Abstract
Background:
Alpha-synuclein (α-syn) preformed fibril (PFF)-induced pathology can be used to study the features and progression of synucleinopathies, such as Parkinson’s disease. Intrastriatal injection of mouse α-syn PFFs produce accumulation of α-syn pathology in both mice and rats. Previous studies in mice have revealed that greater sequence homology between the α-syn amino acid sequence used to produce PFFs with that of the endogenous host α-syn increases α-syn pathology in vivo.
New Methods:
Based on the prediction that greater sequence homology will result in more α-syn pathology, PFFs generated from recombinant rat α-syn (rPFFs) were used instead of PFFs produced from recombinant mouse α-syn (mPFFs), which are normally used in the model. Rats received unilateral intrastriatal injections of either rPFFs or mPFFs and accumulation of α-syn phosphorylated at serine 129 (pSyn) was examined at 1-month post-surgery.
Results:
Rats injected with mPFFs exhibited abundant accumulation of α-syn inclusions in the substantia nigra and cortical regions, whereas in rats injected with rPFFs had significantly fewer SNpc neurons containing pSyn inclusions (≈ 60% fewer) and little, if any, pSyn inclusions were observed in the cortex.
Conclusions:
Our results suggest that additional factors beyond the degree of sequence homology between host α-syn and injected recombinant α-syn impact efficiency of seeding and subsequent inclusion formation. More practically, these findings caution against the use of rPFFs in the rat preformed fibril model.
Keywords: Alpha-synuclein, Preformed fibrils, Synucleinopathy, Parkinson’s disease, Animal models
INTRODUCTION
The accumulation of alpha-synuclein (α-syn) is characteristic of neurodegenerative disorders known as synucleinopathies. In synucleinopathies such as Parkinson’s disease (PD), α-syn aggregation leads to the formation of Lewy bodies and Lewy neurites in neurons (1–3). Many challenges come with studying synucleinopathies. First, animals do not develop neurodegenerative diseases, thus they must be induced artificially. Second, most preclinical animal models fail to simultaneously display the main features of human idiopathic PD: normal levels of α-syn, formation of α-syn aggregates followed by neuronal loss over a protracted period (4–5). This lack of appropriate models has likely impacted the potential of these models to translate to success in clinical trials (6–8).
The α-syn preformed fibril (PFF) model recapitulates critical aforementioned features. Synucleinopathy in the PFF model is induced through exposure of primary neurons or brain tissue to α-syn fibrils produced in vitro from recombinant α-syn (9–10). These fibrils are sonicated to fragments of a smaller size, allowing PFFs to be taken up into the neurons. Once taken up by neurons through a yet undefined mechanism, PFFs trigger templating, phosphorylation, and accumulation of endogenous α-syn to form aggregates (9–15). These inclusions are Lewy body-like, in that they contain α-syn phosphorylated at serine 129 (pSyn), ubiquitin and p62, are resistant to proteinase-K, and contain amyloid structures based on positive thioflavin staining (9–16). Injection of PFFs into the striatum of rodents triggers the formation of pSyn-immunoreactive inclusions within weeks post injection (p.i.) in brain regions that directly innervate the striatum. Inclusions are most prominent in the motor, cingulate, insular, and somatosensory cortical regions, as well as the thalamus, amygdala, and ipsilateral substantia nigra pars compacta (SNpc) (10, 13–15, 17). Though pathology is present in many regions, the nigrostriatal system is the focus of many studies that use PFFs as it is the primary circuitry that degenerates and defines PD.
Previous in vivo studies in rodents and non-human primates have used PFFs produced from recombinant α-syn monomers with amino acid sequences identical to mice (mPFF) or humans (hPFFs) (10, 13–15, 18–21). Within the nigrostriatal system, the progression of the synucleinopathy induced by mPFFs has been extensively characterized in rodent models. In both mice and rats, the number of inclusion-containing neurons in the ipsilateral SNpc peaks between 1–2 months, followed by loss of tyrosine hydroxylase immunoreactivity (THir) and subsequent neurodegeneration by 6 months p.i. (10, 13–15). The amino acid sequence of human and mouse α-syn differs by seven amino acids, at positions 53, 87, 100, 103, 107, 121, and 122 (22). In the mouse PFF model, intrastriatal injections of mPFFs produce three times the nigral pSyn pathology than hPFFs, and result in ~40% THir neuron loss in the SNpc by 6 months p.i., where hPFFs cause no significant THir neuron loss (18). Based on these findings, it is predicted that greater sequence homology of PFFs to the host species would increase the seeding efficiency of the PFFs, and result in more pSyn inclusions. We therefore hypothesized that fibrils generated from recombinant rat α-syn (rPFFs) would produce augmented pSyn pathology than the same quantity of mPFFs in rats. Rat α-syn differs by only a single amino acid at position 121 from mice, where the mouse sequence contains a glycine and the rat sequence contains serine (22; Fig. 1). Surprisingly, pathology produced by intrastriatal rPFF injections was mostly restricted to the SNpc, with few pSyn inclusion containing cells present in regions other than the SNpc. Further, the magnitude of nigral pSyn pathology resulting from rPFF injections was modest, approximately one third the pSyn pathology observed in the SN following equivalent mPFF injections. These results suggest that host and PFF α-syn sequence homology alone does not guarantee robust templating of pathological α-syn. More practically, these findings caution against the use of rPFFs in the rat PFF model.
Figure 1. Mouse and Rat Alpha-synuclein sequences.
Amino acid sequences of Mus musculus (mouse) and Rattus norvegicus (rat) alpha-synuclein. Sequences differ only at position 121 (highlighted in yellow), where the mouse sequence contains a glycine and the rat sequence contains serine. The variance at position 121 is the sole difference between the α-syn monomers used to produce mPFFs and rPFFs.
MATERIALS AND METHODS
Animals
Three-month-old, male Fischer 344 rats (n=20; 6 mPFF and 6 rPFF at one month, and 8 rPFF at two-months post-injection) were purchased from Charles River Laboratories. Rats were housed 1–3 per cage in a room on 12 h light/dark cycle, and food and water were provided ad libitum. All animal work was performed in the Michigan State University Grand Rapids Research Center vivarium. All procedures were approved and conducted in accordance with the Michigan State University Institute for Animal Use and Care Committee (IACUC).
PFF Sonication and Quality Control
Recombinant α-syn was generated using either the mouse (5’-ATGGATGTGTTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAGCAGGGTGTGGCAGAGGCAGCTGGAAAGACAAAAGAGGGAGTCCTCTATGTAGGTTCCAAAACTAAGGAAGGAGTGGTTCATGGAGTGACAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACTGGTGTGACAGCAGTCGCTCAGAAGACAGTGGAGGGAGCTGGGAATATAGCTGCTGCCACTGGCTTTGTCAAGAAGGACCAGATGGGCAAGGGTGAGGAGGGGTACCCACAGGAAGGAATCCTGGAAGACATGCCTGTGGATCCTGGCAGTGAGGCTTATGAAATGCCT TCAGAGGAAGGCTACCAAGACTATGAGCCTGAAGCCTAA-3’) as described in (10), or rat (5’-ATGGATGTGTTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAGCAGGGTGTGGCAGAGGCAGCTGGGAAGACAAAAGAGGGCGTCCTCTATGTAGGTTCCAAAACTAAGGAGGGAGTCGTTCATGGAGTGACAACAGTGGCTGAGAAGACCAAAGAACAAGTGACAAATGTTGGAGGGGCAGTGGTGACTGGTGTGACAGCAGTCGCTCAGAAGACAGTGGAGGGAGCTGGGAACATTGCTGCTGCCACTGGTTTTGTCAAGAAGGACCAGATGGGCAAGGGTGAAGAAGGGTACCCACAAGAGGGAATCCTGGAAGACATGCCTGTGGACCCTAGCAGTGAGGCTTATGAAATGCCT TCAGAGGAAGGCTACCAAGACTATGAGCCTGAAGCCTAA-3’) DNA sequence cloned into bacteria, then purified (9–11). Monomeric α-syn was diluted to a concentration of 5 mg/mL, fibril assembly was performed by shaking the fibrils at 1,000 RPM at 37°C for one week. Prior to use, quality control testing was performed on PFFs as previously described (9–11, 16, 18, 23). Amyloid content in fibril preparations was confirmed with Thioflavin-T fluorimetry, transmission electron microscopy, and sedimentation following centrifugation at 100,000 × g for 30 mins. The presence of a single dominant band following coomassie staining suggests the preservation of the intact α-syn protein while the abundance of the pellet fraction, with only trace amounts are present in the supernatant fraction, indicates little to no remaining monomeric α-syn within preparations (Supplemental Figure 1). Endotoxin levels were measured at ≤ 0.5 EU /mg. Each fibril batch was also shown to seed pSyn-immunoreactive inclusions in mouse hippocampal neurons (CD-1) before use (Supplemental Figure 1). Of note, rPFFs also produced inclusions in culture, but were not as pathogenic as mPFFs. Both mPFFs and rPFFs were fibrilized in the Luk lab as described previously and a single validated lot of mPFFs or rPFFs were used for the experiment (9–11, 23). PFFs were diluted in sterile Dulbecco’s PBS (DPBS), sonicated, and measured by electron microscopy (15–16).
Stereotaxic Surgeries
Rats received a total of 16 μg of either mouse or rat PFFs (4 μg/μl, 2×2 μl injections). Rats were anesthetized using isoflurane and received intrastriatal injections (AP +1.0, ML +2.0, DV −4.0; AP +0.1, ML +4.2, DV −5.0). AP and ML coordinates were measured from bregma, and DV coordinates were measured from dura. Injections and post-surgery care were performed as previously described (15).
Immunohistochemistry
Animals were euthanized, brains collected and processed for immunohistochemistry as previously described (15). Primary antibodies used were: 1:10,000 mouse anti-phosphorylated α-syn at serine 129 (Abcam, AB184674), 1:5,000 mouse anti-α-syn oligomers/fibrils (O2) (El-Agnaf lab), 1:1,000 rabbit anti-phosphorylated α-syn at serine 129 used to detect pSyn* (GeneTex, GTX50222), and 1:4,000 rabbit anti-tyrosine hydroxylase (Millipore, MAB152). Corresponding secondary antibodies of either goat anti-mouse (Millipore, AP124B) or goat anti-rabbit (Millipore, AP132B) were used at 1:500.
Total Enumeration
Total enumeration of pSyn and pSyn* containing neurons was performed as previously described (15). To estimate the total number of neurons in each animal with inclusions, total counts for each animal were multiplied by six.
Imaging and Stipple Images
Imaging was performed with a Nikon Eclipse 90i microscope with a QICAM camera (QImaging, Surrey, British Columbia, Canada), using Nikon Elements AR software (Version 4.500.00, Melville, NY). Stippled images were created from stitched micrographs Adobe Photoshop CS2.
Statistics
Statistical analysis was performed using GraphPad Prism, and significance for all cases was performed using α ≤ 0.05. Outliers were assessed using the absolute deviation from the median method (24), with a “very conservative” difference of 2.5X median absolute deviation used as the exclusion criteria. Groups were compared using an unpaired two-tailed Student’s t-test.
RESULTS
Rat and mouse α-syn preformed fibril length is identical following sonication
Prior to stereotaxic surgeries, PFFs were sonicated with identical parameters, and PFF length determined using transmission electron microscopy. Sonicated PFFs were measured to determine if the species of the monomer altered sonication efficacy or appearance. Fibril length distribution ranged from 29–104 nm for mPFFs, and 23–142 nm for rPFFs. With the mPFFs 90.1% of fibrils were ≤ 60 nm, and 86.2% of rPFFs were ≤ 60 nm, in agreement with the previously determined optimal fibril length for neuron internalization (19, 25). The average lengths were 48.38 ± 0.48 for mPFFs, and 47.87 ± 0.63 for rPFFs. There was no difference in the mean fibril lengths between rPFFs and mPFFs (unpaired t-test; p = 0.5252) (Fig. 2). These results show that both species of fibrils were the same length and suggests fibril length is not a critical difference between rPFFs and mPFFs that would influence inclusion formation.
Figure 2. Rat and mouse PFF length is identical following sonication.
Post-sonication, over 500 PFFs per sample were imaged and measured via transmission election microscopy. (A) PFF lengths of mPFFs and rPFFs. Each circle denotes a measured fibril, black line denotes the group means, error bars represent the standard deviation. Transmission electron micrographs of sonicated (B) mPFFs and (C) rPFFs. (D) Post-sonication distribution of PFF lengths, columns show the percent of mPFFs and rPFFs samples grouped in 10 nm intervals. Scale bar = 200 nm.
rPFF injection results in limited accumulation of pSyn inclusions throughout the brain
Qualitative examination of pSyn inclusion accumulation throughout the brain was assessed 1-month p.i. (Fig. 3). In rats injected with the mPFFs, accumulation of pSyn in the soma and/or neurites was observed in the anterior olfactory nucleus, motor, cingulate, piriform, prelimbic, somatosensory, entorhinal, and insular cortices; amygdala, striatum, and SNpc. In the piriform cortex and striatum, pSyn immunoreactivity was mostly confined to the neurites, where in all other regions it was observed in both soma and neurites. In contrast, accumulation of pSyn inclusions in rats that received rPFFs was markedly reduced throughout the brain. Specifically, reduced pSyn inclusions were observed in the ipsilateral SNpc compared to mPFF injected rats and very few, if any, inclusions were present in cortical areas and the amygdala, primarily presenting in neurites. Additional examination of the amygdala showed that some neurites were also O2-immunoreactive, indicating the presence of oligomeric and possibly fibrillar forms of α-syn (Supplemental Figure 2).
Figure 3. pSyn immunoreactivity following mouse or rat PFF intrastriatal injection.
(Top) Traced and stippled images of representative coronal sections throughout the rat brain from animals injected with mPFFs or rPFFs. Regions labeled are the anterior olfactory nucleus (O), motor cortex (M), cingulate cortex (C), piriform cortex (P), insular cortex (I), somatosensory cortex (S), amygdala (A), striatum (ST), and substantia nigra (SN). Two red dots indicate the approximate location of the intrastriatal injection sites, though the actual injection coordinates are more rostral than the section shown. Each black dot represents a single pSyn-immunoreactive cell in the section, as defined by staining of the soma. Neurites positive for pSyn immunoreactivity were not marked on the traced images. Scale bar = 2 mm. (Bottom) Micrographs from regions with prevalent pSyn immunoreactivity. Scale bar = 50 μm.
Rats injected with rPFFs exhibit significantly fewer pSyn inclusions in the SNpc
To compare the ability of rPFFs and mPFFs to produce pathology in the SNpc, total enumeration was used to quantify pSyn-immunoreactive neurons. The ipsilateral SNpc in all rats contained pSyn-immunoreactive inclusions by 1-month p.i., regardless of whether mPFFs or rPFFs were injected. No pSyn was observed in the contralateral SNpc in either mPFF or rPFF injected animals, consistent with previous reports (13–15). However, the species of α-syn monomers used to produce the PFFs significantly impacted the magnitude of inclusion formation in the SNpc, with rats that received the rPFFs possessing approximately 30% of the number of pSyn inclusions compared to rats that received mPFFs (unpaired t-test; p = 0.0001). Rats injected with mPFFs possessed 4621 ± 475 pSyn-immunoreactive neurons whereas rats injected with rPFFs possessed 1467 ± 244 (Fig. 4A–C). pSyn STAR (α-syn truncated adamant and reactive, pSyn*) is another marker for pSyn inclusions, believed to represent a partially degraded pSyn and thus a later stage of pSyn accumulation (26). As with pSyn, we observed significantly fewer pSyn*-immunoreactive neurons in rats injected with rPFFs compared to mPFF-injected rats (unpaired t-test; p = 0.0029). The mean number of pSyn* containing SNpc neurons in the rats injected with mPFFs was 4013 ± 470 compared to 1946 ± 242 in rats injected with rPFFs (Fig. 4D–F). Collectively, our analysis of pSyn and pSyn* immunoreactivity reveals mPFFs were more effective in inclusion formation than rPFFs.
Figure 4. Assessment of pSyn and pSyn* immunoreactivity in the substantia nigra at 1-month post-injection.
Micrographs showing pSyn-immunoreactivity in the ipsilateral SNpc in rats injected with either (A) mPFFs or (B) rPFFs. Micrographs showing pSyn*-immunoreactivity in the ipsilateral SNpc in rats injected with either (D) mPFFs or (E) rPFFs. Scale bar = 500 μm. Boxed areas denote the high magnification inset. Scale bar = 50 μm. (C) Total enumeration of pSyn-immunoreactive neurons. (F) Total enumeration of pSyn*-immunoreactive neurons. Columns indicate the group means, circles represent data points, error bars represent ± 1 standard error of the mean, an asterisk represents a significant difference with a two-tailed t-test (p < 0.05). (G) IHC for TH in the ipsilateral and contralateral SNpc in a representative rPFF injected animal. Scale bar = 1,000 μm.
PFF species does not impact TH-immunoreactivity
In rats receiving intrastriatal mPFF injections, loss of TH immunoreactivity in ipsilateral nigral pSyn inclusion-bearing neurons begins between 2–4 months p.i. followed by overt neuronal loss by 6 months (15). Based on these previous results, we wouldn’t expect there to be a loss of THir neurons at 1-month p.i. in the SNpc. To examine whether our observation of fewer pSyn inclusion-bearing SNpc neurons in rats receiving rPFFs was due to earlier loss of SNpc neurons we examined THir neurons in the ipsilateral and contralateral SNpc (Fig. 4G). We observed no apparent difference in THir SNpc neurons between the ipsilateral and contralateral hemispheres of rats that received rPFFs, suggesting the reduced number of inclusions observed in the SNpc of rats receiving rPFF injections was not due to loss of SNpc neurons. We also have examined rats two months following rPFFs for the presence of pSyn inclusions. In this cohort we observed little pSyn pathology in the SNpc and other regions which display pathology with mPFFs (Supplemental Figure 3). Similar to the one month post-PFF, we did not observe decreased THir neurons in the ipsilateral SNpc at two months following rPFF injection. This suggests that the reduced pSyn pathology associated with rPFF injections compared to mPFF injections is not due to a delay in inclusion formation (Supplemental Figure 3).
DISCUSSION
Intrastriatal injection of mPFFs into rats predictably and simultaneously seeds nigral, cortical, and amygdala pSyn accumulation at early time points following injection, reflecting the density of striatal inputs from these structures (13–15, 17). In the present study, we observe a similar magnitude of pSyn accumulation in rats injected with mPFFs as has been observed previously (13–15). However, we now provide evidence that rPFFs are less effective than mPFFs in seeding pSyn inclusions in the SNpc (mPFF:rPFF = 3:1). Similarly, rats receiving rPFFs had significantly fewer pSyn*-immunoreactive neurons compared to rats that received mPFFs (mPFF:rPFF = 2:1) suggesting that the reduced pSyn inclusions that we observed in the SNpc of rPFF injected rats was not the result of more rapid degradation of pSyn inclusions (26). The absence of a qualitative change in TH-immunoreactivity between ipsilateral and contralateral SNpc shows that the difference in the number of inclusion-bearing neurons produced by rPFFs is not due to neurodegeneration. Further, the disparity between rPFF and mPFF cortical and amygdala seeding ability appears even more pronounced, with rPFFs producing minimal pSyn accumulation in extranigral structures. This suggests that intrinsic differences between nigrostriatal, corticostriatal, and amygdalostriatal neurons differentially interact with rat and mouse PFF seeding propensity to alter accumulation of pSyn inclusions. One possibility is that the unique dopaminergic phenotype of nigrostriatal neurons facilitates pSyn aggregation (27), a covariate perhaps not fully appreciated when efficient mPFF-triggered pSyn seeding occurs.
There are a number of factors that influence the ability of PFFs to trigger α-syn pathology. PFFs must first be taken up by neurons, prior to the templating and increased phosphorylation of endogenous α-syn. Differences in fibril length after PFF sonication have been shown to influence the resulting pathology in vivo, with size predicted to affect PFF uptake in neurons. Shorter fibrils, approximately 50 nm or less in length are considered the optimal fibril size (19, 25). In this study, we observed no difference in rPFFs and mPFFs lengths, and over 85% of the measured PFFs of both species were in the optimal fibril size range. Therefore, fibril size is not likely the factor driving the disparity between rat and mouse PFF pSyn seeding ability. The majority of innervation to the striatal injection site comes from the cortex (17), however following rPFF injections very few cortical pSyn inclusions were observed. This suggests that factors beyond differences in uptake efficiency between rat and mouse PFFs contribute to the differences observed, perhaps less efficient seeding once internalized. Though the average lengths of the fibrils are the same, it is still possible that structural differences exist. The single amino acid difference between mouse and rat α-syn could be sufficient to influence fibril formation of the rPFFs, as small changes in buffers (28) and even the intracellular milieu (29) can significantly alter the efficacy of the PFFs. To address the question of structural differences, more analyses such as cryo-electron microscopy or x-ray crystallography would need to be employed in the future.
An additional consideration to the study is the rat strain used. Previous PFF studies in rats have been mainly performed using Sprague-Dawley or Fischer 344 rats (13–16). A strain specific difference in PFF-induced inclusion formation has been previously observed in mice (19). Based on this, we cannot rule out the possibility that rPFFs could produce more pathology in another strain of rat. Another limitation of this study is that a single batch of rPFFs was used for all the rPFF injections. This batch passed all of the in vitro QC tests, and produced pSyn positive inclusions in cultured mouse hippocampal neurons. However, it may be possible that a different batch of rPFFs could yield more pathology.
Overall, the meager seeding of the rPFFs is unexpected. Amino acid sequence homology of α-Syn used to generate PFFs compared with the host-species has been shown to be predictive of seeding efficiency in vitro and in mice (18). Importantly, human chimeric α-syn designed to be a few amino acids closer in homology to mouse α-syn can increase seeding efficiency (18). However, this is not the case with rPFFs. In our study, mPFFs seeded pathology more efficiently in rats. This could suggest the single amino acid difference between rat and mouse α-syn impacts the initial templating of endogenous rat α-syn, with glycine at position 121 in mPFFs providing a superiorly permissive template compared to serine at position 121 in rPFFs. Additionally, human α-syn differs at position 121 (and at 6 other locations) between rats and mice where humans have an aspartic acid (22). Position 121 within the C-terminal tail of α-syn has been shown in vitro to be the site of Caspase-1 cleavage (30). Cleavage by Caspase-1 has been stated to produce a truncated form of human α-syn that has been called a “highly aggregation-prone species” and can aggregate and form amyloid structures significantly faster than full length α-syn (30). Interestingly, an amino acid substitution from aspartic acid to glutamic acid in human α-syn can block Caspase-1 cleavage (30). Based on these findings, and assuming that Caspase-1 cleavage is an important part of the process within the formation of pSyn aggregates, it is possible that the glycine in mice promotes or is at least permissive to Caspase-1 cleavage, whereas the serine in rats at position 121 could be inhibitory to Caspase-1 cleavage. The difference in Caspase-1 cleavage could alter the initial misfolded template of α-Syn which is essential to initiating the recruitment and aggregation of endogenous α-Syn. Further study is required to determine whether the serine at position 121 in rat α-syn is less permissive for Caspase-1 cleavage.
The PFF model offers many advantages that can allow for the study of the progression of synucleinopathy in vivo (4–5). As is the case with all models, it is important to standardize the use of the model and explore which variables can affect the end results. Our data suggest that rPFFs should not be used in the rat PFF model due to meager accumulation of pSyn pathology. Rather, mPFFs, though not identical to the sequence of rat α-syn, are more ideal, as they consistently produce widespread pathology in regions innervating the striatum and by extension, nigral degeneration.
Supplementary Material
Supplemental Figure 1. Quality control of rPFFs. Micrographs showing pSyn immunoreactivity in CD-1 primary hippocampal neurons treated with (A) PBS, (B) mPFFs, or (C) rPFFs. (D) Image of Coomassie stained gel from a sedimentation assay performed using rat synuclein. Supernatant (S) or pelleted (P) fractions show fibrilized synuclein is present in the pellet and monomeric synuclein present in the supernatant fraction.
Supplemental Figure 2. Assessment of pSyn and O2 immunoreactivity in the amygdala at 1-month post-injection of rPFFs. Micrographs showing (A) pSyn-immunoreactivity or (B) O2-immunoreactivity in the ipsilateral amygdala in rats injected with rPFFs. Images were acquired from adjacent tissue sections. Scale bar = 100 μm. Boxed areas denote the high magnification inset. Scale bar = 10 μm.
Supplemental Figure 3. TH and pSyn and immunoreactivity at 2-months post-injection. Micrographs showing IHC for pSyn in the ipsilateral (A) motor cortex, (B) piriform cortex, (C) somatosensory cortex, (D) amygdala, (E) striatum. Scale bar = 100 μm. (F) IHC for pSyn in the ipsilateral SNpc. Scale bar = 500 μm. Boxed areas denote the high magnification inset. Scale bar = 50 μm. (G) IHC for TH in the ipsilateral and contralateral SNpc in a representative rPFF injected animal. Scale bar = 1,000 μm.
HIGHLIGHTS.
Rat PFFs produce little to no pathology in regions other than the substantia nigra
Mouse PFFs produce significantly more nigral pathology than rat PFFs in a rat model
Alpha-synuclein amino acid sequence impacts efficient inclusion seeding
ACKNOWLEDGEMENTS
This work was supported by the National Institute of Neurological Disorders and Stroke (NS099416) and the Michael J. Fox Foundation for Parkinson’s Research.
Footnotes
CONFLICTS OF INTEREST
Authors have no conflicts of interest to disclose or competing interests with regards to data presented within this manuscript.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- [1].Graybiel AM, Hirsch EC, Agid Y, The nigrostriatal system in Parkinson’s disease, Adv. Neurol. 53 (1990) 17–29. [PubMed] [Google Scholar]
- [2].Pollanen MS, Dickson DW, Bergeron C, Pathology and biology of the Lewy body, J. Neuropathol. Exp. Neurol. 52 (1993) 183–191. [DOI] [PubMed] [Google Scholar]
- [3].Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M, Alpha-synuclein in lewy bodies, Nature 388 (1997) 839–840. [DOI] [PubMed] [Google Scholar]
- [4].Volpicelli-Daley LA, Kirik D, Stoyka LE, Standaert DG, Harms AS, How can rAAV-alpha-synuclein and the fibril alpha-synuclein models advance our understanding of Parkinson’s disease? J. Neurochem. 139 (Suppl 1) (2016) 131–155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Duffy MF, Collier TJ, Patterson JR, Kemp CJ, Luke Fischer D, Stoll AC, Sortwell CE, Quality over quantity: advantages of using alpha-synuclein preformed fibril triggered synucleinopathy to model idiopathic Parkinson’s disease, Front. Neurosci. 12 (2018) 621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Potashkin JA, Blume SR, Runkle NK, Limitations of animal models of Parkinson’s disease, Parkinson’s Dis. (2010) 658083, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Munoz P, Paris I, Segura-Aguilar J, Corrigendum: commentary: evaluation of models of Parkinson’s disease, Front. Neurosci. 10 (2016) 320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Zeiss CJ, Allore HG, Beck AP, Established patterns of animal study design undermine translation of disease-modifying therapies for Parkinson’s disease, PloS one 12 (2017), e0171790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Volpicelli-Daley LA, Luk KC, Patel TP, Tanik SA, Riddle DM, Stieber A, Meaney DF, Trojanowski JQ, Lee VM, Exogenous alpha-synuclein fibrils induce Lewy body pathology leading to synaptic dysfunction and neuron death, Neuron 72 (2011) 57–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Luk KC, Kehm V, Carroll J, Zhang B, O’Brien P, Trojanowski JQ, Lee VM, Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice, Science 338 (2012) 949–953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Volpicelli-Daley LA, Luk KC, Lee VM, Addition of exogenous alpha-synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy neurite-like aggregates, Nat. Protoc. 9 (2014) 2135–2146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Osterberg VR, Spinelli KJ, Weston LJ, Luk KC, Woltjer RL, Unni VK, Progressive aggregation of alpha-synuclein and selective degeneration of lewy inclusion-bearing neurons in a mouse model of parkinsonism, Cell Rep. 10 (2015) 1252–1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13].Paumier KL, Luk KC, Manfredsson FP, Kanaan NM, Lipton JW, Collier TJ, Steece-Collier K, Kemp CJ, Celano S, Schulz E, Sandoval IM, Fleming S, Dirr E, Polinski NK, Trojanowski JQ, Lee VM, Sortwell CE, Intrastriatal injection of pre-formed mouse alpha-synuclein fibrils into rats triggers alpha-synuclein pathology and bilateral nigrostriatal degeneration, Neurobiol. Dis. 82 (2015) 185–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Duffy MF, Collier TJ, Patterson JR, Kemp CJ, Luk KC, Tansey MG, Paumier KL, Kanaan NM, Fischer DL, Polinski NK, Barth OL, Howe JW, Vaikath NN, Majbour NK, El-Agnaf OMA, Sortwell CE, Lewy body-like alpha-synuclein inclusions trigger reactive microgliosis prior to nigral degeneration, J. Neuroinflammation 15 (2018) 129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].Patterson JR, Duffy MF, Kemp CJ, Howe JW, Collier TJ, Stoll AC, Miller KM, Patel P, Levine N, Moore DJ, Luk KC, Fleming SM, Kanaan NM, Paumier KL, El-Agnaf OMA, Sortwell CE, Time course and magnitude of alpha-synuclein inclusion formation and nigrostriatal degeneration in the rat model of synucleinopathy triggered by intrastriatal alpha-synuclein preformed fibrils, Neurobiol. Dis. 130 (2019) 104525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Patterson JR, Polinski NK, Duffy MF, Kemp CJ, Luk KC, Volpicelli-Daley LA, Kanaan NM, Sortwell CE, Generation of alpha-synuclein preformed fibrils from monomers and use in vivo, JoVE (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17].Wall NR, De La Parra M, Callaway EM, Kreitzer AC, Differential innervation of direct- and indirect-pathway striatal projection neurons, Neuron 79 (2013) 347–360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Luk KC, Covell DJ, Kehm VM, Zhang B, Song IY, Byrne MD, Pitkin RM, Decker SC, Trojanowski JQ, Lee VM, Molecular and biological compatibility with host alpha-synuclein influences fibril pathogenicity, Cell Rep. 16 (2016) 3373–3387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Abdelmotilib H, Maltbie T, Delic V, Liu Z, Hu X, Fraser KB, Moehle MS, Stoyka L, Anabtawi N, Krendelchtchikova V, Volpicelli-Daley LA, West A, alpha-Synuclein fibril-induced inclusion spread in rats and mice correlates with dopaminergic Neurodegeneration, Neurobiol. Dis. 105 (2017) 84–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Shimozawa A, Ono M, Takahara D, Tarutani A, Imura S, Masuda-Suzukake M, Higuchi M, Yanai K, Hisanaga SI, Hasegawa M, Propagation of pathological alpha-synuclein in marmoset brain, Acta neuropathologica communications 5 (2017) 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Chu Y, Muller S, Tavares A, Barret O, Alagille D, Seibyl J, Tamagnan G, Marek K, Luk KC, Trojanowski JQ, Lee VMY, Kordower JH, Intrastriatal alpha-synuclein fibrils in monkeys: spreading, imaging and neuropathological changes, Brain: J. Neurol. 142 (2019) 3565–3579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Lavedan C, The synuclein family, Genome Res. 8 (1998) 871–880. [DOI] [PubMed] [Google Scholar]
- [23].Polinski NK, Volpicelli-Daley LA, Sortwell CE, Luk KC, Cremades N, Gottler LM, Froula J, Duffy MF, Lee VMY, Martinez TN, Dave KD, Best practices for generating and using alpha-synuclein pre-formed fibrils to model Parkinson’s disease in rodents, J. Parkinsons Dis. 8 (2018) 303–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Leys C, Ley C, Klein O, Bernard P, Licata L, Detecting outliers: do not use standard deviation around the mean, use absolute deviation around the median, J. Exp. Soc. Psychol. 49 (4) (2013) 764–766. [Google Scholar]
- [25].Tarutani A, Suzuki G, Shimozawa A, Nonaka T, Akiyama H, Hisanaga S, Hasegawa M, The effect of fragmented pathogenic alpha-synuclein seeds on prion-like propagation, J. Biol. Chem. 291 (2016) 18675–18688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Grassi D, Howard S, Zhou M, Diaz-Perez N, Urban NT, Guerrero-Given D, Kamasawa N, Volpicelli-Daley LA, LoGrasso P, Lasmezas CI, Identification of a highly neurotoxic alpha-synuclein species inducing mitochondrial damage and mitophagy in Parkinson’s disease, in: Proceedings of the National Academy of Sciences of the United States of America 115, 2018, pp. E2634–E2643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Outeiro TF, Klucken J, Bercury K, Tetzlaff J, Putcha P, Oliveira LM, Quintas A, McLean PJ, Hyman BT, Dopamine-induced conformational changes in alpha-synuclein, PloS one 4 (2009), e6906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Bousset L, Pieri L, Ruiz-Arlandis G, Gath J, Jensen PH, Habenstein B, Madiona K, Olieric V, Bockmann A, Meier BH, Melki R, Structural and functional characterization of two alpha-synuclein strains, Nat. Commun. 4 (2013) 2575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Peng C, Gathagan RJ, Covell DJ, Medellin C, Stieber A, Robinson JL, Zhang B, Pitkin RM, Olufemi MF, Luk KC, Trojanowski JQ, Lee VM, Cellular milieu imparts distinct pathological alpha-synuclein strains in alpha-synucleinopathies, Nature 557 (2018) 558–563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Wang W, Nguyen LT, Burlak C, Chegini F, Guo F, Chataway T, Ju S, Fisher OS, Miller DW, Datta D, Wu F, Wu CX, Landeru A, Wells JA, Cookson MR, Boxer MB, Thomas CJ, Gai WP, Ringe D, Petsko GA, Hoang QQ, Caspase-1 causes truncation and aggregation of the Parkinson’s disease-associated protein alpha-synuclein, in: Proceedings of the National Academy of Sciences of the United States of America 113, 2016, pp. 9587–9592. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental Figure 1. Quality control of rPFFs. Micrographs showing pSyn immunoreactivity in CD-1 primary hippocampal neurons treated with (A) PBS, (B) mPFFs, or (C) rPFFs. (D) Image of Coomassie stained gel from a sedimentation assay performed using rat synuclein. Supernatant (S) or pelleted (P) fractions show fibrilized synuclein is present in the pellet and monomeric synuclein present in the supernatant fraction.
Supplemental Figure 2. Assessment of pSyn and O2 immunoreactivity in the amygdala at 1-month post-injection of rPFFs. Micrographs showing (A) pSyn-immunoreactivity or (B) O2-immunoreactivity in the ipsilateral amygdala in rats injected with rPFFs. Images were acquired from adjacent tissue sections. Scale bar = 100 μm. Boxed areas denote the high magnification inset. Scale bar = 10 μm.
Supplemental Figure 3. TH and pSyn and immunoreactivity at 2-months post-injection. Micrographs showing IHC for pSyn in the ipsilateral (A) motor cortex, (B) piriform cortex, (C) somatosensory cortex, (D) amygdala, (E) striatum. Scale bar = 100 μm. (F) IHC for pSyn in the ipsilateral SNpc. Scale bar = 500 μm. Boxed areas denote the high magnification inset. Scale bar = 50 μm. (G) IHC for TH in the ipsilateral and contralateral SNpc in a representative rPFF injected animal. Scale bar = 1,000 μm.