Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2021 Aug 18;297(3):101089. doi: 10.1016/j.jbc.2021.101089

A familial Danish dementia rat shows impaired presynaptic and postsynaptic glutamatergic transmission

Tao Yin 1, Wen Yao 1, Kelly A Norris 1, Luciano D’Adamio 1,∗
PMCID: PMC8429969  PMID: 34416235

Abstract

Familial British dementia and familial Danish dementia are neurodegenerative disorders caused by mutations in the gene integral membrane protein 2B (ITM2b) encoding BRI2, which tunes excitatory synaptic transmission at both presynaptic and postsynaptic termini. In addition, BRI2 interacts with and modulates proteolytic processing of amyloid-β precursor protein (APP), whose mutations cause familial forms of Alzheimer's disease (AD) (familial AD). To study the pathogenic mechanisms triggered by the Danish mutation, we generated rats carrying the Danish mutation in the rat Itm2b gene (Itm2bD rats). Given the BRI2/APP interaction and the widely accepted relevance of human amyloid β (Aβ), a proteolytic product of APP, to AD, Itm2bD rats were engineered to express two humanized App alleles and produce human Aβ. Here, we studied young Itm2bD rats to investigate early pathogenic changes in these diseases. We found that periadolescent Itm2bD rats not only present subtle changes in human Aβ levels along with decreased spontaneous glutamate release and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor–mediated responses but also had increased short-term synaptic facilitation in the hippocampal Schaeffer-collateral pathway. These alterations in excitatory interneuronal communication can impair learning and memory processes and were akin to those observed in adult mice producing rodent Aβ and carrying either the Danish or British mutations in the mouse Itm2b gene. Collectively, the data show that the pathogenic Danish mutation alters the physiological function of BRI2 at glutamatergic synapses across species and early in life. Future studies will determine whether this phenomenon represents an early pathogenic event in human dementia.

Keywords: familial Danish dementia, amyloid precursor protein, amyloid β, neurodegeneration, synaptic plasticity, rat, animal model, glutamate, BRI2, integral membrane protein 2B

Abbreviations: Aβ, amyloid β; ACSF, artificial cerebrospinal fluid; AD, Alzheimer's disease; AMPAR, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor; APP, amyloid-β precursor protein; FBD, familial British dementia; FDD, familial Danish dementia; imBRI2, immature BRI2; ISI, interstimulus interval; ITM2b, integral membrane protein 2B; KI, knock in; mBRI2, mature BRI2; mEPSC, miniature excitatory postsynaptic current; NFT, neurofibrillary tangle; NMDAR, N-methyl-d-aspartic acid; PPF, paired-pulse facilitation; Pr, probability of release; Rs, series resistance; SC, Schaeffer-collateral


Model organisms that reproduce the pathogenesis of human diseases are useful to dissect disease mechanisms, identify therapeutic targets, and test therapeutic strategies. Because genetic manipulation has been easier in mice, mice have overtaken rats as the major rodent-based model organism in neurodegeneration research. Thus, to study familial Danish dementia (FDD) and familial British dementia (FBD), 15 years ago, we generated mice carrying the pathogenic Danish and British dementia mutations (integral membrane protein 2B [ITM2b]; Itm2bD and Itm2bB mice) into the Itm2b mouse gene (1, 2, 3). We choose a knock-in (KI) approach rather than the more common transgenic overexpression approach for several reasons. KIs mimic the genetic of FDD and FBD and make no assumption about pathogenic mechanisms (except the unbiased genetic one), whereas the transgenic approach aims to reproduce pathology (plaques, neurofibrillary tangles [NFTs], etc.), under the assumption that this “pathology” is pathogenic. In KI models, expression of mutant genes is controlled by endogenous regulatory elements, avoiding issues related to overexpression of disease proteins in a nonphysiological quantitative–spatial–temporal manner. Finally, potential confounding “insertion” effects of transgenes are avoided.

Because rats are better suited to study neurodegenerative diseases, we took advantage of recent developments in gene-editing technologies and introduced the familial Danish mutation into the genomic Itm2b rat locus (Itm2bD rats). The rat was the organism of choice for most behavioral, memory, and cognitive research, which is critical when studying neurodegenerative diseases—because physiological processes are similar in rats and humans and the rat is an intelligent and quick learner (4, 5, 6, 7).

Several procedures that are important in dementia research are more easily performed in rats as compared with mice because of the larger size of the rat brain. Cannulas—to administer drugs, biologics, viruses, and others—and microdialysis probes—for sampling extracellular brain levels of neurotransmitters, amyloid β (Aβ), soluble tau, and others—can be accurately directed to individual brain regions, causing less damage and increasing specificity. In vivo brain imaging techniques, such as MRI (8) and PET (9, 10, 11), can assess the extent and course of neurodegeneration with better spatial resolution in rats. Moreover, rats are large enough for convenient in vivo electrophysiological recordings or serial sampling of cerebrospinal fluid for detection of biomarkers.

Finally, gene-expression differences suggest that rats may be advantageous model of neurodegenerative diseases over mice. For example, alternative spicing of tau (12, 13, 14, 15), which forms NFTs and is mutated in frontotemporal dementia (16, 17, 18, 19, 20, 21, 22, 23), leads to expression of tau isoforms with three or four microtubule-binding domains (3R and 4R, respectively). Adult human and rat brains express both 3R and 4R tau isoforms (24): in contrast, adult mouse brains express only 4R tau (25), suggesting that the rat may be a better model organism for dementias with tauopathy, such as FDD and FBD.

BRI2 physically interacts with and modulates processing of amyloid-β precursor protein (APP), which bears relevance to Alzheimer's disease (AD) pathogenesis (26, 27, 28, 29, 30). In addition, APP processing mediates long-term potentiation and memory deficits of Danish and British KI mice (31, 32, 33, 34, 35, 36). Aggregated forms of Aβ, a product of APP processing, are by and large considered the main pathogenic molecule in AD. Rat and human APP differ by three amino acids in the Aβ region: given that human Aβs are believed to have higher propensity to form toxic Aβ species as compared with rodent Aβs, we produced rats carrying the humanized Aβ sequence (Apph rats) (37, 38). Thus, to study possible interactions between the Danish mutation and human Aβ, Itm2bD rats were backcrossed to Apph rats. Hence, all rats used in this study produce human and not rodent Aβ species.

Here, we studied periadolescent Itm2bD rats, with the purpose of investigating early dysfunctions that may underlie initial pathogenic mechanisms leading to dementia later in life.

Results

Generation of Itm2bD KI rats carrying humanized Apph alleles

The KI founder F0-Itm2bD rat, which is carrying FDD mutation on Itm2b rat gene, was generated by CRISPR/Cas–mediated genome engineering as described in the Experimental procedures section and Supporting information. The F0-Itm2bD rat, which is a chimera for the Itm2b gene, was crossed to WT (Itm2bw/w) Long–Evans rats to generate F1-Itm2bD/w rats. F1-Itm2bD/w rats were crossed to WT Long–Evans to generate F2-Itm2bD/w rats. These crossings were repeated three more times to obtain F5-Itm2bD/w rats. The probability that F5 rats carry unidentified off-target mutations (except those, if present, on chromosome 15) is ∼1.5625%. Male and female F5-Itm2bD/w rats were crossed to obtain Itm2bD/w, Itm2bD/D, and Itm2bw/w rats.

The FDD mutation consists of a ten nucleotides duplication one codon before the normal stop codon (39). This produces a frameshift in the BRI2 sequence generating a precursor protein 11 amino acids larger than normal (Fig. 1A). To verify that the Danish mutation was correctly inserted into Itm2b exon 6, we amplified by PCR the Itm2b gene exon 6 Itm2bD/w, Itm2bD/D, and Itm2bw/w rats. Sequencing of the PCR products shows that the Danish mutation was correctly inserted in the Itm2b gene exon 6 (Fig. 1B) and encoded for the COOH terminus of the Danish BRI2 mutant. When we generated FDD KI mice, we humanized the mouse COOH-terminal region of BRI2 by introducing an alanine (A) substituted for threonine (T) at codon 250 (3). Since that humanization did not result into deposition of ADan peptides in amyloid plaques in KI mice (3), that modification was not repeated in rats.

Figure 1.

Figure 1

Characterization of Itm2bDKI rats.A, sequences of the COOH terminus of Bri2–23 (WT) and Bri2-ADan (Danish). B, PCR amplification and sequencing of the Itm2b gene exon 6 from Itm2bw/w and Itm2bD/D rats shows that the Danish mutation was correctly inserted in the Itm2b exon 6 of Itm2bD/D rats. This mutation causes the predicted frameshift in the BRI2 sequence generating a precursor protein 11 amino acids larger-than-normal coding for the Bri2-ADan mutant protein (partial DNA sequences of WT and Danish exon 6 are shown). Inserted nucleotides are highlighted in black, and the amino-acid sequences are indicated above for the Danish mutant allele and below for the WT allele—the DNA sequences. C, levels of Itm2b mRNA in brains of 21-day-old Itm2bw/w and Itm2bD/D rats were determined by Standard-RNA-Seq analysis. No significant differences between Itm2bw/w and Itm2bD/D rats were evident. Data are represented as mean ± SD. Data were analyzed by Student's t test. N = 4 rats per genotype. KI, knock in.

To generate Itm2bD/w, Itm2bD/D, and Itm2bw/w rats on a background in which rat App has a humanized Aβ region, Itm2bD/w and Apph/h rats were crossed to generate Itm2bD/w;Apph/w rats. The Appw allele was removed in subsequent crosses. Henceforth, Itm2bD/D, Itm2bD/w, and Itm2bw/w rats used in this study have an Apph/h background and produce human and not rodent Aβ species.

To determine whether Itm2b expression is disrupted by the introduced mutations, we examined Itm2b mRNA levels in p21 Itm2bD/D and Itm2bw/w rats by standard RNA-Seq analysis on total brain RNA. The mRNA expression of Itm2b shows no significant difference between Itm2bD/D and Itm2bw/w rats (Fig. 1C).

The Itm2bD allele encodes for a longer Bri2 precursor protein (Bri2-ADan) that accumulates in primary neurons

BRI2 is type II membrane protein that is synthesized as an immature precursor (imBRI2). imBRI2 is cleaved at the COOH terminus by proprotein convertase to produce the NH2-terminal mature BRI2 (mBRI2) and the 23 amino acid–long COOH-terminal peptide called Bri23 (40). As noted previously, in the Danish patients, a frameshift caused by a ten nucleotides duplication 5′ to the stop codon leads to the synthesis of a BRI2 precursor protein 11 amino acids larger than normal (39). Convertase-mediated cleavage of Danish imBRI2 generates a WT-like mBRI2 and a 34 amino acid–long peptide called ADan, which codeposits with Aβ species in amyloid fibrils in patients. For clarity, we will refer to the WT imBri2 as Bri2–Bri23 and to the Danish mutant imBri2 as Bri2-ADan.

To determine whether the Itm2bD allele codes for Bri2-ADan, we examined Bri2 expression in total neuronal lysates isolated from male and female 2-month-old Itm2bD/w, Itm2bD/D, and Itm2bw/w rats. However, the Bri2 antibody tested identified many nonspecific bands (Fig. S1), making a rigorous assessment of Bri2 expression in rat brains challenging.

Analysis of mouse Itm2bw/w and Itm2bD/D primary neurons showed that the mBri2/Bri2–Bri23 ratio in Itm2bw/w primary neurons was significantly higher than the mBri2/Bri2-ADan ratio in Itm2bD/D primary neurons (41). In addition, lysosomal inhibition caused accumulation of mBri2 but not Bri2–Bri23 in Itm2bw/w primary neurons; in contrast, both mBri2 and Bri2-ADan accumulated in Itm2bD/D primary neurons (41). These observations indicated that the Danish mutation reduced maturation of the mutant precursor Bri2 in mouse neurons. Based on these observations, we probed whether primary neurons could be used to assess mBri2, Bri2–Bri23, and Bri2-ADan expression in KI rats. Primary neurons are a simpler system compared with total brain; this, per se, may reduce the number of nonspecific bands identified by anti-Bri2 antibodies. Moreover, inhibition of lysosome-mediated degradation of Bri2 species in primary neurons may help identify specific Bri2 molecules. Thus, primary neurons derived from Itm2bw/w and Itm2bD/D rats were treated with the lysosomal inhibitor chloroquine and analyzed by Western blot. The anti-Bri2 antibody identified a band of ∼34 kDa in all samples, which was increased by chloroquine (Fig. 2, A and C). These observations are consistent with the ∼34 kDa corresponding to mBri2. A second band of ∼36 kDa was detected in Itm2bw/w primary neurons (Fig. 2A). In contrast, a slightly larger second band (∼37 kDa) that was increased by chloroquine treatment was detected in Itm2bD/D primary neurons (Fig. 2, A and C). These observations are consistent with the ∼36 and ∼37 kDa bands corresponding to Bri2–Bri23 and Bri2-ADan, respectively.

Table 1.

Results of the statistical analysis of data shown in Figure 2

Ordinary two-way ANOVA analysis of Figure 2
imBri2 Source of variation F (DFn, DFd) p
Interaction F (1, 20) = 272.2 <0.0001
Treatment F (1, 20) = 354.3 <0.0001
Genotype F (1, 20) = 1966 <0.0001
Sidak's multiple comparisons test Summary Adjusted p
Itm2bw/w (Veh) versus Itm2bD/D (Veh) ∗∗∗∗ <0.0001
Itm2bw/w (Veh) versus Itm2bw/w (Chlo) NS 0.5229
Itm2bD/D (Veh) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
Itm2bw/w (Chlo) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
mBri2 Source of variation F (DFn, DFd) p
Interaction F (1, 20) = 207.4 <0.0001
Treatment F (1, 20) = 186.9 <0.0001
Genotype F (1, 20) = 228.5 <0.0001
Sidak's multiple comparisons test Summary Adjusted p
Itm2bw/w (Veh) versus Itm2bD/D (Veh) NS 0.9969
Itm2bw/w (Veh) versus Itm2bw/w (Chlo) ∗∗∗∗ <0.0001
Itm2bD/D (Veh) versus Itm2bD/D (Chlo) NS 0.9966
Itm2bw/w (Chlo) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
imBri2/mBri2 Source of variation F (DFn, DFd) p
Interaction F (1, 20) = 108.3 <0.0001
Treatment F (1, 20) = 104.2 <0.0001
Genotype F (1, 20) = 627.1 <0.0001
Sidak's multiple comparisons test Summary Adjusted p
Itm2bw/w (Veh) versus Itm2bD/D (Veh) ∗∗∗∗ <0.0001
Itm2bw/w (Veh) versus Itm2bw/w (Chlo) NS >0.9999
Itm2bD/D (Veh) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
Itm2bw/w (Chlo) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
LC3AI/II Source of variation F (DFn, DFd) p
Interaction F (1, 20) = 37.36 <0.0001
Treatment F (1, 20) = 353.5 <0.0001
Genotype F (1, 20) = 36.16 <0.0001
Sidak's multiple comparisons test Summary Adjusted p
Itm2bw/w (Veh) versus Itm2bw/w (Chlo) ∗∗∗∗ <0.0001
Itm2bD/D (Veh) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001
LC3B I/II Source of variation F (DFn, DFd) p
Interaction F (1, 20) = 8.111 0.0099
Treatment F (1, 20) = 26.75 <0.0001
Genotype F (1, 20) = 8.283 0.0093
Sidak's multiple comparisons test Summary Adjusted p
Itm2bw/w (Veh) versus Itm2bw/w (Chlo) NS 0.2185
Itm2bD/D (Veh) versus Itm2bD/D (Chlo) ∗∗∗∗ <0.0001

Abbreviation: NS, not significant.

∗∗∗∗ indicates P < 0.0001.

Table 2.

Results of the statistical analysis of data shown in Figure 3C

Ordinary one-way ANOVA analysis of Figure 3C
Protein F (DFn, DFd) p
sAPPα F (2, 27) = 0.1084 0.8977
sAPPβ F (2, 27) = 0.7666 0.4744
Aβ38 F (2, 27) = 0.1121 0.8943
Aβ40 F (2, 27) = 2.030 0.1509
Aβ42 F (2, 27) = 4.764 0.0169∗
Aβ43 F (2, 26) = 2.654 0.0893
Aβ42/Aβ40 F (2, 27) = 4.074 0.0284∗
Aβ43/Aβ40 F (2, 26) = 4.031 0.0299∗
Aβ43/Aβ42 F (2, 23) = 3.281 0.0558

Tukey's multiple comparisons test Summary Adjusted p
Aβ42 Itm2bw/wversus Itm2bD/w NS 0.6966
Itm2bw/wversus Itm2bD/D ∗ 0.0159
Itm2bD/wversus Itm2bD/D NS 0.0948
Aβ42/Aβ40 Itm2bw/wversus Itm2bD/w NS 0.8326
Itm2bw/wversus Itm2bD/D ∗ 0.0301

Abbreviation: NS, not significant.

∗ indicates P < 0.05.

Figure 2.

Figure 2

Distinct degradation pathways of Bri2–23 and Bri2-ADan in Itm2bw/wand Itm2bD/Dprimary neurons. WB analysis of Bri2 (A) and LC3A/B (B) from primary hippocampal neurons isolated from Itm2bw/w (•) and Itm2bD/D (○) P1 pups treated with either the vehicle PBS (−) or 50 μM chloroquine (+) for 18 h. C, quantification of LC3A/B and Bri2 levels. Data are represented as mean ± SD and analyzed by ordinary two-way ANOVA followed by post hoc Sidak's multiple comparisons test when ANOVA showed significant differences. Detailed statistical analysis results are shown in Table 1. WB, Western blotting.

Without treatment, the levels of Bri2-ADan in Itm2bD/D primary neurons were significantly higher than the levels of Bri2–Bri23 in Itm2bw/w primary neurons (Fig. 2, A and C), and the mBri2/Bri2–Bri23 ratio in Itm2bw/w primary neurons was significantly higher than the mBri2/Bri2-ADan ratio in Itm2bD/D primary neurons (Fig. 2, A and C).

LC3A and LC3B are autophagosome membrane proteins: the LC3A I/LC3A II and LC3B I/LC3B II ratios for each provides an independent measure of the impact of chloroquine on lysosomal degradation. Chloroquine significantly reduced the LC3A I/LC3A II and LC3B I/LC3B II ratios (Fig. 2, B and C), confirming inhibition of lysosome-mediated degradation.

Subtle increase in Aβ42 levels in young Itm2bD KI rats

Sequential processing of APP by α-/γ-secretase and β-/γ-secretase generates the following APP-derived peptides and polypeptides: sAPPβ, sAPPα, β-CTF, α-CTF, AID/AICD, P3, and Aβ. Since BRI2 interacts with APP and modulates APP processing by α-, β-, and γ-secretase (26, 27, 28, 29, 30), we determined the steady-state levels of several of these APP metabolites in the central nervous system of young male and female Itm2bD KI rats. Full-length APP, α-CTF, and β-CTF were measured by Western blot: soluble APPs (sAPPα/sAPPβ) were detected by ELISA, and human Aβ species (Aβ38, Aβ40, Aβ42, and Aβ43) were detected by human Aβ-specific ELISA. These measurements have previously been used for other KI rats generated in our laboratory (38, 42, 43).

Neither the levels of full-length APP, CTFs, Aβ38, Aβ40, Aβ43, sAPPα, and sAPPβ were unchanged in 8-week-old Itm2bD/w, Itm2bD/D, and Itm2bw/w rats (Fig. 3, A–C) nor was the Aβ43/Aβ42 ratio altered (Fig. 3C). In contrast, there was a slight but significant increase in Aβ42 as well as the Aβ42/Aβ40 ratio in Itm2bD/D compared with Itm2bw/w rats (Fig. 3C). Small but statistically significant decreases in both Aβ43 and Aβ43/Aβ42 ratios were evident in Itm2bD/D as compared with Itm2bw/w rats (Fig. 3C). Overall, these data indicate a gene dosage–dependent minor increase in steady-state levels of Aβ42, and decrease in Aβ43, in periadolescent Itm2bD rats. Analysis of older rats will be needed to determine whether the Danish mutation in Itm2b alters APP processing in KI rats and whether these alterations may more robustly change the steady-state levels of APP metabolites with aging.

Figure 3.

Figure 3

Levels of peptides and polypeptides derived from APP processing in Itm2bDKI rats. Data are represented as mean ± SD and were analyzed by ordinary one-way ANOVA followed by post hoc Tukey's multiple comparisons test when ANOVA showed statistically significant differences. We analyzed 8-week-old rats and five female and five male rats per genotype. A, levels of full-length APP, αCTF, and βCTF were determined by Western analysis of brain lysate of Itm2bD/D, Itm2bD/w, and Itm2bw/w male and female rats. B, quantitation of Western blots. Signal intensity of APP metabolites were normalized to red Ponceau staining of nitrocellulose membranes. Data were analyzed by ordinary one-way ANOVA. ANOVA summary: mAPP, F(2, 27) = 0.7931, p = 0.4627; imAPP, F(2, 27) = 1.367, p = 0.2720; α-CTF, F(2, 27) = 0.6075, p = 0.5520; β-CTF, F(2, 27) = 1.614, p = 0.2177. C, levels of sAPPα, sAPPβ, Aβ38, Aβ40, Aβ42, and Aβ43 were determined by ELISA of brain lysate from the same Itm2bD/D, Itm2bD/w, and Itm2bw/w male and female rats. Data were analyzed by ordinary one-way ANOVA. Detailed statistical analysis results are shown in Table 2. APP, amyloid-β precursor protein; KI, knock in.

It has been postulated that toxic forms of Aβ are oligomeric (44). Thus, we tested whether toxic oligomers are augmented in periadolescent Itm2bD rats. To this end, we used the prefibrillar oligomer-specific antibody A11 to perform dot blots (45). We found no evidence supporting an increase in neurotoxic brain oligomer levels in periadolescent Itm2bD/w and Itm2bD/D rats as compared with Itm2bw/w rats (Fig. 4). However, Aβ oligomers appeared to be significantly increased in Itm2bD/w rats compared with Itm2bD/D animals (Fig. 4). Analysis of older rats will be needed to clarify the relevance of this odd observation.

Figure 4.

Figure 4

Levels of human Aβ oligomeric species in the brain of periadolescent Itm2bD/D, Itm2bD/w, and Itm2bw/wmale and female rats. We analyzed material from the same rats analyzed in Figure 3. Quantitation of dot blots using the oligomer-specific antibody A11. Before immunoblot analysis, membranes were stained with Ponceau red. Quantitative analysis of A11 blot was normalized to the Ponceau red quantitative analysis. Data are represented as mean ± SD and analyzed by ordinary one-way ANOVA followed by post hoc Tukey's multiple comparisons test when ANOVA showed statistically significant differences. ANOVA summary: F(2, 27) = 4.593, p = 0.0192∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.6406, Itm2bw/wversus Itm2bD/D, p = 0.1195; Itm2bD/wversus Itm2bD/D, p = 0.0170∗.

Glutamatergic synaptic transmission at hippocampal SC–CA3>CA1 synapses is impaired in peradolescent Itm2bD rats

Bri2 modulates glutamatergic synaptic transmission at both presynaptic and postsynaptic termini of Schaeffer-collateral (SC) pathway–CA3>CA1 synapses (46). This function is compromised in both adult Itm2bD and Itm2bB KI mice (41). Here, we analyzed glutamatergic transmission at SC–CA3>CA1 synapses in young periadolescent Itm2bD male and female rats. First, we analyzed miniature excitatory postsynaptic currents (mEPSCs), the frequency of which is determined, in part, by the probability of release (Pr) of glutamatergic synaptic vesicles release (47). Thus, mEPSC frequency is regulated mostly by presynaptic mechanisms. As shown in Figure 5, A–C, the Danish Itm2b mutation caused a significant reduction in the frequency of mEPSC: this reduction is gene dosage dependent (Itm2bw/w versus Itm2bD/w, p = 0.003; Itm2bw/w versus Itm2bD/D, p < 0.0001; and Itm2bD/w versus Itm2bD/D, p = 0.0051) and suggests a decrease in Pr of glutamatergic synaptic vesicles.

Figure 5.

Figure 5

Glutamatergic synaptic transmission is reduced at hippocampal SC–CA3>CA1 synapses of Itm2bDKI rats. Data are represented as mean ± SD and were analyzed by ordinary one-way ANOVA followed by post hoc Tukey's multiple comparisons test when ANOVA showed significant differences. We used the following animals: Itm2bw/w N = 11 (4M/6, 3F/5, indicating that six recordings were obtained from the four males and five recordings from the three females), Itm2bD/w N = 15 (3M/7, 4F/8), Itm2bD/D N = 10 (3M/5, 3F/5). A, representative recording traces of mEPSC at SC–CA3>CA1 synapses. B, the Danish mutation causes a significant decrease in mEPSC frequency (ANOVA summary, F(2, 33) = 20.66, p < 0.0001∗∗∗∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.003∗∗, Itm2bw/wversus Itm2bD/D, p < 0.0001∗∗∗∗; Itm2bD/wversus Itm2bD/D, p = 0.0051∗∗). C, cumulative probability of AMPAR-mediated mEPSC frequency interevent intervals. D, the Danish mutation causes a significant decrease in mEPSC amplitude (ANOVA summary, F(2, 33) = 10.78, p = 0.0002∗∗∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.0016∗∗; Itm2bw/wversus Itm2bD/D, p = 0.0005∗∗∗; Itm2bD/wversus Itm2bD/D, p = 0.6691). E, cumulative probability of AMPAR-mediated mEPSC amplitude. F, in contrast, decay time of mEPSC was not significantly changed (ANOVA summary, F(2, 33) = 1.292, p = 0.2882). G, average mEPSC of Itm2bD/D, Itm2bD/w, and Itm2bw/w rats. H, AMPAR/NMDAR peak current ratio is significantly decreased in Itm2bD/D rats (ANOVA summary, F(2, 16) = 8.417, p = 0.0032∗∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.2393; Itm2bw/wversus Itm2bD/D, p = 0.0023∗∗; Itm2bD/wversus Itm2bD/D, p = 0.0818). Representative traces are shown on top of the graph (traces are averaged from 20 sweeps). Animals used: Itm2bw/w N = 7 (4M/4, 3F/3), Itm2bD/w N = 6 (3M/3, 3F/3), and Itm2bD/D N = 6 (3M/3, 3F/3). I, average PPF at 50 ms (left panel) and 200 ms (right panel) interstimulus interval (ISI) shows that PPF is increased in Itm2bD/D rats ISI (50 ms ISI PPF ANOVA summary: F(2, 60) = 11.89, p < 0.0001∗∗∗∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.2315; Itm2bw/wversus Itm2bD/D, p < 0.0001∗∗∗∗; Itm2bD/wversus Itm2bD/D, p = 0.0031∗∗. 200 ms ISI PPF ANOVA summary: F(2, 64) = 3.802, p = 0.0275∗; post hoc Tukey's multiple comparisons test: Itm2bw/wversus Itm2bD/w, p = 0.4504; Itm2bw/wversus Itm2bD/D, p = 0.0205∗; Itm2bD/wversus Itm2bD/D, p = 0.2462). Representative traces are shown on top of the panels. p < 0.05∗; p < 0.01∗∗; p < 0.001∗∗∗; and p < 0.0001∗∗∗∗. Animals used: Itm2bw/w N = 18 (4M/10, 3F/8), Itm2bD/w N = 20 (3M/10, 4F/10), and Itm2bD/D N = 17 (3M/8, 3F/9). AMPAR, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor; mEPSC, miniature excitatory postsynaptic current; NMDAR, N-methyl-d-aspartic acid; PPF, paired-pulse facilitation.

The amplitude of mEPSC is instead dependent on postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) responses. AMPAR-mediated mEPSC responses amplitude was also significantly decreased in Itm2bD rats (Fig. 5, A, D, E, and G). Also in this case, the reduction is gene dosage dependent (Itm2bw/w versus Itm2bD/w, p = 0.0016; Itm2bw/w versus Itm2bD/D, p = 0.0005). Decay time of mEPSC was not significantly affected in Itm2bD rats compared with littermate controls (Fig. 5, A, F, and G).

Since mEPSC AMPAR-mediated responses are reduced in amplitude, we measured the AMPAR/N-methyl-d-aspartic acid (NMDAR) peak current ratio in evoked responses. Consistent with the hypothesis that the Danish Itm2b mutation impairs AMPAR-mediated responses, the AMPAR/NMDAR peak current ratio was reduced in Danish KI rats (Fig. 5H). This difference was statistically different only between Itm2bw/w and Itm2bD/D rats, with Itm2bD/w rats showing an intermedia phenotype.

Finally, we examined the effect of the pathogenic Danish mutation on paired-pulse facilitation (PPF). PPF is a form of short-term synaptic plasticity that is in part determined by changes in Pr of glutamatergic synaptic vesicles (41, 43, 47). Facilitation at both 50 and 200 ms interstimulus interval (ISI) was significantly increased in Itm2bD/D (Fig. 5I). Even in this case, the changes were gene dosage dependent (50 ms ISI: Itm2bw/w versus Itm2bD/D, p < 0.0001; Itm2bD/w versus Itm2bD/D, p = 0.0031; 200 ms ISI: Itm2bw/w versus Itm2bD/D, p = 0.0205). Interestingly, also an increase in PPF is consistent with a decrease in Pr, just like a decrease in mEPSC frequency. Overall, our data indicate that the pathogenic Danish Itm2b mutation alters glutamatergic synaptic transmission at excitatory hippocampal SC–CA3>CA1 synapses in periadolescent KI rats. These alterations are like those seen in Itm2b KO and Itm2bD/Itm2bB KI adult mice.

Discussion

The choice of the genetic approach and the model organisms used to model human diseases have major implications on the phenotypic expression of disease-associated genetic mutations. For the last 13 years, our laboratory has modeled AD and AD-like neurodegenerative disorders in mice, using a KI approach (3, 48, 49, 50, 51). The KI approach was preferred because it generates models genetically faithful to human diseases and makes no preconceived assumption about pathogenic mechanisms (except the unbiased genetic one). We have recently extended our KI modeling of familial and sporadic forms of AD and AD-related disorders to rats (38, 42, 43, 52, 53) because the rat is better suited for behavioral tests and other procedures that are important when studying neurodegenerative diseases. In addition, gene expression differences suggest that rats may be advantageous model of neurodegenerative diseases over mice. Alternative spicing of Mapt (12, 13, 14, 15), which forms NFTs and is mutated in frontotemporal dementia (16, 17, 18, 19, 20, 21, 22, 23), leads to expression of tau isoforms with three or four microtubule-binding domains (3R and 4R, respectively). Adult human and rat brains express both 3R and 4R tau isoforms (24): in contrast, adult mouse brains express only 4R tau (25), suggesting that the rat may be a better model organism for dementias with tauopathy.

To explore early dysfunctions that may underlie initial mechanisms leading to dementia, we studied young KI rats carrying the Itm2bD FDD mutation. Consistent with the findings in Itm2bD/D mouse KIs (41), we found that Bri2-ADan maturation is altered and accumulates in Itm2bD/D primary neurons (Fig. 2). Analysis of APP metabolism in periadolescent Itm2bD KI rats (Figs. 3 and 4) only showed subtle but significant changes in Aβ42 and Aβ43 steady-state levels, which were slightly increased and decreased, respectively (Fig. 3).

We have previously shown that the Danish and British ITM2b mutations lead to reduced glutamatergic neurotransmitter release and AMPAR-mediated responses in adult Itm2bB and Itm2bD mice. These reductions are like those seen in adult Itm2b KO mice (41, 46). Interestingly, we detected identical, gene dosage–dependent, presynaptic and postsynaptic glutamatergic transmission changes in the SC pathway of periadolescent Itm2bD rats (Fig. 5). More specifically, the frequency of mEPSC and PPF is significantly decreased and increased, respectively, in Itm2bD rats, suggesting a presynaptic reduction of the Pr of glutamatergic synaptic vesicles. In addition, mEPSC amplitude and the AMPAR/NMDAR peak current ratio were both decreased in Itm2bD rats, suggesting a postsynaptic reduction of AMPAR-mediated responses. Collectively, these data together with our previously published observations indicate that the synaptic transmission alteration caused by Danish mutation occurs early in life and are neither species nor gene-editing technology specific. These studies underlie the potential relevance of our studies to functional changes caused by the pathogenic ITM2b mutations in humans.

Given the functional and pathological interaction between APP and BRI2 (26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36), it is possible that the presence of human Aβ in the rat model may lead to an earlier manifestation of synaptic plasticity deficit in rat as compared with mice, which express rodent Aβ. Moreover, the evidence that both APP and BRI2 tune excitatory synaptic transmission, and that these functions are altered by pathogenic mutations in both APP and BRI2 (37, 41, 46, 54, 55, 56), suggests that early alterations in glutamatergic transmission may underlie initial pathogenic mechanisms in dementia. Future studies will be needed to test these hypotheses.

Experimental procedures

Rats and ethics statement

Rats were handled according to the National Institutes of Health Ethical Guidelines for Treatment of Laboratory Animals. The procedures were described and approved by the Institutional Animal Care and Use Committee at Rutgers (Institutional Animal Care and Use Committee; protocol number: PROTO201702513).

Generation of rats expressing the Danish Itm2b mutation (Itm2D rats)

The rat Itm2b gene (GenBank accession number: NM_001006963.1; Ensembl: ENSRNOG00000016271) is located on rat chromosome 15. It comprises six exons, with ATP start codon in exon 1 and TGA stop codon in exon 6. The FDD mutation (TTTAATTTGTTCTTGAACAGTCAAGAAAAACATTAT) KI site in oligo donor was introduced into exon 6, which is the target site by homology-directed repair. A silent mutation (GTG to GTC) was also introduced to prevent the binding and recutting of the sequence by Cas9 after homology-directed repair. The detailed procedures are reported in the supporting information file.

Standard RNA-Seq analysis

Total brain RNA from 21-day-old Itm2bD/D and Itm2bw/w rats (two male and two females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis were performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf). Student's t test was used for all analyses, with data presented as mean ± SD.

Protein preparation, Western blots, and ELISA of rat brain

These procedures were performed as previously described (42, 53). Briefly, rats were anesthetized with isoflurane and perfused via intracardiac catheterization with ice-cold PBS. Brains were extracted and homogenized with a glass-teflon homogenizer in 250 mM sucrose, 20 mM Tris base, pH 7.4, 1 mM EDTA, 1 mM EGTA plus protease and phosphatase inhibitors (Thermo Fisher Scientific). All steps were carried out on ice. Homogenates were solubilized with 1% NP-40 for 30 min rotating and spun at 20,000g for 10 min. Supernatants were collected, and protein content was quantified by Bradford.

For Western blot analyses, proteins were diluted with PBS and LDS sample buffer—10% β-mercaptoethanol (Invitrogen; NP0007) and 4.5 M urea to 1 μg/μl, loaded on a 4 to 12% Bis–Tris polyacrylamide gel (Bio-Rad; 3450125), and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes. For dot-blot analysis, 2.5 μg of material was directly spotted with a p20 pipette on a nitrocellulose membrane. Dot membrane was also visualized by red Ponceau after it was totally dried. Membranes were blocked in 5% milk (Bio-Rad; 1706404) for 30 min and washed in PBS/Tween-20 to 0.05%. Primary antibodies were applied dilution in blocking solution (Thermo; 37573). The following antibodies were used: polyclonal anti-Bri2 serum test bleeds provided by Cell Signaling Technology was used at 1:500 with overnight shaking at 4 °C. APP-Y188 (Abcam; 32136), Oligomer Aβ A11 (shared by Rakez Kayed's laboratory), LC3A (CST; 4599), and LC3B (CST; 2775) were used at 1:1000 with same other condition. Secondary antibodies (either antimouse [Southern Biotech; 1031-05] or a 1:1 mix of anti-rabbit [Southern Biotech; OB405005] and anti-rabbit [Cell Signaling; 7074]) were diluted 1:1000 in 5% milk and used against either mouse or rabbit primary antibodies for 1 h at room temperature, with shaking. Membranes were washed with PBS/Tween-20 to 0.05% (three times, 10 min each time), developed with West Dura ECL reagent (Thermo: PI34076) and visualized on a ChemiDoc MP Imaging System (Bio-Rad). Signal intensity was quantified with Image Lab software (Bio-Rad). Data were analyzed using Prism software (GraphPad Software, Inc) and represented as mean ± SD.

For analysis of human Aβ peptides and sAPPα/sAPPβ, brain lysates were diluted at 4 μg/μl. Aβ38, Aβ40, and Aβ42 were measured with V-PLEX Plus Aβ Peptide Panel 1 6E10 (K15200G; Meso Scale Discovery), and sAPPα/sAPPβ were measured with sAPPα/sAPPβ (K15120E; Meso Scale Discovery). Plates were read on a MESO QuickPlex SQ 120. Aβ43 was quantified using the IBL human Aβ43 Assay Kit #27710.

Primary hippocampal neuron culture

Rat hippocampal neurons were prepared from Itm2bw/w and Itm2bD/D postnatal day 1 pups. Briefly, after removal of meninges, the hippocampi were collected in Hank's balanced salt solution without magnesium and calcium, 1 mM sodium pyruvate, 0.1% glucose, and 10 mM Hepes. Hippocampi were dissected into single cell by trituration followed by 15-min incubation at 37 °C in 0.25% trypsin. Cells were subsequently treated with 0.1% DNAse (Sigma; dn25) in plating media (beta-mercaptoethanol, 10% fetal bovine serum, 0.09% glucose, 1 mM sodium pyruvate, 2 mM glutamine, and 1× penicillin/streptomycin). Cells were filtered through a Falcon 70 μm nylon cell strainer and were plated in poly-l-lysine–pretreated 12-well plate (300,000 cells/well) in neurobasal media, 1× B-27, 2 mM glutamine, and 1× penicillin/streptomycin. Half of the culture media was changed every 2 days. The six Itm2bw/w and Itm2bD/D cultures shown in Figure 2 were derived from one P1 pup. For each animal, equal amounts of cells were cultured into two wells. For each biological replicate, one well was treated with PBS and one well with chloroquine.

Pharmacological treatment and sample preparation

After 9 days in culture, primary neurons were treated with 50 μM chloroquine (Cell Signaling; 14774s) or PBS (Veh) for 18 h. After treatment, cells were washed with PBS and lysed in radioimmunoprecipitation buffer with protease/phosphatase inhibitor for 15 min on ice. Lysed cells were centrifuged at full speed for 15 min. Cell lysates were quantified and analyzed by Western blot as described earlier for brain lysates.

Electrophysiological recording

These procedures were performed as previously described (52). Briefly, rats were anesthetized with isoflurane and perfused intracardially with an ice-cold cutting solution containing (in millimolar) 120 choline chloride, 2.6 KCl, 26 NaHCO3, 1.25 NaH2PO4, 0.5 CaCl2, 7 MgCl2, 1.3 ascorbic acid, and 15 glucose, prebubbled with 95% O2/5% CO2 for 15 min. The brains were rapidly removed from the skull, and coronal brain slices containing the hippocampal formation (350 μm thick) were prepared in the ice-cold cutting solution bubbled with 95% O2/5% CO2 using Vibratome VT1200S (Leica Microsystems) and then incubated in an interface chamber in artificial cerebrospinal fluid (ACSF) containing (in millimolar): 126 NaCl, 3 KCl, 1.2 NaH2PO4; 1.3 MgCl2, 2.4 CaCl2, 26 NaHCO3, and 10 glucose (at pH 7.3), bubbled with 95% O2 and 5% CO2 at 30 °C for 1 h and then kept at room temperature. The hemislices were transferred to a recording chamber perfused with ACSF at a flow rate of ∼2 ml/min using a peristaltic pump. Experiments were performed at 28.0 °C ± 0.1 deg. C.

Whole-cell recordings in the voltage-clamp mode (−70 mV) were made with patch pipettes containing (in millimolar): 132.5 Cs gluconate, 17.5 CsCl, 2 MgCl2, 0.5 EGTA, 10 Hepes, 4 ATP, and 5 QX-314, with pH adjusted to 7.3 by CsOH. Patch pipettes (resistance, 8–10 MΩ) were pulled from 1.5-mm thin-walled borosilicate glass (Sutter Instruments) on a horizontal puller (model P-97; Sutter Instruments). Basal synaptic responses were evoked at 0.05 Hz by electrical stimulation of the SC afferents using concentric bipolar electrodes. CA1 neurons were viewed under upright microscopy (FN-1; Nikon Instruments) and recorded with Axopatch-700B amplifier (Molecular Devices). Data were low-pass filtered at 2 kHz and acquired at 5 to 10 kHz. The series resistance (Rs) was consistently monitored during recording in case of reseal of ruptured membrane. Cells with Rs >20 MΩ or with Rs deviated by >20% from initial values were excluded from analysis. EPSCs were recorded in ACSF containing the gamma aminobutyric acid-A receptors inhibitor bicuculline methiodide (15 μM). The stimulation intensity was adjusted to evoke EPSCs that were 40% of the maximal evoked amplitudes (“test intensity”). About 5 to 10 min after membrane rupture, EPSCs were recorded for 7 min at a test stimulation intensity that produced currents of ∼40% maximum. For recording of paired-pulse ratio, paired-pulse stimuli with 50 or 200 ms interpulse interval were given. The paired-pulse ratio was calculated as the ratio of the second EPSC amplitude to the first. For recording of AMPAR/NMDAR peak current ratio, the membrane potential was first held at −70 mV to record only AMPAR current for 20 sweeps with 20-s intervals. Then the membrane potential was turned to +40 mV to record NMDAR current for 20 sweeps with perfusion of 5 μM NBQX to block AMPAR. Mini EPSCs were recorded by maintaining neurons at −70 mV with ACSF containing action potential blocker (1 μM tetrodotoxin) and GABA-A receptor inhibitors (15 μM bicuculline methiodide). mEPSCs were recorded for ∼10 min. Data were collected with Axopatch 700B amplifiers and analyzed with pCLAMP10 software (Molecular Devices). mEPSCs are analyzed using Mini Analysis Program.

Statistics

All the experiments mentioned in the article were analyzed by one-way ANOVA or two-way ANOVA as indicated. Data showing statistical significance by one-way ANOVA or two-way ANOVA were subsequently analyzed by either Tukey's multiple comparisons test or Sidak's multiple comparisons. All statistical analyses were performed using Prism 9 software.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Supporting information

This article contains supporting information.

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.

Acknowledgments

All authors read and approved the final article.

Author contributions

L. D. conceptualization; L. D. methodology; T. Y. and L. D. validation; T. Y., W. Y., and L. D. formal analysis; T. Y., W. Y., K. A. N., and L. D. investigation; K. A. N. resources; T. Y. and L. D. data curation; T. Y. and L. D. writing–original draft; W. Y. writing–review and editing; L. D. supervision; L. D. project administration; L. D. funding acquisition.

Funding and additional information

L. D. was funded by the NIH/NIA R01AG063407, RF1AG064821, 1R01AG033007. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Edited by Paul Fraser

Footnotes

Present address for Wen Yao: Biomedical Research Center, Southern Medical University, 1023 South Shatai Road, Guangzhou, Guangdong 510515, China.

Supporting information

Supplemental Figures S1–S3 and Table S1
mmc1.pdf (2.2MB, pdf)

References

  • 1.Tamayev R., Matsuda S., Fa M., Arancio O., D'Adamio L. Danish dementia mice suggest that loss of function and not the amyloid cascade causes synaptic plasticity and memory deficits. Proc. Natl. Acad. Sci. U. S. A. 2010;107:20822–20827. doi: 10.1073/pnas.1011689107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Tamayev R., Giliberto L., Li W., D'Abramo C., Arancio O., Vidal R., D'Adamio L. Memory deficits due to familial British dementia BRI2 mutation are caused by loss of BRI2 function rather than amyloidosis. J. Neurosci. 2010;30:14915–14924. doi: 10.1523/JNEUROSCI.3917-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Giliberto L., Matsuda S., Vidal R., D'Adamio L. Generation and initial characterization of FDD knock in mice. PLoS One. 2009;4 doi: 10.1371/journal.pone.0007900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Deacon R.M. Housing, husbandry and handling of rodents for behavioral experiments. Nat. Protoc. 2006;1:936–946. doi: 10.1038/nprot.2006.120. [DOI] [PubMed] [Google Scholar]
  • 5.Whishaw I.Q., Metz G.A., Kolb B., Pellis S.M. Accelerated nervous system development contributes to behavioral efficiency in the laboratory mouse: A behavioral review and theoretical proposal. Dev. Psychobiol. 2001;39:151–170. doi: 10.1002/dev.1041. [DOI] [PubMed] [Google Scholar]
  • 6.Kepecs A., Uchida N., Zariwala H.A., Mainen Z.F. Neural correlates, computation and behavioural impact of decision confidence. Nature. 2008;455:227–231. doi: 10.1038/nature07200. [DOI] [PubMed] [Google Scholar]
  • 7.Foote A.L., Crystal J.D. Metacognition in the rat. Curr. Biol. 2007;17:551–555. doi: 10.1016/j.cub.2007.01.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bartelle B.B., Barandov A., Jasanoff A. Molecular fMRI. J. Neurosci. 2016;36:4139–4148. doi: 10.1523/JNEUROSCI.4050-15.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zimmer E.R., Leuzy A., Bhat V., Gauthier S., Rosa-Neto P. In vivo tracking of tau pathology using positron emission tomography (PET) molecular imaging in small animals. Transl. Neurodegener. 2014;3:6. doi: 10.1186/2047-9158-3-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Leuzy A., Zimmer E.R., Heurling K., Rosa-Neto P., Gauthier S. Use of amyloid PET across the spectrum of Alzheimer's disease: Clinical utility and associated ethical issues. Amyloid. 2014;21:143–148. doi: 10.3109/13506129.2014.926267. [DOI] [PubMed] [Google Scholar]
  • 11.Zimmer E.R., Leuzy A., Gauthier S., Rosa-Neto P. Developments in tau PET imaging. Can. J. Neurol. Sci. 2014;41:547–553. doi: 10.1017/cjn.2014.15. [DOI] [PubMed] [Google Scholar]
  • 12.Andreadis A. Tau gene alternative splicing: Expression patterns, regulation and modulation of function in normal brain and neurodegenerative diseases. Biochim. Biophys. Acta. 2005;1739:91–103. doi: 10.1016/j.bbadis.2004.08.010. [DOI] [PubMed] [Google Scholar]
  • 13.Janke C., Beck M., Stahl T., Holzer M., Brauer K., Bigl V., Arendt T. Phylogenetic diversity of the expression of the microtubule-associated protein tau: Implications for neurodegenerative disorders. Brain Res. Mol. Brain Res. 1999;68:119–128. doi: 10.1016/s0169-328x(99)00079-0. [DOI] [PubMed] [Google Scholar]
  • 14.Hong M., Zhukareva V., Vogelsberg-Ragaglia V., Wszolek Z., Reed L., Miller B.I., Geschwind D.H., Bird T.D., McKeel D., Goate A., Morris J.C., Wilhelmsen K.C., Schellenberg G.D., Trojanowski J.Q., Lee V.M. Mutation-specific functional impairments in distinct tau isoforms of hereditary FTDP-17. Science. 1998;282:1914–1917. doi: 10.1126/science.282.5395.1914. [DOI] [PubMed] [Google Scholar]
  • 15.Roberson E.D., Scearce-Levie K., Palop J.J., Yan F., Cheng I.H., Wu T., Gerstein H., Yu G.Q., Mucke L. Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer's disease mouse model. Science. 2007;316:750–754. doi: 10.1126/science.1141736. [DOI] [PubMed] [Google Scholar]
  • 16.Spillantini M.G., Goedert M. Tau protein pathology in neurodegenerative diseases. Trends Neurosci. 1998;21:428–433. doi: 10.1016/s0166-2236(98)01337-x. [DOI] [PubMed] [Google Scholar]
  • 17.Goedert M., Crowther R.A., Spillantini M.G. Tau mutations cause frontotemporal dementias. Neuron. 1998;21:955–958. doi: 10.1016/s0896-6273(00)80615-7. [DOI] [PubMed] [Google Scholar]
  • 18.Grundke-Iqbal I., Iqbal K., Tung Y.C., Quinlan M., Wisniewski H.M., Binder L.I. Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology. Proc. Natl. Acad. Sci. U. S. A. 1986;83:4913–4917. doi: 10.1073/pnas.83.13.4913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hutton M., Lendon C.L., Rizzu P., Baker M., Froelich S., Houlden H., Pickering-Brown S., Chakraverty S., Isaacs A., Grover A., Hackett J., Adamson J., Lincoln S., Dickson D., Davies P. Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature. 1998;393:702–705. doi: 10.1038/31508. [DOI] [PubMed] [Google Scholar]
  • 20.Stanford P.M., Shepherd C.E., Halliday G.M., Brooks W.S., Schofield P.W., Brodaty H., Martins R.N., Kwok J.B., Schofield P.R. Mutations in the tau gene that cause an increase in three repeat tau and frontotemporal dementia. Brain. 2003;126:814–826. doi: 10.1093/brain/awg090. [DOI] [PubMed] [Google Scholar]
  • 21.Yasuda M., Takamatsu J., D'Souza I., Crowther R.A., Kawamata T., Hasegawa M., Hasegawa H., Spillantini M.G., Tanimukai S., Poorkaj P., Varani L., Varani G., Iwatsubo T., Goedert M., Schellenberg D.G. A novel mutation at position +12 in the intron following exon 10 of the tau gene in familial frontotemporal dementia (FTD-Kumamoto) Ann. Neurol. 2000;47:422–429. [PubMed] [Google Scholar]
  • 22.Kowalska A., Hasegawa M., Miyamoto K., Akiguchi I., Ikemoto A., Takahashi K., Araki W., Tabira T. A novel mutation at position +11 in the intron following exon 10 of the tau gene in FTDP-17. J. Appl. Genet. 2002;43:535–543. [PubMed] [Google Scholar]
  • 23.Grover A., England E., Baker M., Sahara N., Adamson J., Granger B., Houlden H., Passant U., Yen S.H., DeTure M., Hutton M. A novel tau mutation in exon 9 (1260V) causes a four-repeat tauopathy. Exp. Neurol. 2003;184:131–140. doi: 10.1016/s0014-4886(03)00393-5. [DOI] [PubMed] [Google Scholar]
  • 24.Hanes J., Zilka N., Bartkova M., Caletkova M., Dobrota D., Novak M. Rat tau proteome consists of six tau isoforms: Implication for animal models of human tauopathies. J. Neurochem. 2009;108:1167–1176. doi: 10.1111/j.1471-4159.2009.05869.x. [DOI] [PubMed] [Google Scholar]
  • 25.McMillan P., Korvatska E., Poorkaj P., Evstafjeva Z., Robinson L., Greenup L., Leverenz J., Schellenberg G.D., D'Souza I. Tau isoform regulation is region- and cell-specific in mouse brain. J. Comp. Neurol. 2008;511:788–803. doi: 10.1002/cne.21867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Matsuda S., Giliberto L., Matsuda Y., Davies P., McGowan E., Pickford F., Ghiso J., Frangione B., D'Adamio L. The familial dementia BRI2 gene binds the Alzheimer gene amyloid-beta precursor protein and inhibits amyloid-beta production. J. Biol. Chem. 2005;280:28912–28916. doi: 10.1074/jbc.C500217200. [DOI] [PubMed] [Google Scholar]
  • 27.Fotinopoulou A., Tsachaki M., Vlavaki M., Poulopoulos A., Rostagno A., Frangione B., Ghiso J., Efthimiopoulos S. BRI2 interacts with amyloid precursor protein (APP) and regulates amyloid beta (Abeta) production. J. Biol. Chem. 2005;280:30768–30772. doi: 10.1074/jbc.C500231200. [DOI] [PubMed] [Google Scholar]
  • 28.Matsuda S., Giliberto L., Matsuda Y., McGowan E.M., D'Adamio L. BRI2 inhibits amyloid beta-peptide precursor protein processing by interfering with the docking of secretases to the substrate. J. Neurosci. 2008;28:8668–8676. doi: 10.1523/JNEUROSCI.2094-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Matsuda S., Matsuda Y., Snapp E.L., D'Adamio L. Maturation of BRI2 generates a specific inhibitor that reduces APP processing at the plasma membrane and in endocytic vesicles. Neurobiol. Aging. 2011;32:1400–1408. doi: 10.1016/j.neurobiolaging.2009.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Matsuda S., Tamayev R., D'Adamio L. Increased AβPP processing in familial Danish dementia patients. J. Alzheimers Dis. 2011;27:385–391. doi: 10.3233/JAD-2011-110785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tamayev R., Matsuda S., Giliberto L., Arancio O., D'Adamio L. APP heterozygosity averts memory deficit in knock in mice expressing the Danish dementia BRI2 mutant. EMBO J. 2011;30:2501–2509. doi: 10.1038/emboj.2011.161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tamayev R., D'Adamio L. Inhibition of γ-secretase worsens memory deficits in a genetically congruous mouse model of Danish dementia. Mol. Neurodegener. 2012;7:19. doi: 10.1186/1750-1326-7-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tamayev R., D'Adamio L. Memory deficits of British dementia knock-in mice are prevented by Aβ-precursor protein haploinsufficiency. J. Neurosci. 2012;32:5481–5485. doi: 10.1523/JNEUROSCI.5193-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tamayev R., Matsuda S., Arancio O., D'Adamio L. β- but not γ-secretase proteolysis of APP causes synaptic and memory deficits in a mouse model of dementia. EMBO Mol. Med. 2012;4:171–179. doi: 10.1002/emmm.201100195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lombino F., Biundo F., Tamayev R., Arancio O., D'Adamio L. An intracellular threonine of amyloid-β precursor protein mediates synaptic plasticity deficits and memory loss. PLoS One. 2013;8 doi: 10.1371/journal.pone.0057120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Biundo F., Ishiwari K., Del Prete D., D'Adamio L. Deletion of the γ-secretase subunits Aph1B/C impairs memory and worsens the deficits of knock-in mice modeling the Alzheimer-like familial Danish dementia. Oncotarget. 2016;7:11923–11944. doi: 10.18632/oncotarget.7389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tambini M.D., Yao W., D'Adamio L. Facilitation of glutamate, but not GABA, release in familial Alzheimer's APP mutant knock-in rats with increased β-cleavage of APP. Aging Cell. 2019;18 doi: 10.1111/acel.13033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tambini M.D., Norris K.A., D'Adamio L. Opposite changes in APP processing and human Aβ levels in rats carrying either a protective or a pathogenic APP mutation. Elife. 2020;9 doi: 10.7554/eLife.52612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Vidal R., Revesz T., Rostagno A., Kim E., Holton J.L., Bek T., Bojsen-Møller M., Braendgaard H., Plant G., Ghiso J., Frangione B. A decamer duplication in the 3' region of the BRI gene originates an amyloid peptide that is associated with dementia in a Danish kindred. Proc. Natl. Acad. Sci. U. S. A. 2000;97:4920–4925. doi: 10.1073/pnas.080076097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Choi S.I., Vidal R., Frangione B., Levy E. Axonal transport of British and Danish amyloid peptides via secretory vesicles. FASEB J. 2004;18:373–375. doi: 10.1096/fj.03-0730fje. [DOI] [PubMed] [Google Scholar]
  • 41.Yin T., Yao W., Lemenze A.D., D'Adamio L. Danish and British dementia ITM2b/BRI2 mutations reduce BRI2 protein stability and impair glutamatergic synaptic transmission. J. Biol. Chem. 2021;296:100054. doi: 10.1074/jbc.RA120.015679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tambini M.D., D'Adamio L. Trem2 splicing and expression are preserved in a human Abeta-producing, rat knock-in model of Trem2-R47H Alzheimer's risk variant. Sci. Rep. 2020;10:4122. doi: 10.1038/s41598-020-60800-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ren S., Breuillaud L., Yao W., Yin T., Norris K.A., Zehntner S.P., D'Adamio L. TNF-α-mediated reduction in inhibitory neurotransmission precedes sporadic Alzheimer's disease pathology in young Trem2 R47H rats. J. Biol. Chem. 2020;296:100089. doi: 10.1074/jbc.RA120.016395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Shankar G.M., Li S., Mehta T.H., Garcia-Munoz A., Shepardson N.E., Smith I., Brett F.M., Farrell M.A., Rowan M.J., Lemere C.A., Regan C.M., Walsh D.M., Sabatini B.L., Selkoe D.J. Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat. Med. 2008;14:837–842. doi: 10.1038/nm1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kayed R., Head E., Thompson J.L., McIntire T.M., Milton S.C., Cotman C.W., Glabe C.G. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science. 2003;300:486–489. doi: 10.1126/science.1079469. [DOI] [PubMed] [Google Scholar]
  • 46.Yao W., Yin T., Tambini M.D., D'Adamio L. The familial dementia gene ITM2b/BRI2 facilitates glutamate transmission via both presynaptic and postsynaptic mechanisms. Sci. Rep. 2019;9:4862. doi: 10.1038/s41598-019-41340-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zucker R.S., Regehr W.G. Short-term synaptic plasticity. Annu. Rev. Physiol. 2002;64:355–405. doi: 10.1146/annurev.physiol.64.092501.114547. [DOI] [PubMed] [Google Scholar]
  • 48.Barbagallo A.P., Wang Z., Zheng H., D'Adamio L. The intracellular threonine of amyloid precursor protein that is essential for docking of Pin1 is dispensable for developmental function. PLoS One. 2011;6 doi: 10.1371/journal.pone.0018006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Barbagallo A.P., Wang Z., Zheng H., D'Adamio L. A single tyrosine residue in the amyloid precursor protein intracellular domain is essential for developmental function. J. Biol. Chem. 2011;286:8717–8721. doi: 10.1074/jbc.C111.219873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Barbagallo A.P., Weldon R., Tamayev R., Zhou D., Giliberto L., Foreman O., D'Adamio L. Tyr(682) in the intracellular domain of APP regulates amyloidogenic APP processing in vivo. PLoS One. 2010;5 doi: 10.1371/journal.pone.0015503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Garringer H.J., Murrell J., D'Adamio L., Ghetti B., Vidal R. Modeling familial British and Danish dementia. Brain Struct. Funct. 2010;214:235–244. doi: 10.1007/s00429-009-0221-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ren S., Yao W., Tambini M.D., Yin T., Norris K.A., D'Adamio L. Microglia TREM2R47H Alzheimer-linked variant enhances excitatory transmission and reduces LTP via increased TNF-α levels. Elife. 2020;9 doi: 10.7554/eLife.57513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Tambini M.D., D'Adamio L. Knock-in rats with homozygous PSEN1 L435F Alzheimer mutation are viable and show selective γ-secretase activity loss causing low Aβ40/42 and high Aβ43. J. Biol. Chem. 2020;295:7442–7451. doi: 10.1074/jbc.RA120.012542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yao W., Tambini M.D., Liu X., D'Adamio L. Tuning of glutamate, but not GABA, release by an intrasynaptic vesicle APP domain whose function can Be modulated by β- or α-secretase cleavage. J. Neurosci. 2019;39:6992–7005. doi: 10.1523/JNEUROSCI.0207-19.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Fanutza T., Del Prete D., Ford M.J., Castillo P.E., D'Adamio L. APP and APLP2 interact with the synaptic release machinery and facilitate transmitter release at hippocampal synapses. Elife. 2015;4 doi: 10.7554/eLife.09743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Del Prete D., Lombino F., Liu X., D'Adamio L. APP is cleaved by Bace1 in pre-synaptic vesicles and establishes a pre-synaptic interactome, via its intracellular domain, with molecular complexes that regulate pre-synaptic vesicles functions. PLoS One. 2014;9 doi: 10.1371/journal.pone.0108576. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Figures S1–S3 and Table S1
mmc1.pdf (2.2MB, pdf)

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES