkably inhibits the expression of pro-inflammatory cytokines in mammalian macrophages and mitigates lipopolysaccharide-induced lung damage through restraint of NF-κB inhibitor α, c-Jun N-terminal kinase, and p38 mitogen-activated protein kinase (p38 MAPK) activation [30]. In neurons, pinocembrin has also been demonstrated to display antioxidant [20, 31, 32] and anti-inflammatory [20, 28, 30, 33] effects. However, its effect on demyelinating diseases in the CNS remains unclear.

Materials and Methods

Materials

Pinocembrin, Hoechst 33342, Luxol fast blue (LFB), and poly-L-lysine (PLL) were from Sigma (St. Louis, USA). Pinocembrin was preliminarily dissolved in DMSO to 10 mmol/L as a stock solution and further diluted in cell culture medium. Anti-MBP antibody was from Chemicon International (Temecula, USA); anti-total and phospho-mTOR antibodies were from Cell Signaling Technology (Beverly, USA); anti-beta actin antibody and HRP-conjugated secondary antibodies were from Kangcheng Biotechnology (Shanghai, China). Cell culture-related reagents were from Gibco (Grand Island, USA).

Rat Primary OPC Culture

Purified OPCs were isolated and primary-cultured as previously described [34–36]. Briefly, mixed cortical glial cell cultures were generated from newborn rats and maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) for 10 days at 37 °C with 5% CO2. Microglia were roughly removed by mechanical shaking for 1 h at 180 r/min on a gyratory shaker at 37 °C. The culture flasks were further shaken for an additional 16 h at 200–220 r/min. Then, the cell suspension was collected in uncoated Petri dishes (Sterilin, Staffordshire, UK) to allow microglia to attach. The suspension was then seeded onto PLL-coated plates or coverslips. For the differentiation assay, OPCs were cultured for 48 h in Neurobasal medium supplemented with 2% B27, and 30 ng/mL triiodothyronine and 40 ng/mL thyroxine were added as a positive control.

Immunocytofluorescence Staining

Cells were fixed with 4% paraformaldehyde (PFA) for 20 min followed by washing in phosphate-buffered saline (PBS) at room temperature, permeabilized with 0.3% Triton X-100, and incubated with primary antibodies of mouse anti-myelin basic protein (MBP; 1:50, MAB382, Chemicon) overnight at 4 °C. The cells were then incubated in fluorescein isothiocyanate- or tetramethylrhodamine isothiocyanate -conjugated secondary antibodies (1:100) containing Hoechst 33342 (1:1000) for 2 h at room temperature. Photographs were captured using an Olympus IX70 microscope (Olympus, Tokyo, Japan) system. Cells were counted from at least 10 random fields/well and 3 replicated wells from each of the individual treatment conditions in three independent experiments.

Western Blot Analysis

OPCs were cultured in differentiation medium for 3 days before whole-cell lysates were harvested to detect MBP. As for mTOR activation analysis, OPCs were grown in proliferation medium for 48 h, starved for 6 h in DMEM without any supplements, then treated for 15 min (antagonists were added and left for 20 min). Western blot was carried out using a standard protocol. Quantification was done using 422 Image Lab Analysis (Bio-Rad, Hercules, USA).

Bromodeoxyuridine (BrdU) Incorporation Assay

To assess the proliferation of OPCs, BrdU (Sigma-Aldrich, St. Louis, USA) was incorporated into cells for 6 h and then fixed with 4% PFA. The cells were then incubated in 2 N HCl for 30 min and 0.1 mol/L sodium borate (pH 8.5) for 20 min. Then immunofluorescence staining was performed using anti-BrdU antibody as described above.

TUNEL Assay

TUNEL assays were carried out using an in situ cell death detection kit (12156, Roche, USA) according to the manufacturer’s instructions. Briefly, the cells on coverslips were fixed in 4% PFA and then incubated with the TUNEL reaction solution mixture containing terminal-deoxynucleo-tidyltransferase at 37 °C for 1 h. The cell nuclei were labeled with Hoechst 33342. The percentage of TUNEL-labeled cells versus nuclei was calculated.

Animal Model Induction

The EAE model was induced as previously described [37]. Female C57BL/6 mice (8–10 weeks) were subcutaneously immunized with MOG35–55 (myelin oligodendrocyte glycoprotein; GL Biochem, Shanghai, China) in complete Freund’s adjuvant containing heat-killed Mycobacterium tuberculosis (H37Ra strain; Difco, USA). The immunization day was designated day 0. Pertussis toxin (Calbiochem-EMD Chemicals, San Diego, USA) in PBS was administered intraperitoneally on days 0 and 2. Clinical EAE scores were graded daily in a blind manner as follows: (0) no clinical signs; (1) paralyzed tail; (2) paresis; (3) paraplegia; (4) paraplegia with forelimb weakness or paralysis; and (5) moribund state or death [37]. For the focal demyelination model, spinal cord lesions were induced as described previously [38, 39]. Briefly, 1 μL of 1% lysophosphatidylcholine (LPC; Sigma Aldrich, St. Louis, USA) in 0.9% NaCl was slowly injected into the dorsal column at T11–T12 in C57BL/6 mice (8–10 weeks) using a micromanipulator and a glass tip attached to a syringe (Hamilton Co., Reno, USA), following a laminectomy. The day of LPC injection was set as day 0 (0 DPL). The demyelinated lesion volume was calculated according to the equation for the volume of a cylinder (volume = lesion area × length of lesion).

RNA Isolation and qPCR

Total RNA was extracted from the cultured cells using TRIzol (Invitrogen, Carlsbad, USA). First-strand cDNA was synthesized using a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, USA). Real-time quantitative PCR (qPCR) was performed with the SYBR Green Real-time PCR Master Mix (Toyobo, Shanghai, China) on a Lightcyler96 Real Time PCR system (Roche). Gene expression was expressed as the mRNA level, which was normalized to that of a standard housekeeping gene (Gapdh) using the ∆∆CT method. The primers used were: for GAPDH, F: CCATCAACGACCCCTTCATT; R: ATTCTCAGCCTTGACTGTGC; for MBP, F: CTTGTTAATCCGTTCTAATTCCG; R: TTCTGGAAGTTTCGTCCCT.

Luxol Fast Blue (LFB) Staining

Frozen samples of LPC lesions were later used to cut 14-µm cryosections for LFB staining, and the dorsal columns were observed. The samples were allowed to incubate in 100% ethanol for 5 min and 0.1% LFB overnight at 58 °C and were then differentiated with 0.05% Li2CO3 and 70% ethanol.

Hematoxylin and Eosin (H&E) Staining

Frozen tissues samples of EAE were later used to cut 14-µm cryosections for further hematoxylin staining for 5 min. The samples were immersed in hydrochloric acid-alcohol for several seconds followed by 1% ammonia water for several seconds and then placed into Iraqi red dye for 1–3 min. Finally, the samples were dehydrated with ethanol for 5 min and made transparent with xylene for 5 min.

Electron Microscopy

To prepare tissue samples for electron microscopy, mice were sacrificed and transcardially perfused with PBS. Then, the dorsal column of spinal cords was isolated and fixed in 2.5% glutaraldehyde for 2 h, postfixed in 1% osmium tetroxide for 45 min, dehydrated, and embedded in Araldite resin. Sections (1 µm) were stained with toluidine blue. Ultrathin sections (60 nm) were stained in uranyl acetate and lead citrate. Samples were visualized using a transmission electron microscope (H-7650; Hitachi, Tokyo, Japan) at 100 kV. The thickness of myelin sheaths was determined using ImageJ (National Institutes of Health, USA) as the g-ratio (the ratio of the diameter of the axon itself to the diameter of axon plus its myelin sheath).

Statistical Analysis

All experiments were repeated at least three times and the results are shown as the mean ± SEM. Differences between groups were statistically tested using a two-tailed unpaired Student’s t-test or analysis of variance followed by Tukey’s post hoc test. For the analysis of EAE, results were compared using the nonparametric Mann Whitney U-test. Differences were considered statistically significant at P <0.05.

Results

Pinocembrin Promotes OPC Differentiation

To identify compounds that selectively induce OPC differentiation, we assessed the mRNA expression of MBP in rat cortex-derived OPCs under basal differentiation conditions. The screening of the drug library of 502 natural compounds led to the identification of several potential inducers of OPC differentiation (Fig. 1A). Unfortunately, these molecules have rarely-reported therapeutic applications in CNS diseases so far. Among them, one of the most effective inducers of OPC differentiation was pinocembrin, which we chose to investigate in depth, considering its anti-inflammatory effect [32, 40, 41]. The in vitro differentiation of rodent OPCs induced by pinocembrin was confirmed by evaluating the mRNA and protein levels of MBP through qPCR with reverse transcription and Western blot analysis. The results showed that pinocembrin remarkably boosted the mRNA level of MBP compared with DMSO (Fig. 1A). To further explore whether the effect of pinocembrin on OPC maturation was concentration-dependent, different concentrations of pinocembrin ranging from 0.02 to 50 μmol/L were added to the OPC culture medium. By Western blot analysis, pinocembrin was shown to elevate MBP protein expression in a concentration-dependent manner, with an overt effect appearing at 2 μmol/L and culminating at 20 μmol/L (Fig. 1C, D). In addition, pinocembrin resulted in a dramatic increase in the percentage of MBP+ cells (Fig. 1E, F). Thus, our data suggest a positive regulatory role of pinocembrin in the modulation of OPC differentiation in vitro.

Fig. 1.

Fig. 1

Pinocembrin induces OPC differentiation in vitro. A Potential inducers of OPC differentiation identified by the elevation of MBP mRNA expression from a library of small-molecule compounds. B Chemical structure of pinocembrin. C, D Pinocembrin promotes MBP protein expression in a concentration-dependent manner. E Representative images showing MBP-positive cells in different treatment groups (scale bar, 100 μm). F Quantitative analysis of the relative percentages of MBP-positive cells in different treatment groups. Cells were counted in at least 10 randomly-selected fields from each coverslip, and at least 3 coverslips were counted for each group. Data are shown as the mean ± SEM (*P < 0.05; **P < 0.01 versus control, Student’s t-test).

Pinocembrin Does Not Affect the Survival or Proliferation of OPCs

Could the elevation of MBP expression alternatively be ascribed to a pro-proliferation or pro-survival effect of pinocembrin? To test this possibility and determine whether pinocembrin plays a part in the proliferation or survival of cultured OPCs, we applied BrdU incorporation and TUNEL assays. The comparable proportions of BrdU+/Hoechst+ cells (Fig. 2A, C) and TUNEL+/Hoechst+ cells (Fig. 2B, D) suggested that pinocembrin had no significant effect on the proliferation or survival of OPCs. Thus, our results indicate that pinocembrin acts specifically on the maturation of OPCs without interfering with their survival or proliferation.

Fig. 2.

Fig. 2

Pinocembrin does not affect the proliferation or apoptosis of OPCs. A, B Representative images showing BrdU-positive and TUNEL-positive cells with pinocembrin (20 μmol/L) or DMSO treatment (control) (scale bars, 50 μm). C, D Quantitative analysis of BrdU- and TUNEL-positive cells in the indicated conditions. Cells were counted in at least 10 randomly-selected fields from each coverslip, and at least 3 coverslips were counted for each group.

Pinocembrin Accelerates the Recovery of Neurological Function in EAE Mice

We next examined the activity of pinocembrin in the MOG33–35-induced EAE model with clinic relevance to MS. Pinocembrin (20 and 40 mg/kg) and DMSO were administered by a daily intraperitoneal (i.p.) injection initiated at the first sign of disease. As shown in Fig. 3A, pinocembrin dramatically ameliorated the disease severity during the acute phase. In parallel experiments, we isolated the spinal cords from pinocembrin or DMSO-treated mice at various time points during the acute and chronic phases of the disease. Sections were then stained with LFB or H&E to visualize myelination and infiltrating immune cells (Fig. 3B, C). The mice treated with 20 and 40 mg/kg pinocembrin exhibited a smaller demyelination area than the control group, with the 40 mg/kg group displaying the smallest area (Fig. 3D). Consistently, quantification of H&E staining showed a decreased number of infiltrating immune cells in both pinocembrin groups, and the 40 mg/kg group was lower than control group (Fig. 3E), suggesting a moderate inflammatory condition. Taken together, the above results suggest that pinocembrin not only attenuates white matter demyelination but also inhibits inflammatory infiltration in EAE mice.

Fig. 3.

Fig. 3

Treatment with pinocembrin (PB) alleviates the progression of EAE. A Average clinical scores of EAE in mice from the pinocembrin and control groups (n = 10 mice per group; **P < 0.01, Mann-Whitney U-test). B, C Representative LFB-stained (B) and H&E-stained (C) spinal cord sections from EAE mice at day 30 after immunization (boxed areas on the left are enlarged on the right; asterisks, demyelination; arrows, inflammatory cell infiltration; scale bars, 100 μm). D, E Percentages of demyelinated white matter (WM) in total WM (D) and infiltrating cells in WM (E) as in B and C. Data are shown as the mean ± SEM (n = 3 mice per group; *P < 0.05, **P < 0.01, ns, not significant, Student’s t-test).

Pinocembrin Promotes Remyelination in LPC-induced Focal Demyelinating Lesions

As EAE is a model of inflammation-induced demyelination, in order to exclude effects of the immune response on demyelination and myelin regeneration, we introduced a model using LPC-induced focal demyelination [38, 42]. Consistent with our hypothesis, pinocembrin treatment at 11 and 15 DPL significantly enhanced the remyelination following LPC-induced demyelination, as demonstrated by LFB staining (Fig. 4A, B). We used electron microscopy (EM) to observe the myelin wrapping the axons in the lesions. Pinocembrin treatment resulted in extensive remyelination, as evidenced by the emergence of abundant newly-formed thin myelin sheaths at 14 DPL (Fig. 4C). Notably, EM analysis uncovered a higher proportion of re-myelinated axons and a lower g-ratio in the lesions of pinocembrin-treated mice at 14 DPL (Fig. 4D, E), supporting a pinocembrin-induced pro-remyelination effect.

Fig. 4.

Fig. 4

Pinocembrin promotes remyelination in LPC-induced focal lesions. A Representative spinal cord sections showing LFB-stained dorsal columns from pinocembrin-treated (lower panels) and DMSO-treated control (upper panels) groups at 3, 7, 11, and 15 DPL (scale bar, 100 μm). B Quantitative analysis of lesion size in the dorsal columns of pinocembrin-treated and DMSO-treated control groups (n = 3 mice per group). C Representative electron micrographs of the re-myelinated area in the spinal cord of indicated groups at 7 and 14 DPL; thin myelin sheaths (remyelination) are evident in both the pinocembrin-treated and DMSO-treated control groups (scale bar, 1 μm). D Quantification of myelinated axons among total axons in indicated groups at 7 and 14 DPL (n = 3 mice per group). E Analysis of the myelinated axons showing a reduction in the g-ratio in the spinal cords from the pinocembrin-treated group (red) compared with that in the DMSO-treated control groups (blue) at 14 DPL. Data are shown as the mean ± SEM (n = 3 mice per group; *P < 0.05 as indicated, Student’s t-test).

Pinocembrin Activates mTOR Signaling during OPC Differentiation

We next investigated the possible downstream mechanism that might mediate the pro-differentiation effect of pinocembrin. Studies have demonstrated that several signaling pathways are potently implicated in the modulation of OPC differentiation, such as the Wnt/β-catenin [43], classical Notch [44], Lingo-1 [45–47], ERK/MAPK (extracellular signal related kinase/mitogen activated protein kinase) [43], and PI3K/AKT/mTOR (phosphoinositide-3-kinase/AKT serine/threonine kinase/mammalian target of rapamycin) pathways [43]. Since our previous data showed that the mTOR pathway plays a potent role in regulating the differentiation of OPCs and remyelination [34], we examined the role of mTOR signaling in pinocembrin-induced OPC differentiation by using the inhibitor rapamycin. Adding rapamycin to the OPC culture medium remarkably reduced the expression of MBP, and the pro-differentiation effect of pinocembrin was diminished following the addition of rapamycin (Fig. 5A, B). Western blot analysis displayed a similar tendency of the protein levels in these groups (Fig. 5C, D). Consistently, the protein level of phosphorylated mTOR exhibited a sustained elevation in the pinocembrin-treated OLs, and this effect was significantly inhibited by rapamycin, indicating an mTOR-dependent mechanism (Fig. 5E, F). The enhancement of mTOR phosphorylation was detected at 0.5 h and maintained for at least 2 h following pinocembrin treatment.

Fig. 5.

Fig. 5

Pinocembrin regulates OPC differentiation through activating mTOR signaling. A Representative image of MBP-positive OLs cultured for 72 h in indicated conditions. MBP (red) labels mature OLs, Hoechst (blue) labels nuclei (PB, Pinocembrin, 20 μmol/L; Rap, Rapamycin, 20 nmol/L; scale bar, 100 µm). B Quantification of the percentages of MBP-positive cells in indicated conditions. C Representative Western blots of MBP in indicated situation. D Quantification of the expression of MBP in indicated situation. Actin expression from the same sample is an internal control. E Representative Western blots of p-mTOR and mTOR in indicated situations. F Quantification of the expression of p-mTOR in indicated situation. The expression of mTOR was analyzed from the same sample as an internal control. Scanning densitometry was quantified and normalized to control. Results are from 3 independent experiments. Data are shown as the mean ± SEM (*P < 0.05; **P < 0.01; ***P < 0.001).

Together, the above data demonstrate that pinocembrin promotes OPC differentiation at least partly by activation of the mTOR signaling pathway.

Discussion

MS is a chronic neurological disease with persistent extensive inflammation in the CNS, leading to multifocal demyelination and axonal loss [12]. At present, disease interventions are mainly focused on immune modulators. However, these drugs only reduce the frequency of recurrence but are not able to effectively inhibit the disease progression. Once in the late stage of MS, these drugs yield no satisfactory therapeutic effect [9, 11, 12, 14]. A large number of undifferentiated OPCs have been found in the demyelinating lesions, indicating that the recruitment of OPCs is relatively normal but their maturation is obstructed [6–9]. Aiming at demyelinating diseases, we screened for novel drugs that promote the differentiation and maturation of OPCs. Small-molecule natural drugs attracted our attention, with the advantage that they can be easily extracted from natural products. Furthermore, owing to their low molecular weight, these drugs can easily cross the blood-brain-barrier to function in the CNS.

In this study, we used screening to identify several drugs that elevated the expression of MBP in OPCs. These candidate drugs had certain biological activities and clinical applications. For instance, protopine HCl is a novel microtubule stabilizer with accompanying anticancer and anti-inflammatory activity [48, 49]. Norharmane is a β-carboline alkaloid found abundantly in tobacco. It is a monoamine oxidase inhibitor which is used to regulate epinephrine and norepinephrine levels, and to treat blood stasis, cough, labor injury-induced hematemesis, and bruises [50, 51]. Hesperetin is a flavonoid mainly derived from citrus peel. Hesperetin has been reported to be able to promote antigen-presenting T cell activation, and the transplantation of hesperetin-treated T cells into normal mice exacerbates the severity of EAE compared with controls [52–54].

Among these drugs, we chose pinocembrin as our research priority for its anti-inflammatory effect which might enhance the effect in MS treatment. First, we confirmed that pinocembrin promoted OPC differentiation without affecting their proliferation or apoptosis. Second, we used an EAE inflammation model and an LPC-induced lesion model to investigate the role of pinocembrin in demyelinating diseases. The EAE model is the classical animal model of MS, is close to the clinical progression of the disease, and provides relatively strong evidence for the application of the drug. The LPC model facilitated study of the effects of pinocembrin on remyelination following demyelination injury, and minimized the influence of the immune system on myelin repair [38, 42]. We demonstrated in the EAE model that pinocembrin not only significantly reduced the behavioral scores of the mice but also remarkably inhibited the demyelinating injury and the infiltration of inflammatory cells. Furthermore, our data showed that pinocembrin effectively promotes remyelination following LPC-induced demyelination.

As to the mechanism underlying the effect of pinocembrin in promoting OPC differentiation and remyelination, we demonstrated that the mTOR pathway inhibitor rapamycin blocked this effect. Compelling evidence provided by many researchers has shown that mTOR, a downstream effector of AKT signaling, is fairly pivotal for OPC differentiation and myelination [43, 55]. MTOR regulates OPC differentiation and myelination in the CNS by ensuring appropriate OPC differentiation, the transcription and translation of myelin-related proteins, and the initiation of myelination, along with lipid biogenesis [43]. Considering our data, it is likely that mTOR mediates the pro-differentiation effect of pinocembrin by regulating the transcription and translation of myelin-related proteins.

In conclusion, pinocembrin not only promotes OPC differentiation but also participates in the remyelination process in demyelinating lesions, suggesting that it may be a potential drug candidate for MS treatment.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (31771129).

Conflict of interest

The authors declare that they have no conflict of interest.

Footnotes

Qi Shao, Ming Zhao, and Wenwen Pei contributed equally to this work.

Contributor Information

Benqiang Deng, Email: xiaocalf@163.com.

Li Cao, Email: caoli@smmu.edu.cn.

References

  • 1.Franklin RJ, Ffrench-Constant C. Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci. 2008;9:839–855. doi: 10.1038/nrn2480. [DOI] [PubMed] [Google Scholar]
  • 2.Balabanov R, Popko B. Myelin repair: developmental myelination redux? Nat Neurosci. 2005;8:262–264. doi: 10.1038/nn0305-262. [DOI] [PubMed] [Google Scholar]
  • 3.Simons M, Nave KA. Oligodendrocytes: Myelination and axonal support. Cold Spring Harb Perspect Biol. 2015;8:a020479. doi: 10.1101/cshperspect.a020479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Emery B, Lu QR. Transcriptional and epigenetic regulation of oligodendrocyte development and myelination in the central nervous system. Cold Spring Harb Perspect Biol. 2015;7:a020461. doi: 10.1101/cshperspect.a020461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Emery B. Regulation of oligodendrocyte differentiation and myelination. Science. 2010;330:779–782. doi: 10.1126/science.1190927. [DOI] [PubMed] [Google Scholar]
  • 6.Chang A, Tourtellotte WW, Rudick R, Trapp BD. Premyelinating oligodendrocytes in chronic lesions of multiple sclerosis. N Engl J Med. 2002;346:165–173. doi: 10.1056/NEJMoa010994. [DOI] [PubMed] [Google Scholar]
  • 7.Wolswijk G. Chronic stage multiple sclerosis lesions contain a relatively quiescent population of oligodendrocyte precursor cells. J Neurosci. 1998;18:601–609. doi: 10.1523/JNEUROSCI.18-02-00601.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kuhlmann T, Miron V, Cui Q, Wegner C, Antel J, Bruck W. Differentiation block of oligodendroglial progenitor cells as a cause for remyelination failure in chronic multiple sclerosis. Brain. 2008;131:1749–1758. doi: 10.1093/brain/awn096. [DOI] [PubMed] [Google Scholar]
  • 9.Franklin RJ. Why does remyelination fail in multiple sclerosis? Nat Rev Neurosci. 2002;3:705–714. doi: 10.1038/nrn917. [DOI] [PubMed] [Google Scholar]
  • 10.Heß K, Starost L, Kieran NW, Thomas C, Vincenten MCJ, Antel J, et al. Lesion stage-dependent causes for impaired remyelination in MS. Acta Neuropathol. 2020;140:359–375. doi: 10.1007/s00401-020-02189-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Leary SM, Porter B, Thompson AJ. Multiple sclerosis: diagnosis and the management of acute relapses. Postgrad Med J. 2005;81:302–308. doi: 10.1136/pgmj.2004.029413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Compston A, Coles A. Multiple sclerosis. Lancet. 2002;359:1221–1231. doi: 10.1016/S0140-6736(02)08220-X. [DOI] [PubMed] [Google Scholar]
  • 13.Damal K, Stoker E, Foley JF. Optimizing therapeutics in the management of patients with multiple sclerosis: a review of drug efficacy, dosing, and mechanisms of action. Biologics. 2013;7:247–258. doi: 10.2147/BTT.S53007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Stuve O, Cutter GR. Multiple sclerosis drugs: how much bang for the buck? Lancet Neurol. 2015;14:460–461. doi: 10.1016/S1474-4422(15)00016-2. [DOI] [PubMed] [Google Scholar]
  • 15.Lu F, Yin D, Pu Y, Liu W, Li Z, Shao Q, et al. Shikimic acid promotes oligodendrocyte precursor cell differentiation and accelerates remyelination in mice. Neurosci Bull. 2019;35:434–446. doi: 10.1007/s12264-018-0322-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lungkaphin A, Pongchaidecha A, Palee S, Arjinajarn P, Pompimon W, Chattipakorn N. Pinocembrin reduces cardiac arrhythmia and infarct size in rats subjected to acute myocardial ischemia/reperfusion. Appl Physiol Nutr Metab. 2015;40:1031–1037. doi: 10.1139/apnm-2015-0108. [DOI] [PubMed] [Google Scholar]
  • 17.Sala A, Recio MC, Schinella GR, Manez S, Giner RM, Cerda-Nicolas M, et al. Assessment of the anti-inflammatory activity and free radical scavenger activity of tiliroside. Eur J Pharmacol. 2003;461:53–61. doi: 10.1016/S0014-2999(02)02953-9. [DOI] [PubMed] [Google Scholar]
  • 18.Wang W, Zheng L, Xu L, Tu J, Gu X. Pinocembrin mitigates depressive-like behaviors induced by chronic unpredictable mild stress through ameliorating neuroinflammation and apoptosis. Mol Med. 2020;26:53. doi: 10.1186/s10020-020-00179-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang Y, Miao Y, Mir AZ, Cheng L, Wang L, Zhao L, et al. Inhibition of beta-amyloid-induced neurotoxicity by pinocembrin through Nrf2/HO-1 pathway in SH-SY5Y cells. J Neurol Sci. 2016;368:223–230. doi: 10.1016/j.jns.2016.07.010. [DOI] [PubMed] [Google Scholar]
  • 20.Saad MA, Abdel Salam RM, Kenawy SA, Attia AS. Pinocembrin attenuates hippocampal inflammation, oxidative perturbations and apoptosis in a rat model of global cerebral ischemia reperfusion. Pharmacol Rep. 2015;67:115–122. doi: 10.1016/j.pharep.2014.08.014. [DOI] [PubMed] [Google Scholar]
  • 21.Wang H, Wang Y, Zhao L, Cui Q, Wang Y, Du G. Pinocembrin attenuates MPP+-induced neurotoxicity by the induction of heme oxygenase-1 through ERK1/2 pathway. Neurosci Lett. 2016;612:104–109. doi: 10.1016/j.neulet.2015.11.048. [DOI] [PubMed] [Google Scholar]
  • 22.Liu R, Li JZ, Song JK, Zhou D, Huang C, Bai XY, et al. Pinocembrin improves cognition and protects the neurovascular unit in Alzheimer related deficits. Neurobiol Aging. 2014;35:1275–1285. doi: 10.1016/j.neurobiolaging.2013.12.031. [DOI] [PubMed] [Google Scholar]
  • 23.Habtemariam S. The Nrf2/HO-1 axis as targets for flavanones: Neuroprotection by pinocembrin, naringenin, and eriodictyol. Oxid Med Cell Longev. 2019;2019:4724920. doi: 10.1155/2019/4724920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bertelli D, Papotti G, Bortolotti L, Marcazzan GL, Plessi M. 1H-NMR simultaneous identification of health-relevant compounds in propolis extracts. Phytochem Anal. 2012;23:260–266. doi: 10.1002/pca.1352. [DOI] [PubMed] [Google Scholar]
  • 25.Xin M, Guo S, Zhang W, Geng Z, Liang J, Du S, et al. Chemical constituents of supercritical extracts from Alpinia officinarum and the feeding deterrent activity against Tribolium castaneum. Molecules 2017, 22. [DOI] [PMC free article] [PubMed]
  • 26.Kumar N, Biswas S, Hosur Shrungeswara A, Basu Mallik S, Hipolith Viji M, Elizabeth Mathew J, et al. Pinocembrin enriched fraction of Elytranthe parasitica (L.) Danser induces apoptosis in HCT 116 colorectal cancer cells. J Infect Chemother 2017, 23: 354–359. [DOI] [PubMed]
  • 27.Rasul A, Millimouno FM, Ali Eltayb W, Ali M, Li J, Li X. Pinocembrin: a novel natural compound with versatile pharmacological and biological activities. Biomed Res Int. 2013;2013:379850. doi: 10.1155/2013/379850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lan X, Wang W, Li Q, Wang J. The natural flavonoid pinocembrin: Molecular targets and potential therapeutic applications. Mol Neurobiol. 2016;53:1794–1801. doi: 10.1007/s12035-015-9125-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li L, Yang HG, Yuan TY, Zhao Y, Du GH. Rho kinase inhibition activity of pinocembrin in rat aortic rings contracted by angiotensin II. Chin J Nat Med. 2013;11:258–263. doi: 10.3724/SP.J.1009.2013.00258. [DOI] [PubMed] [Google Scholar]
  • 30.Soromou LW, Chu X, Jiang L, Wei M, Huo M, Chen N, et al. In vitro and in vivo protection provided by pinocembrin against lipopolysaccharide-induced inflammatory responses. Int Immunopharmacol. 2012;14:66–74. doi: 10.1016/j.intimp.2012.06.009. [DOI] [PubMed] [Google Scholar]
  • 31.Liu R, Gao M, Yang ZH, Du GH. Pinocembrin protects rat brain against oxidation and apoptosis induced by ischemia-reperfusion both in vivo and in vitro. Brain Res. 2008;1216:104–115. doi: 10.1016/j.brainres.2008.03.049. [DOI] [PubMed] [Google Scholar]
  • 32.Estevinho L, Pereira AP, Moreira L, Dias LG, Pereira E. Antioxidant and antimicrobial effects of phenolic compounds extracts of Northeast Portugal honey. Food Chem Toxicol. 2008;46:3774–3779. doi: 10.1016/j.fct.2008.09.062. [DOI] [PubMed] [Google Scholar]
  • 33.Tuchinda P, Reutrakul V, Claeson P, Pongprayoon U, Sematong T, Santisuk T, et al. Anti-inflammatory cyclohexenyl chalcone derivatives in Boesenbergia pandurata. Phytochemistry. 2002;59:169–173. doi: 10.1016/S0031-9422(01)00451-4. [DOI] [PubMed] [Google Scholar]
  • 34.Li C, Xiao L, Liu X, Yang W, Shen W, Hu C, et al. A functional role of NMDA receptor in regulating the differentiation of oligodendrocyte precursor cells and remyelination. Glia. 2013;61:732–749. doi: 10.1002/glia.22469. [DOI] [PubMed] [Google Scholar]
  • 35.Xiao L, Hu C, Yang W, Guo D, Li C, Shen W, et al. NMDA receptor couples Rac1-GEF Tiam1 to direct oligodendrocyte precursor cell migration. Glia. 2013;61:2078–2099. doi: 10.1002/glia.22578. [DOI] [PubMed] [Google Scholar]
  • 36.Yang W, Xiao L, Li C, Liu X, Liu M, Shao Q, et al. TIP30 inhibits oligodendrocyte precursor cell differentiation via cytoplasmic sequestration of Olig1. Glia. 2015;63:684–698. doi: 10.1002/glia.22778. [DOI] [PubMed] [Google Scholar]
  • 37.Zhao M, Sun D, Guan Y, Wang Z, Sang D, Liu M, et al. Disulfiram and diphenhydramine hydrochloride upregulate mir-30a to suppress IL-17-associated autoimmune inflammation. J Neurosci. 2016;36:9253–9266. doi: 10.1523/JNEUROSCI.4587-15.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sun D, Yu Z, Fang X, Liu M, Pu Y, Shao Q, et al. LncRNA GAS5 inhibits microglial M2 polarization and exacerbates demyelination. EMBO Rep. 2017;18:1801–1816. doi: 10.15252/embr.201643668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shi Y, Shao Q, Li Z, Gonzalez GA, Lu F, Wang D, et al. Myt1L promotes differentiation of oligodendrocyte precursor cells and is necessary for remyelination after lysolecithin-induced demyelination. Neurosci Bull. 2018;34:247–260. doi: 10.1007/s12264-018-0207-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kumar MA, Nair M, Hema PS, Mohan J, Santhoshkumar TR. Pinocembrin triggers Bax-dependent mitochondrial apoptosis in colon cancer cells. Mol Carcinog. 2007;46:231–241. doi: 10.1002/mc.20272. [DOI] [PubMed] [Google Scholar]
  • 41.Feng R, Guo ZK, Yan CM, Li EG, Tan RX, Ge HM. Anti-inflammatory flavonoids from Cryptocarya chingii. Phytochemistry. 2012;76:98–105. doi: 10.1016/j.phytochem.2012.01.007. [DOI] [PubMed] [Google Scholar]
  • 42.Yu Z, Sun D, Feng J, Tan W, Fang X, Zhao M, et al. MSX3 switches microglia polarization and protects from inflammation-induced demyelination. J Neurosci. 2015;35:6350–6365. doi: 10.1523/JNEUROSCI.2468-14.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Gaesser JM, Fyffe-Maricich SL. Intracellular signaling pathway regulation of myelination and remyelination in the CNS. Exp Neurol. 2016;283:501–511. doi: 10.1016/j.expneurol.2016.03.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Mitew S, Hay CM, Peckham H, Xiao J, Koenning M, Emery B. Mechanisms regulating the development of oligodendrocytes and central nervous system myelin. Neuroscience. 2014;276:29–47. doi: 10.1016/j.neuroscience.2013.11.029. [DOI] [PubMed] [Google Scholar]
  • 45.Jepson S, Vought B, Gross CH, Gan L, Austen D, Frantz JD, et al. LINGO-1, a transmembrane signaling protein, inhibits oligodendrocyte differentiation and myelination through intercellular self-interactions. J Biol Chem. 2012;287:22184–22195. doi: 10.1074/jbc.M112.366179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Huang H, Zhao XF, Zheng K, Qiu M. Regulation of the timing of oligodendrocyte differentiation: mechanisms and perspectives. Neurosci Bull. 2013;29:155–164. doi: 10.1007/s12264-013-1314-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mi S, Miller RH, Lee X, Scott ML, Shulag-Morskaya S, Shao Z, et al. LINGO-1 negatively regulates myelination by oligodendrocytes. Nat Neurosci. 2005;8:745–751. doi: 10.1038/nn1460. [DOI] [PubMed] [Google Scholar]
  • 48.Chen CH, Liao CH, Chang YL, Guh JH, Pan SL, Teng CM. Protopine, a novel microtubule-stabilizing agent, causes mitotic arrest and apoptotic cell death in human hormone-refractory prostate cancer cell lines. Cancer Lett. 2012;315:1–11. doi: 10.1016/j.canlet.2011.09.042. [DOI] [PubMed] [Google Scholar]
  • 49.Bae DS, Kim YH, Pan CH, Nho CW, Samdan J, Yansan J, et al. Protopine reduces the inflammatory activity of lipopolysaccharide-stimulated murine macrophages. BMB Rep. 2012;45:108–113. doi: 10.5483/BMBRep.2012.45.2.108. [DOI] [PubMed] [Google Scholar]
  • 50.Rommelspacher H, May T, Susilo R. Beta-carbolines and tetrahydroisoquinolines: detection and function in mammals. Planta Med. 1991;57:S85–92. doi: 10.1055/s-2006-960234. [DOI] [PubMed] [Google Scholar]
  • 51.de Meester C. Genotoxic potential of beta-carbolines: a review. Mutat Res. 1995;339:139–153. doi: 10.1016/0165-1110(95)90008-X. [DOI] [PubMed] [Google Scholar]
  • 52.Parhiz H, Roohbakhsh A, Soltani F, Rezaee R, Iranshahi M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: an updated review of their molecular mechanisms and experimental models. Phytother Res. 2015;29:323–331. doi: 10.1002/ptr.5256. [DOI] [PubMed] [Google Scholar]
  • 53.Iranshahi M, Rezaee R, Parhiz H, Roohbakhsh A, Soltani F. Protective effects of flavonoids against microbes and toxins: The cases of hesperidin and hesperetin. Life Sci. 2015;137:125–132. doi: 10.1016/j.lfs.2015.07.014. [DOI] [PubMed] [Google Scholar]
  • 54.Shagirtha K, Bashir N, MiltonPrabu S. Neuroprotective efficacy of hesperetin against cadmium induced oxidative stress in the brain of rats. Toxicol Ind Health. 2017;33:454–468. doi: 10.1177/0748233716665301. [DOI] [PubMed] [Google Scholar]
  • 55.Guardiola-Diaz HM, Ishii A, Bansal R. Erk1/2 MAPK and mTOR signaling sequentially regulates progression through distinct stages of oligodendrocyte differentiation. Glia. 2012;60:476–486. doi: 10.1002/glia.22281. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Neuroscience Bulletin are provided here courtesy of Springer

RESOURCES