Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Behnoush Hosseini; Ralf T Voegele; Tobias I Link

doi:10.1371/journal.pone.0257225

. 2021 Sep 10;16(9):e0257225. doi: 10.1371/journal.pone.0257225

Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Behnoush Hosseini ¹, Ralf T Voegele ¹, Tobias I Link ^1,^*

Editor: Ruslan Kalendar²

PMCID: PMC8432765 PMID: 34506590

Abstract

Diaporthe species are fungal plant pathogens of many important crops. Seed decay is one of the most important diseases on soybean. It is caused by various species of the genus Diaporthe and responsible for significant economic damage. In central Europe the four species D. longicolla, D. caulivora, D. eres, and D. novem are considered the principal species of Diaporthe on soybean. Fast and accurate detection of these pathogens is of utmost importance. In this study four species-specific TaqMan primer-probe sets that can be combined into a quadruplex assay were designed based on TEF sequences. The specificity and efficiency of the primer-probe sets were tested using PCR products and genomic DNA from pure cultures of the four Diaporthe species and other soybean fungal pathogens. Our results indicate that the primer-probe sets DPCL, DPCC, DPCE, and DPCN allow discrimination of D. longicolla, D. caulivora, D. eres, and D. novem, respectively, and can be used to detect and quantify these four Diaporthe species in parallel using quadruplex real-time PCR. In addition, the quadruplex real-time PCR assay was evaluated on different plant materials including healthy and infected soybean seeds or seed lots, soybean stems, and soybean leaves. This assay is a rapid and effective method to detect and quantify Diaporthe species from samples relevant for disease control.

Introduction

Soybean (Glycine max L.) is one of the major sources of oil and protein in the world. Due to the expansion of soybean cultivation soybean diseases are also becoming relevant in the new soybean growing areas. Among the most important pathogens of soybean, fungal species of the genus Diaporthe cause severe diseases including seed decay, pod and stem blight, and stem canker [1]. Soybean seeds are heavily attacked by D. longicolla (Hobbs) and other species of the genus Diaporthe, which can significantly affect yield, quality, and stability of this industrial crop [2]. Infected soybean seeds are smaller and lighter than healthy seeds and their germination rate is reduced, which leads to their economic devaluation. Often seeds have wrinkled and cracked seed coats covered with fungal mycelium [3]. Sometimes, however, infected seeds are symptomless. In this case, it is challenging to distinguish healthy from infected soybean seeds. Therefore, the accessibility of a fast, accurate, and sensitive method for detection and species identification for these pathogens is required. On the one hand this will help to ensure use of healthy seeds to prevent spreading of the disease. On the other hand the prevalence of the species in Germany has not been studied beyond an assessment establishing the presence of four Diaporthe species [4] (see below), therefore, an assay with the ability to distinguish between the species is necessary to study disease epidemiology. Future epidemiological studies should also more precisely determine how the pathogens spread, both inside plants and from plant to plant. In the seed-plating assay as a common diagnostic method, Diaporthe species can be identified based on their morphological characteristics by an expert mycologist. This culture-based assay is multi-stage and time-consuming. Also, because of the existence of overlaps in cultural characteristics among Diaporthe species, differentiation is difficult and often inaccurate [4].

These difficulties have led to the development of molecular tools to improve accuracy and reliability. Technologies based on polymerase chain reaction (PCR) enhance detection and provide comparison of Diaporthe spp. at the molecular level. Genetic differences among species of Diaporthe from different hosts have been studied by sequencing the ribosomal DNA (rDNA) internal transcribed spacer (ITS) [5]. In a study by Zhang et al. [6], specific-primers PhomІ and PhomІІ based on the sequence of the ITS region were designed to detect D. phaseolorum and D. longicolla in soybean plants and seeds. Furthermore, PCR-restriction fragment length polymorphism (RFLP) was used to amplify DNA within the ITS region (using ITS4/ITS5 primers) to distinguish isolates of D. phaseolorum and D. longicolla from other fungal soybean pathogens. However, a shortage of adequate polymorphisms in the ITS region made identification of other gene sequences necessary that could be used to accurately resolve the species [7]. Using translation elongation factor 1-alpha (EF1-α/TEF), beta-tubulin (TUB), histone H3 (HIS) and calmodulin (CAL) loci has promoted accurate delineation of Diaporthe spp. as they exhibit sufficient polymorphism [4,8–10].

Although PCR-based technologies can significantly reduce the time needed for diagnosis compared to conventional culture methods, they still require additional work [11]. Moreover, conventional PCR is not suited for quantitative analysis of plant pathogens [12].

By contrast, real-time, or quantitative PCR (qPCR) is a versatile advanced technology that allows to distinguish the target pathogen simply, quickly, economically, and reproducibly. It can also discriminate between two closely related organisms. Additionally, qPCR can be utilized to measure the pathogen load in a sample [13]. The use of probes with different fluorescent dyes enables the detection of several target pathogen DNAs in a single reaction (multiplex-PCR). The method has been used to enhance biosecurity [14] and to detect seed-borne pathogens [15], and phytopathogenic bacteria [16]. Using real-time PCR to collect epidemiological data can lead to a better understanding of seed-borne diseases. A real-time PCR assay has been developed to detect and quantify species of the genus Diaporthe including D. longicolla, D. phaseolorum var. meridionalis, D. caulivora, and D. phaseolorum var. sojae from soybean seeds [17]. This assay was recently applied by Kontz et al. [18] for direct quantification of D. caulivora and D. longicolla in infected soybean plants, and to quantify resistance in soybean germplasm to these two pathogens. However, the primer-probe combinations PL-3 and DPC-3 by Zhang et al. [17] were not developed for parallel use in a multiplex real-time PCR system. The specificity of these combinations for either D. longicolla or D. caulivora resides in the primers while the probes bind to DNA from either species. For use in diagnostics to test seeds for the presence of pathogens, multiplex is highly desirable, since one sample can be tested for different pathogens in a single reaction. This saves both time and costs.

We have recently surveyed Diaporthe spp. on soybean in central Europe [4]. In the course of this survey we established the presence of D. longicolla, D. caulivora (J.M. Santos), D. eres (Nitschke), and D. novem (J.M. Santos). We expect that if these species are allowed to spread over the expanding soybean fields in central Europe they will cause considerable damage. To provide diagnostics to prevent this we have developed and present here a multiplex (quadruplex) real-time PCR assay to detect, distinguish, and quantify these four closely related species in parallel. The assay was tested with soybean seeds and soybean plant tissue.

Materials and methods

Fungal strains and plant material

Single-spore isolates of ten strains of Diaporthe isolated from soybean seeds ([4] or received from Kristina Petrović (Institute of Field and Vegetable Crops, Novi Sad, Serbia), respectively) were used in this study (Table 1) for DNA preparation to test the specificity of the assay.

Table 1. Diaporthe strains used in this study and their corresponding GenBank accession numbers.

Isolate no.	Species	GenBank Accession
		ITS	TEF
DPC_HOH1	D. longicolla	MK024676	MK099093 ^c
DPC_HOH20^a		MK024695	MK099112
DPC-HOH17^b		MK024692	MK099109
DPC_HOH22^b		MK024697	MK099114
DPC_HOH25^b		MK024700	MK099117
DPC_HOH26^b		MK024701	MK099118
DPC_HOH28^a		MK024703	MK099120
DPC_HOH29^b		MK024704	MK099121
PL-157a/PDS157A^a		JQ697845	JQ697858
DPC_HOH2^a	D. caulivora	MK024677	MK099094 ^c
DPC_HOH3^a	D. eres	MK024678	MK099095 ^c
DPC_HOH7^a		MK024682	MK099099 ^c
PS-74^a		JF430488	JF461474
DPC_HOH8^a	D. novem	MK024683	MK099100 ^c
DPC_HOH11^a		MK024686	MK099103 ^c
DPC_HOH15^a		MK024690	MK099107
DC-27(1)/17-DIA-034^a	D. aspalathi	MK942646	MK941268
PS-22^a	D. foeniculina	JF430495	JF461481

Open in a new tab

^aThese Diaporthe isolates were used to test the specificity and sensitivity of the TaqMan primer-probe combinations

^bInfected stem samples were obtained from diseased soybean plants inoculated with these Diaporthe isolates in greenhouse pathogenicity tests.

^cSequences used for primer/probe design.

Pure cultures of the common soybean pathogens Sclerotinia sclerotiorum (Lib.), Colletotrichum truncatum (Schwein.), Cercospora kikuchii T. Matsumoto &Tomoy., (1925), and Fusarium tricinctum El-Gholl (1978) were used as controls. For S. sclerotiorum two isolates were used: S. sclerotiorum DSM 1946 (GenBank Accession: MH857810.1; DSMZ, Braunschweig, Germany) and S. sclerotiorum IZS (own isolate). Isolates of C. truncatum and F. tricinctum were from our laboratory collection. Additional control species were Fusarium solani (Mart.), two isolates of Alternaria spp, and three rust species: Phakopsora pachyrhizi (Syd.), Uromyces fabae (Bary ex Cooke), and Uromyces appendiculatus (Unger). Cultures were grown on acidified potato dextrose agar (APDA) or potato dextrose agar (PDA), respectively, for 10 days at 25 ± 2°C. Rust fungi were propagated by inoculating the respective host plants.

Stem samples covered with pycnidia were taken from four months-old plants that had been artificially inoculated with the D. longicolla isolates indicated in Table 1 in greenhouse pathogenicity tests [4]. Leaf and stem samples from four-week-old healthy soybean plants were used as control.

Seed samples were taken from seed lots (cultivars Sultana and Primus) known to contain seeds infected with Diaporthe spp. [4]. More infected soybean seeds (with and without symptoms; cultivar Anuschka) were from Landwirtschaftsbetrieb Zschoche (Südliches Anhalt, Germany). Healthy soybean seeds (healthy as determined by the source, no symptomatic seeds in the sample; cultivar Sultana) were obtained from the Landwirtschaftliches Technologiezentrum (LTZ) Augustenberg (Karlsruhe, Germany).

DNA extraction from mycelia

Mycelia were scraped from ten-day-old fungal cultures on APDA plates and homogenized by vortexing for 40 s using microbeads (Lysing Matrix E tubes, Fast Prep-24^TM, MP Biomedicals GmbH, Eschwege, Germany) in lysis buffer. DNA from Diaporthe strains was prepared using the peqGOLD fungal DNA Mini Kit (PEQLAB Biotechnologie GmbH, Erlangen, Germany) following the recommendations of the manufacturer. DNA from other soybean pathogens was isolated using the protocol by Liu et al. [19]. DNA concentrations were determined by measuring the absorption at 260 nm.

DNA extraction from plant material

Prior to DNA extraction, stem samples (each 2 cm) were ground individually in liquid nitrogen for 2 min using mortar and pestle. Leaf samples (≤ 100 mg) were placed individually into 2 ml micro screw tubes (Sarstedt, Nümbrecht, Germany) together with two steel balls (4.50 mm, Niro, Sturm Präzision GmbH, Oberndorf am Neckar, Germany). They were frozen for 3 min in liquid nitrogen, and homogenized for 20 s using the FastPrep^®-24 homogenizer (MP Biomedicals GmbH). The micro screw tubes were returned to liquid nitrogen for 1 min, and homogenization was repeated two more times.

For DNA extraction from seeds, soybean seeds were treated with 1% sodium hypochlorite for 30 s, followed by washing with sterile distilled water. Surface-disinfected soybean seeds were squeezed to remove their seed coats. Seed coats were placed individually in 2 ml micro screw tubes containing 2 steel balls, frozen for 3 min in liquid nitrogen, and homogenized using the FastPrep^®-24 homogenizer as described above. Uncoated soybean seeds and whole seeds were ground individually in liquid nitrogen by using mortar and pestle for three minutes. Seeds were each treated individually as separate samples.

The extraction of DNA for all homogenized plant material was done using the DNAeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions.

Design of TaqMan primer-probe sets

Multiple sequence alignments were performed using ClustalW as implemented in BioEdit (version 7.1.3.0 [20]). Melting temperatures (Tm) and potential secondary structures of primers and probes were evaluated with Gene Runner (Version 6.5.52x64 Beta).

Specificity of the selected primers was tested using NCBI’s Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). In “Primer Pair Specificity Checking Parameters” we entered nr as database and as organisms Diaporthe, Fungi, Pythium, Phytophthora, and Glycine. All oligonucleotide primers and probes were synthesized by Biomers.net GmbH (Ulm, Germany) and are shown in Table 2.

Table 2. TaqMan primer-probe combinations for detection and distinguishing D. longicolla, D. caulivora, D. eres and D. novem.

Primer-probe set/Specificity	Primer Probe	Sequence	Target isolate	Position (bp)	Fragment length (bp)	Efficiency (%)
Primer-probe set/Specificity	Primer Probe	Sequence	Target isolate	Position (bp)	Fragment length (bp)	PCR product	Genomic DNA
DPCL/DL	DPCL-F	5ʹ-`TGTCGCACCTTTACCACTG`-3ʹ	DPC-HOH20	199–217	90	98.2	81.0
	DPCL-R	5ʹ-`GAACGATCCAAAAAGCTCTC`-3ʹ		269–288
	DPCL-P	FAM-`GCATCACTTTCATTCCCACTTTCTG`-BMN-Q535		239–263
DPCC/DC	DPCC-F	5ʹ-`GCCTGCAAAACCCTGTTAC`-3ʹ	DPC-HOH2	186–204	120	97.7	90
	DPCC-R	5ʹ-`CATCATGCTTTAAAAATGGGG`-3ʹ		285–305
	DPCC-P	Cy5-`CTCTTACCACACCTGCCGTCG`-BMN-Q620		237–257
DPCE/DE	DPCE-F	5’-`ACTCACTCAATCCTTGTCAC`-3’	DPC-HOH3	208–227	100	82.4	92.2
	DPCE-F	5’-`ACTCACTCAATCCTTGTCAC`-3’		288–307
	DPCE-R	5’-`GAGGGTCAGCATAATATTCG` 3’		244–266
	DPCE-R	5’-`GAGGGTCAGCATAATATTCG` 3’	DPC-HOH7	208–227	101
	DPCE-P	ROX-`CCATCAACCCCATCGCCTCTTTC`-BMN-Q590		289–308
	DPCE-P	ROX-`CCATCAACCCCATCGCCTCTTTC`-BMN-Q590		245–267
DPCN/DN	DPCN-F	5ʹ-`AAAACCCTGCTGGCATTAAC`-3ʹ	DPC-HOH8	192–211	99	94.5	93
	DPCN-F	5ʹ-`AAAACCCTGCTGGCATTAAC`-3ʹ		270–290
	DPCN-R	5ʹ-`TATTCTTGACAGTTCGTTTCG`-3ʹ		238–262
	DPCN-R	5ʹ-`TATTCTTGACAGTTCGTTTCG`-3ʹ	DPC-HOH11	193–212	99	95.5	84.2
	DPCN-P	HEX-`TCTACCACTTTCAACCCTATCAATC`-BMN-Q535		271–291
	DPCN-P	HEX-`TCTACCACTTTCAACCCTATCAATC`-BMN-Q535		239–263

Open in a new tab

F, R, P = Forward, Reverse, and Probe. The probes carry ROX, FAM, Cy5, or HEX dyes as reporter attached to the 5ʹ-terminal nucleotide and BMN-Q590, BMN-Q535, or BMN-Q620 as quencher attached to the respective3ʹ-terminal nucleotide.

DE = D. eres, DL = D. longicolla, DC = D. caulivora, and DN = D. novem.

Real-time PCR

Real-time PCR was performed using a CFX96 Real-Time PCR system (Bio-Rad Laboratories GmbH, Munich, Germany) using FrameStar® 96-Well Skirted PCR Plates (4titude, Brooks Automation, Chelmsford, MA, USA). Real-time PCR reactions were prepared using a ready to use mixture, SensiFAST Probe No-ROX mix (2x) (SensiFAST^TM Probe No-ROX Kit, Bioline GmbH, London, UK). All reactions were performed with a final volume of 20 μl. Reaction mixtures in singleplex real-time PCR assays consisted of 10 μl 2x SensiFAST Probe No-ROX mix, 8 pmol of each forward and reverse primers, 2 pmol probe, and 2 μl template DNA. Reaction mixtures for duplex and quadruplex real-time PCR assays consisted of 10 μl 2x SensiFAST Probe No-ROX mix, and a reduced amount of 4 pmol of each forward and reverse primers, 1 pmol of each of the two probes, and 2 μl template DNA. Reaction mixtures for quantifying soybean DNA consisted of 10 μl 2x SensiFAST SYBR No-ROX mix, 8 pmol each of primers GmUKN2f (5’-GCCTCTGGATACCTGCTCAAG-3’) and GmUKN2r (5’-ACCTCCTCCTCAAACTCCTCTG-3’) [21], and 2 μl template DNA.

Samples were incubated for 3 min at 95°C and then subjected to 40 cycles of 95°C for 15 s and 60°C for 45 s. Reactions used as standards were run in technical triplicates; reactions used to test for pathogen presence were run in technical duplicates. No-template controls were included for all assays, singleplex, duplex and quadruplex.

Dilution series of PCR products and genomic DNA

TEF regions were amplified via PCR using primers EF1-728F (5’-CATCGAGAAGTTCGAGAAGG-3’) and EF1-986R (5’-TACTTGAAGGAACCCTTACC-3’) [22] in individual reactions for the different Diaporthe isolates. Amplification was performed in 25 μl reactions: 2.5 μl 10x Taq buffer with (NH₄)₂SO₄ (Thermo Fisher Scientific, Waltham, MA, USA), 2.5 μl 2 mM dNTPs, 2.5 μl MgCl₂ (25 mM), 12.5 pmol of each forward and reverse primers, 1 μl Taq DNA polymerase (1 U/μl), and 1 μl genomic DNA. The following conditions were used: 3 min at 95°C, 35 cycles of: denaturation 30 s at 95°C, annealing 30 s at 68°C, and elongation 30 s at 72°C, and a final elongation of 5 min at 72°C. PCR products were checked by electrophoresis on 2% agarose gels. Subsequently, PCR products were purified using the PEQGOLD Cycle-Pure Kit (PEQLAB Biotechnologie GmbH). DNA concentrations were determined by using a Qubit^® 2.0 Fluorometer (Thermo Fisher Scientific). To determine the amplification efficiency of each primer-probe set, serial dilutions of PCR products containing 10⁹ to 10⁴copies/μl and also dilution series 1:10, 1:100 and 1:1000 for the genomic DNA of the Diaporthe isolates were prepared. To allow for quantification standard curves were performed with genomic DNA of the Diaporthe isolates. For the latter the concentration of genomic DNA was both determined by measuring absorption at 260 nm and by using a Qubit^® 2.0. The DNA was diluted 1:10–1:10⁶ with 50 μg/ml DNA prepared from healthy soybean tissue.

Results

Design of TaqMan primer-probe sets for specific detection of D. longicolla, D. caulivora, D. eres, and D. novem in a multiplex real-time PCR

With the aim of building a quadruplex real-time PCR assay to detect D. longicolla, D. caulivora, D. eres, and D. novem, the Diaporthe species we previously identified in central European soybean seeds [4], we first checked the literature for primer-probe sets that might be used. Prominent among the studies addressing this issue was the one by Zhang et al. [17]. After establishing that the primer-probe sets developed by Zhang et al. [17] could not be used together in a multiplex reaction we designed our own primer-probe sets by searching alignments of Diaporthe sequences for suitable sites. We started with alignments containing the sequences of 32 Diaporthe isolates [4] together with sequences of ex-type species and removed identical sequences to gain alignments with the fewest possible number of sequences representing the sequence diversity. From the ITS alignment it became clear that it is not possible to design sets in this region because the sequences are too similar. Therefore, all primer-probe sets were designed de novo in the TEF alignment (Fig 1, Table 2).

Fig 1 — Position of primer-probe combinations DPCL (blue frames), DPCC (purple frames), DPCE (orange frames), and DPCN (green frames) in the alignment of TEF sequences of *Diaporthe* species. Identical nucleotides and gaps are represented by dots and dashes, respectively. The sequences in the alignment were chosen from the sequences obtained in [4] in order to represent all intra specific polymorphisms, identical sequences were removed.

Primers were checked for specificity using Primer-BLAST. It could be corroborated that the primer-probe combinations can distinguish between the four Diaporthe species and do not detect any other pathogens occurring on soybean in Central Europe (S1 Text).

Assessing the specificity and efficiency of the TaqMan primer-probe sets

Singleplex reactions

In order to test primer efficiency we used serial dilutions of PCR products. This way, problems with inhibitors can be avoided and the minimum template copy number can be extrapolated. To test conditions corresponding to what will be used in the screen for Diaporthe infestations genomic DNAs of the Diaporthe isolates were also tested. We obtained acceptable efficiencies with the PCR products and with the genomic DNAs (S1 Fig, Table 2). From our dilution series with PCR products we could also deduce that we can detect as few as ten copies or less. Each primer probe set was also tested with genomic DNA from the non-target Diaporthe species (S2 Fig). No amplification was recorded with non-target species indicating good specificity of the primer probe sets.

Multiplex reactions

To ensure adequate efficiencies of the TaqMan primer-probe sets in the presence of other oligonucleotides and fluorogenic dyes, duplex real-time PCR assays were performed. We tested all six combinations of primer-probe sets. Each combination was tested by applying parallel dilution series with DNA of both species. The efficiencies were still good. A full description of the experiment can be found in S2 Text.

Our first step in assessing the quadruplex assay was to test again for specificity. DNA from the different isolates was added individually to the reactions. In all cases, we obtained a signal from the specific reporting dye only (Fig 2). For D. longicolla and D. eres additional isolates were tested with identical results. This proves that each primer-probe set amplifies DNA from its target species but not from the other three species. Two non-target Diaporthe spp., nine other soybean pathogens, and two additional rust fungal species tested negative. Similarly, DNA extracted from healthy soybean leaves and stems was not amplified (Fig 2). This indicates high specificity of our primer-probe sets also in a quadruplex assay.

Fig 2 — Since the graphs for different isolates of the target species and also of all the non-target species are highly similar, only one representative graph is shown each. 0.4 ng DNA from (A) D. *longicolla* DPC_HOH28, (B) D. *caulivora* DPC_HOH2, (C) D. *eres* DPC_HOH3, and (D) D. *novem* DPC_HOH15 was added individually to the mix that contained all four primer-probe sets. (E) shows the result for the non-target species D. *aspalathi*, D. *foeniculina*, *Cercospora kikuchii*, *Fusarium solani*, *Alternaria sp*., S. *sclerotiorum* DSMZ, or S. *sclerotiorum* IZS, *Colletotrichum truncatum*, F. *tricinctum*, *Phakopsora pachyrhizi*, *Uromyces fabae*, *Uromyces appendiculatus*, healthy soybean leaf, and healthy soybean stem. For these species and also D. *longicolla* isolate PL-157a and D. *eres* isolate PS-74 DNA amounts varied between 350 and 2,500 ng.

When two or three different DNA samples of species of Diaporthe were tested together, all four TaqMan primer-probe sets retained similar specificity and showed discrimination between the particular pathogens present in the quadruplex assay. Finally, when applying DNA of all four species of Diaporthe together in one PCR reaction, the appearance of signals related to all four reporting dyes proved the ability of the assay to detect D. longicolla, D. caulivora, D. eres and D. novem in parallel (Fig 3).

Fig 3 — Parallel detection of two (A-F), three (G-J), or all four (K) different *Diaporthe* species. 0.4 ng DNA from (A) D. *longicolla* (blue) and D. *caulivora* (purple), (B) D. *longicolla* and D. *eres* (orange), (C) D. *longicolla* and D. *novem* (green), (D) D. *caulivora* and D. *eres*, (E) D. *caulivora* and D. *novem*, (F) D. *eres* and D. *novem*, (G) D. *longicolla*, D. *caulivora*, and D. *eres*, (H) D. *longicolla*, D. *caulivora*, and D. *novem*, (I) D. *longicolla*, D. *eres*, and D. *novem*, (J) D. *caulivora*, D. *novem*, and D. *eres*, and (K) D. *longicolla*, D. *caulivora*, D. *eres*, and D. *novem* were added to the mix that contained all four primer-probe sets.

Standard curves for quantification using the quadruplex real-time PCR assay

After testing the efficiency and the specificity of the primer-probe sets and after establishing that they can be used together in a quadruplex assay, we started to evaluate the full assay for its sensitivity. For this, dilution series were created with DNA from four representative isolates, using roughly 20 ng, 2 ng, 200 pg, 20 pg, 2 pg, 0.2 pg, and 0.02 pg DNA per reaction and diluting with DNA prepared from soybean tissue. The resulting standard curves (Fig 4, Table 3) can be used to calculate the amount of Diaporthe DNA in ng per reaction.

Fig 4 — (A) Graph and data of the standard curve for D. *longicolla*. The highest starting amount was 19.4 ng. The fluorescence threshold was set at 10 RFU. (B) Graph and data of the standard curve for D. *caulivora*. The highest starting amount was 17.4 ng. The fluorescence threshold was set at 35 RFU. (C) Standard curve for D. *eres*. The highest starting amount was 21.4 ng. The fluorescence threshold was set at 84 RFU. (D) Standard curve for D. *novem*. The highest stating amount was 19.4 ng. The fluorescence threshold was set at 42 RFU.

Table 3. Functions and additional information derived from standard curves.

Species	Isolate^a	Function^b [C_q]	LOD^c [pg]	C_q cutoff^d
D. longicolla	DPC_HOH20	= 23.6–3.4x	0.2 > X > 0.02	36 > X > 39
D. caulivora	DPC_HOH2	= 22.8–3.5x	0.2 > X > 0.02	35 > X > 38
D. eres	DPC_HOH7	= 22.2–3.5x	0.2 > X > 0.02	33 > X > 36
D. novem	DPC_HOH11	= 22.7–3.3x	2^c > X > 0.02	32 > X >37

Open in a new tab

^aIsolate from which DNA was prepared for the standard curve experiment.

^bFunction describing the standard curve. x = log10 starting quantity in ng.

^cEstimate for the limit of detection showing the DNA amount from the standard curve experiment that still gave an amplification and the first amount that did not give amplification. For D. novem one of the reactions at 0.2 ng was also negative; this is responsible for the very wide range in this case.

^dEstimate for the C_q cutoff derived from the LOD: C_q corresponding to the amount still giving amplification and the calculated virtual C_q where no amplification was seen.

The full series of tests for determining the limit of detection (LOD) and a C_q cutoff could not be performed so far. Nevertheless, results from our dilution series allow for a rough estimate of these values. These estimates are presented in Table 3.

Validation of the quadruplex real-time PCR assay

Infected soybean stems

For our multiplex real-time PCR to be useful it is necessary that it is capable to detect DNA from Diaporthe spp. prepared from infected plant samples. To validate this, we first used stem samples covered with pycnidia. These were taken from plants that had been artificially inoculated with D. longicolla isolates (Table 1) in greenhouse pathogenicity tests [4].

D. longicolla DNA was detected in all tested samples with visible symptoms (Fig 5). For healthy stem samples the primer-probe sets produced no amplification (Fig 5).

Screening soybean seeds

Because Diaporthe spp. are seedborne pathogens, the most important application for our newly developed assay is the screening of soybean seed-lots. Therefore, we tested detection of these pathogens using DNA prepared from soybean seeds. We used seed samples from seed-lots that were known to contain seeds infected with Diaporthe spp. and that already had been used in our earlier study [4] on identification of Diaporthe strains. All four Diaporthe species could be detected in different seed samples or seed lots. We also tested DNA preparation from whole seeds, seed coats and uncoated seeds. S3 Fig shows an example where we detected D. eres and D. novem in extracted DNA of seed coats, uncoated seeds and whole seeds via the quadruplex real-time PCR assays. For healthy seeds the primer-probe sets produced no amplification. These experiments also yielded the perception that DNA preparation from seed coats is most easily accomplished, especially homogenization. Therefore, in the following experiments we used DNA from seed coats, only.

Finally, we present results from sampling two different seed lots (Fig 6). For each lot we prepared DNA from 30 seed coats and tested these DNA samples in the quadruplex qPCR assay. In addition, we determined the amount of soybean DNA using soybean primers in a SYBR green based qPCR reaction. The amount was calculated using the standard curve for soybean DNA (C_q = 30.9–3.6x). Thus, we can quantify the severity of an infection in ng pathogen DNA/ng soybean DNA.

It is apparent that in any seed lot there are seeds infected with Diaporthe spp. while other seeds seem to be free of the pathogens. On the other hand, the portion of fungal DNA that can be found in a seed varies by more than an order of magnitude (pg per ng soybean DNA up to ng per ng soybean DNA). For establishing the assay in the seed certification process it still needs to be established whether the portion of fungal DNA in different seeds should be taken into account or whether the assay should deliver pure yes or no results for a given seed. For the latter decision a more precise determination of LOD and C_q cutoff will be necessary.

Discussion

Soybean production in central Europe has been on a very small scale, so far. This is mostly due to the cold climatic conditions. Together with smaller plot sizes this contributed to the fact that soybean production in central Europe was not competitive compared to production in the USA or South America. These conditions are now changing. There is growing demand for soybean for human consumption that is not genetically modified (non-GM soybean). In addition, there is growing reservation against importing GM soybean for animal feed. Together with warmer and drier weather caused by climate change and the introduction of new cultivars that tolerate the weather in central Europe, the conditions for growing soybean in central Europe have much improved [23].

Soybean production in central Europe is expanding rapidly, but starting from almost nothing [23]. It can be surmised that pathogens affecting soybean in other regions of the world will become important in central Europe, too. Nevertheless this assumption needs to be confirmed. As part of a larger project surveying the whole complement of pathogens on soybean in central Europe we have analyzed the DPC on soybean. In the course of this survey we established the presence of D. longicolla, D. caulivora (J.M Santos), D. eres (Nitschke), and D. novem (J.M. Santos) in central Europe [4]. In comparison, in Serbia also D. foeniculina, D. rudis [24], and D. sojae [25] were found on soybean seeds. The latter study [25], however, could not find D. foeniculina and D. rudis but determined D. longicolla as the dominating Diaporthe species followed by D. caulivora. This also indicates that D foeniculina and D. rudis only have marginal occurrence, which is probably also true for D. sojae in central Europe.

A severe limitation to these studies is the relatively small number of seeds that were tested and the much smaller number of fungal isolates that were assigned to a species. So far the rating of D. longicolla as the dominant species in central Europe relies on the assignation of 32 isolates [4]. To enable much wider sampling that could lead to epidemiological studies and monitoring of the species over several years and to limit the spread of these pathogens in central European soybean fields, especially such fields newly introduced to soybean production, we set out to build a diagnostic assay for these four species.

We chose qPCR for our assay since it allows quick and specific identification of pathogens and, using TaqMan probes with different fluorescent dyes, also allows parallel detection of different species in a multiplex reaction [11]. Parallel detection of pathogens is desirable because it reduces the number of necessary qPCR reactions by the multiplexing factor. Especially with large sample numbers this can save a lot of money. On the other hand, multiplex assays are more difficult to design than singleplex reactions. In singleplex reactions the probe just adds to the specificity of the assay, which is determined by primers and probe together. In this case it can be sufficient if one of the three oligos of the primer-probe set is specific. In a multiplex, however, a probe must be specific to just one species, otherwise there is cross-detection of the different species. The primers should also be specific, because false amplifications could lead to reduced efficiencies of the assay. This means that for a multiplex all three oligos of the primer-probe set should be specific and in the case of a quadruplex that twelve unique oligonucleotides have to be identified.

Our approach was aim-oriented rather than searching for novelty and so, instead of just designing primers de novo we first searched the literature for existing PCR assays for detection of the four Diaporthe species. Prominent here was the study by Zhang et al. [17] who developed three primer-probe sets, PL-5, PL-3, and DPC-3. While PL-5 detects D. longicolla, D. caulivora, D. phaseolorum var. sojae, and D. phaseolorum var. meridionalis in parallel, PL-3 and DPC-3 are specific for D. longicolla and D. caulivora, respectively. Unfortunately, the primer-probe sets are only specific when used in singleplex reactions. Importantly the probes PL-3 P and DPC-3 P bind to the same sequence and cannot be used together in a multiplex assay.

We next made an effort to alter the primer-probe sets PL-3 and DPC-3 [17] to enable their use in a multiplex assay and to design primers and probe for D. eres based on the ITS sequence. However, it soon became apparent that there is too little sequence divergence between the four species within the ITS region to design primer-probe sets that are not only specific for the different species but can also be used together in a quadruplex assay. Therefore, we decided to design primers de novo using our alignment of TEF sequences of the four Diaporthe species that shows more sequence divergence (Fig 1).

Subsequently, all four TaqMan primer-probe sets were tested in singleplex assays individually to amplify the PCR products and genomic DNA of the respective Diaporthe strains. The four TaqMan primer-probe sets showed excellent discrimination of the sequences for which they were designed. Also, the performance of the primer-probe sets in duplex assays revealed that the efficiency of the primer-probe sets does not change markedly in the presence of a second primer-probe set and that presence of one pathogen in abundance does not mask detection of another less abundant pathogen. Furthermore, the four amplification curves in quadruplex real-time PCR showed that each primer-probe set amplifies a single product for its target species, confirming the specificity of the primer-probe sets. The accuracy of this multiplex assay was also tested with DNA from other important soybean pathogens, healthy stem and leaf tissue as negative controls, without any false positive results.

For the assay to reflect the actual pathogen load in an infected tissue, it is necessary that quantification is possible. To enable this, we created standard curves with genomic DNA prepared from pure cultures of isolates of all four Diaporthe species relevant in our assay. The DNA was diluted in soybean DNA to simulate tests in which DNA is prepared from soybean tissue to diagnose Diaporthe. With our standard curves it is now possible to quantify the four Diaporthe species and even though the exact LOD for the four species in the assay was not yet determined it could be deduced that it is less than 0.2 pg.

The suitability of this assay for detection of Diaporthe species in infected plant material was supported via detection of D. longicolla from stem samples inoculated with this species. There was a 100% correlation between re-identification of D. longicolla from stem tissue using the real-time PCR assay and results obtained using culture-based and sequencing based methods [4].

Because of the importance of seed health testing to detect seed-borne pathogens as the first step in the management of crop diseases, conventional seed detection assays including visual examination, selective media, serological assays and the seedling grow-out assay have been used extensively, but all have shortcomings ranging from inefficiency to lack of specificity and sensitivity [26]. Therefore, the multiplex real-time PCR assay was evaluated for screening of seeds. When applying extracted DNA from three different parts of infected soybean seeds to the assay, D. eres and D. novem were detected first. These first tests also showed, that when a seed is infected, the pathogen can also be found in the seed coat. Since homogenization of seed coats is easier than homogenization of whole seeds we decided that testing of seed coats is the way to proceed.

We finally applied our assay to the testing of seed lots instead of individual seeds. Even though this was the first test of the assay it shows more about the tested seed lots than what could have been learned by extensive seedling grow-out assays combined with species determination (for example [4,24,25]). Not only could we determine what was the dominant species (D. caulivora in the first and D. novem in the second seed lot), we could also detect double or even triple infections of individual seeds, that would most likely have been missed with a different assay. The main aim of the experiment was to gather data that should later help with developing sampling schemes for the assessment of seed lots. Our data show, that even in heavily infested lots as chosen for these tests, individual seeds may be or may not be infected, suggesting that it will be necessary to test a considerable number of seeds per lot before making a decision on the suitability of a given lot. We also found that the pathogen load per seed can vary considerably. It will be necessary to gather more data, to perform additional experiments studying disease progression, and to discuss with both seed companies and authorities involved in seed testing and certification to decide on the best sampling scheme and whether the pathogen load per seed should be considered in the decision on a seed lot. Seed soaking assays [27] could be an alternative to random sampling of seeds with DNA preparation from the seeds and will be considered in further tests of our assay.

In conclusion, our assay eliminates the need to obtain cultures of the pathogens for identification. It provides a rapid and practical method to detect four important and common species of Diaporthe directly in diseased plant tissues and infected soybean seeds. The application of our assay offers the potential to improve laboratory diagnosis of Diaporthe spp. in soybean seeds. It can contribute to survey the distribution of Diaporthe spp. in different regions, different years, and different cultivars. It could be of value for inspection of soybean seed lots and can be used to prevent the transmission of pathogens and improve disease control decision making.

Supporting information

S1 Fig. Standard curves to determine the efficiency of the primer probe sets DPCL, DPCC, DPCE, and DPCN in singleplex reactions.

Graphs showing the quantification cycle (C_q) on the y-axis and the quantity of TEF PCR product (10 to 10¹⁰ copies) ((A), (C), (E), (G), (I)) or genomic DNA (undiluted, 1:10, 1:100 and 1:1,000) ((B), (D), (F), (H), (J)) for D. longicolla isolate DPC-HOH20 ((A) and (B)), D. caulivora isolate DPC-HOH2 ((C) and (D)), D. eres isolate DPC-HOH7 ((E) and (F)), and D. novem isolates DPC-HOH8 ((G) and (H)) and DPC-HOH11 (I and J).

(TIF)

Click here for additional data file.^{(2.4MB, tif)}

S2 Fig. Specificity test for each species-specific TaqMan primer-probe set with Diaporthe species.

Specificity test for primer-probe set (A) DPCL, (B) DPCC, (C) DPCE, and (D) DPCN with DNA from D. longicolla, D. caulivora, D. eres, and D. novem (from left to right), respectively.

(TIF)

Click here for additional data file.^{(2.5MB, tif)}

S3 Fig. Screening soybean seeds via the quadruplex real-time PCR assay.

D. eres and D. novem were detected in extracted DNA of (A) infected seed coat, (B) infected uncoated seed, and (C) whole infected seed. No amplification was observed for (D) healthy seed coat, (E) healthy uncoated seed, and (F) whole healthy seed.

(TIF)

Click here for additional data file.^{(2.4MB, tif)}

S1 Text. Primer BLAST results.

(DOCX)

Click here for additional data file.^{(14.2KB, docx)}

S2 Text. Test of the primer-probe sets in Duplex reactions with both templates.

(DOCX)

Click here for additional data file.^{(15.9KB, docx)}

S1 File. Excel file with multiple datasheets with contents and Cq values from the qPCR experiments reported in this publication.

(XLSX)

Click here for additional data file.^{(68.4KB, xlsx)}

Acknowledgments

We would like to express our sincere gratitude to Taifun-Tofu GmbH (Freiburg, Germany), to the Landwirtschaftsbetrieb Zschoche (Südliches Anhalt, Germany), and to the Landwirtschaftliches Technologiezentrum (LTZ) Augustenberg (Karlsruhe, Germany) for providing infected and healthy soybean seed lots, and to Daniela Hirschburger for supplying the fungal cultures of Sclerotinia sclerotiorum, Colletotrichum truncatum, and Fusarium tricinctum, and to Kristina Petrović for supplying fungal cultures of Diaporthe aspalathi, Diaporthe foeniculina, Diaporthe longicolla, Diaporthe eres, Fusarium solani, Cercospora kikuchii, and Alternaria sp.. We thank Heike Popovitsch for technical assistance.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This research was supported by the German Federal Office for Agriculture and Food (SoySound; Grant number 2815EPS082; to TL) and the Food Security Center (FSC) of University of Hohenheim to BH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Baird RE, Abney TS, Mullinix BG. Fungi associated with pods and seeds during the R6 and R8 stages of four soybean cultivars in southwestern Indiana. Phytoprotection. 2001; 82:1–11. doi: 10.7202/706210ar [DOI] [Google Scholar]
2.Sinclair JB. Phomopsis seed decay of soybeans—a prototype for studying seed disease. Plant Disease. 1993; 77:329–334. [Google Scholar]
3.Sinclair JB. Discoloration of soybean seeds: an indicator of quality. Plant Disease. 1992; 76:1087–1091. [Google Scholar]
4.Hosseini B, El-Hasan A, Link T, Voegele RT. Analysis of the species spectrum of the Diaporthe/Phomopsis complex in European soybean seeds. Mycological Progress. 2020; 19:455–469. doi: 10.1007/s11557-020-01570-y [DOI] [Google Scholar]
5.Rehner SA, Uecker FA. Nuclear ribosomal internal transcribed spacer phylogeny and host diversity in the coelomycete Phomopsis. Canadian Journal of Botany. 1994; 72:1666–1674. doi: 10.1139/b94-204 [DOI] [Google Scholar]
6.Zhang AW, Hartman GL, Riccioni L, Chen WD, Ma RZ, Pedersen WL. Using PCR to distinguish Diaporthe phaseolorum and Phomopsis longicolla from other soybean fungal pathogens and to detect them in soybean tissues. Plant Disease. 1997; 81:1143–1149. doi: 10.1094/PDIS.1997.81.10.1143 [DOI] [PubMed] [Google Scholar]
7.Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia. 2013; 31:1–41. doi: 10.3767/003158513X666844 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Mathew FM, Alananbeh KM, Jordahl JG, Meyer SM, Castlebury LAG, T. J., Markell SG. Phomopsis stem canker: A reemerging threat to sunflower (Helianthus annuus) in the United States. Phytopathology. 2015; 105:990–997. doi: 10.1094/PHYTO-11-14-0336-FI [DOI] [PubMed] [Google Scholar]
9.Santos JM, Correia VG, Phillips AJL. Primers for mating-type diagnosis in Diaporthe and Phomopsis: their use in teleomorph induction in vitro and biological species definition. Fungal Biology. 2010; 114:255–270. doi: 10.1016/j.funbio.2010.01.007 [DOI] [PubMed] [Google Scholar]
10.Udayanga D, Liu X, Mckenzie EHC, Chukeatirote E, Bahkali AHA, Hyde KD. The genus Phomopsis: biology, applications, species concepts and names of common phytopathogens. Fungal Diversity. 2011; 50:189–225. doi: 10.1007/s13225-011-0126-9 [DOI] [Google Scholar]
11.Schena L, Nigro F, Ippolito A, Gallitelli D. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. European Journal of Plant Pathology. 2004; 110:893–908. doi: 10.1007/s10658-004-4842-9 [DOI] [Google Scholar]
12.Schena L, Li Destri Nicosia MG, Sanzani SM, Faedda R, Ippolito A, Cacciola SO. Development of quantitative PCR detection methods for phytopathogenic fungi and oomycetes. Journal of Plant Pathology. 2013; 95:7–24. [Google Scholar]
13.Schena L, Hughes KJ, Cooke DE. Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real-time PCR. Molecular Plant Pathology. 2006; 7:365–379. doi: 10.1111/j.1364-3703.2006.00345.x [DOI] [PubMed] [Google Scholar]
14.Schaad NW, Frederick RD, Shaw J, Schneider WL, Hickson R, Petrillo MD, et al. Advances in molecular-based diagnostics in meeting crop biosecurity and phytosanitary issues. Annual Review of Phytopathology. 2003; 41:305–324. doi: 10.1146/annurev.phyto.41.052002.095435 [DOI] [PubMed] [Google Scholar]
15.Taylor EJA, Bates J, Kenyon D, Maccaferri M, Thomas J. Modern molecular methods for characterization and diagnosis of seed-borne fungal pathogens. Journal of Plant Pathology. 2001; 83:75–81. [Google Scholar]
16.Schaad NW, Frederick RD. Real-time PCR and its application for rapid plant disease diagnostics. Canadian Journal of Plant Pathology. 2002; 24:250–258. doi: 10.1080/07060660209507006 [DOI] [Google Scholar]
17.Zhang AW, Hartman GL, Curio-Penny B, Pedersen WL, Becker KB. Molecular detection of Diaporthe phaseolorum and Phomopsis longicolla from soybean seeds. Phytopathology. 1999; 89(9):796–804. doi: 10.1094/PHYTO.1999.89.9.796 [DOI] [PubMed] [Google Scholar]
18.Kontz B, Adhikari S, Subramanian S, Mathew FM. Optimization and application of a quantitative polymerase chain reaction assay to detect Diaporthe species in soybean plant tissue. Plant Disease. 2016; 100:1669–1676. doi: 10.1094/PDIS-10-15-1204-RE [DOI] [PubMed] [Google Scholar]
19.Liu D, Coloe S, Baird R, Pedersen J. Rapid mini-preparation of fungal DNA for PCR. Journal of Clinical Microbiology. 2000; 38:471. doi: 10.1128/JCM.38.1.471-471.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999; 41:95–98. [Google Scholar]
21.Hu R, Fan C, Li H, Zhang Q, Fu YF. Evaluation of putative reference genes for gene expression normalization in soybean by quantitative real-time RT-PCR. BMC Mol Biol. 2009; 10:93. doi: 10.1186/1471-2199-10-93 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Carbone I, Kohn LM. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999; 91:553–556. doi: 10.1080/00275514.1999.12061051 [DOI] [Google Scholar]
23.Siebert L, Tränkner-Benslimane K. Value chain of soybeans in China and Germany 2020. 11/19/2020:[27 p.]. Available from: https://www.dcz-china.org/en/dcz-publications.html. [Google Scholar]
24.Petrović K, Riccioni L, Vidić M, Đorđević V, Balešević-Tubić S, Đukić V, et al. First report of Diaporthe novem, D. foeniculina, and D. rudis associated with soybean seed decay in Serbia. Plant Disease. 2016; 100(11):2324. doi: 10.1094/PDIS-03-16-0353-PDN [DOI] [Google Scholar]
25.Krsmanović S, Petrović K, Ćeran M, Đorđević V, Ranđelović P, Jaćimović S, et al. Diversity of phytopathogenic fungi on soybean seed in Serbia. Ratar Povrt. 2020; 57(3):80–86. doi: 10.5937/ratpov57-27516 [DOI] [Google Scholar]
26.Walcott RR. Detection of seedborne pathogens. HortTechnology. 2003; 13:40–47. doi: 10.21273/HORTTECH.13.1.0040 [DOI] [Google Scholar]
27.Ramiro J, Ciampi-Guillardi M, Caldas DGG, de Moraes MHD, Barbieri MCG, Pereira WV, et al. Quick and accurate detection of Sclerotinia sclerotiorum and Phomopsis spp. in soybean seeds using qPCR and seed-soaking method. Journal of Plant Pathology. 2019; 167:273–282. doi: 10.1111/jph.12796 [DOI] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0257225.r001

Decision Letter 0

Ruslan Kalendar

20 Jan 2021

PONE-D-20-38183

Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

PLOS ONE

Dear Dr. Link,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Authors should consider all comments from reviewers who have done a big job to improve this work. There are many comments and they are important, the authors may need to carry out additional experiments in accordance with these recommendations.

Please submit your revised manuscript by Mar 06 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: No

Reviewer #3: Yes

Reviewer #4: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: No

Reviewer #3: Yes

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Reviewer #1:

The manuscript reports the design of primers/probe sets to be used in a multiplex real-time PCR assay to identify four Diaporthe species causing disease on soybean.

First, the authors should state clearly what is the relevance of distinguishing the four different species involved, in terms of disease management. Why do we need to use a costly multiplex real-time PCR assay to help monitoring or preventing the disease? The introduction should explain why the four species should be considered separately and specifically, especially since D. longicolla and D. eres are regarded as the same species according to the current taxonomic databases (see USDA ARS DB). Overall, although I do not question the effort to design specific oligonucleotides, I think that this work lacks a clear and sufficient demonstration of the specificity of the assay. Only a few target species and non-target species have been included in the experiment, and the work does not provide evidence of the application for field samples, and data. Late Ct values observed with non-target species are visible on figure S1, but not discussed at all. A last major issue is the lack of validation of the assay with field samples. Seeds have only been assessed individually, which prevents the use of the test at a practical scale. A protocol to test seed samples (with 400-1000 seeds) should be described. Last, the inhibition and amplifiability of the samples have only been assessed with pure fungal DNA, which has no practical application with field samples. Evaluation of inhibition and amplifiability should be verified with plant DNA, using a reference gene amplification such as COX or 18S rDNA.

I also have other comments that should be addressed to improve the manuscript, listed below. In general, there is too many figures, which should be transferred to supporting material, or simply removed (duplex assay).

I recommend major revisions before acceptance.

L34: remove “anamorph: Phomopsis” since this nomenclature is no longer in force in fungal taxonomy (one fungus, one name)

L71: “providing species specificity”: this part of the sentence does not make sense. Please reword.

L72-74: this sentence referring to reviews is useless here.

L74-L77: why identification of pathogen would provide information on diseases threshold. There is no connection.

Table 1: This is one of the core issue with this study. The shallow number of strains studied and included for each species. Without a significantly higher number of strains, and DNA sequences, there is no possible evaluation of the intra specific polymorphism. Figure 1 shows that such a polymorphism occur for ITS within D. eres. Maybe other intraspecific polymorphism occur for ITS and TEF for other strains of the 4 species, and has been ignored or overlooked. In addition, TEF sequences listed in Table 1 are not available on GenBank. They should be.

L107-112: again, one may regret the very weak number of non-target species included in the specificity assessment (only 3!). Many other species, closely related genetically or also present on Soybean, should be included in the study to support that the multiplex assay does not cross-react with non-target species DNA.

L113: four-month-old

L116: seed lots

L148: how many sequences were used?

L187: “replicates” means how many?

L201: copy numbers are described here, but never used later in the manuscript and in the results section. Why is so?

L246-247: This simply is not true since late Ct values can be observed with a non-target species. Similar late Ct values are observed with individual seed (Fig 10), thus questioning the specificity of the assay or at least interpretation of the results.

L263: Since the goal of the assay is to be used in a multiplex fashion, I do not see the point of assessing the assay in several duplex reactions. Amplifiability and competition should be assessed directly in quadruplex. All the part dealing with duplex should be removed in my opinion.

L275: Competing

L302: Which DNA concentration have been used here?

Discussion: the first part of the discussion L345-383 is just simple repetition of the introduction of or the results and has not added value. The discussion should “discuss” the results, in light of other works, not repeat them.

L395-398: the data showing correlation of isolation and real-time assay are not shown, which is unfortunate. The work should definitely include real-world field samples, not only individual seeds.

L400-L404: please provide information regarding DPC, instead of general seed-borne diseases.

L408-411: this is irrelevant here, it is like presenting the objectives of another work.

L415: the authors should clearly describe why the assay offers a potential to “dramatically” improve lab diagnostic.

Reviewer #2:

The manuscript, titled “Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean” developed a singleplex, duplex and quadruplex real-time PCR assay to distinguish four soybean pathogens.

The method could be a detection tool to improve the diagnosis and management of these pathogens. The PCR, especially real-time PCR, could increase specificity and sensitivity compared to more traditional techniques. To achieve this, a reliable method is required. Therefore, a validation study of real-time PCR method should be conducted to confirm by examination and provision of objective evidence that the particular requirements for a specific intended use are fulfilled. The qualitative real-time PCR method must meet acceptance criteria of specificity, sensitivity (limit of detection, LOD), robustness, amplification efficiency and linearity (the latter two optional).

The results of the theoretical specificity test on the BLAST database (Materials and Methods, lines 151-154) are neither shown nor discussed. The experimental sensitivity was tested with target DNA (D. longicolla, caulivora, eres, novem, S1 Fig., Figs 2-9) at unknown concentrations in ng (line 128, “DNA concentrations were determined by measuring the absorption at 260 nm” inconsistent with lines 199-200 “DNA concentrations were determined by using a Qubit 2.0 Fluorimeter” and results are not shown). Determination number for pathogens test is unclear: lines 186-187 “reaction used as standards were run in technical triplicates; reaction used to test for pathogen presence were run in technical replicates”. Non-target DNA tested were S. sclerotiorum DSMZ, S.sclerotiorum IZS, C. truncatum, F. tricinctum, healthy soybean leaf and stem, healthy soybean seed coat, uncoated and whole. Non-target DNA concentrations are unknown and it would be interesting to check specificity with respect to other Diaporthe species such as D. phaseolorum var. sojae, D. phaseolorum var. meridionalis and for the most important related crops.

Lines 102-103 Materials and methods “These Diaporthe isolates were used to test the specificity and sensitivity…”, but the sensitivity was not tested. A test, similar to the asymmetric LOD, was performed for the duplex assays (Table 2), but without first defining a LOD for each target-method and for the proposed quadruplex assay.

Robustness was not performed.

The efficiency results, shown only for single methods (Fig. 2-4, Table 2) and duplex methods (Table 4), are not good for genomic DNA of D. longicolla system (Fig. 3B), D. novem system, isolate HOH11 (Fig. 4D) and duplex PCR, set2 and set 4 (Table 2). Is the efficiency of DPCE, set 1, a transcription error? The amplification efficiency must be between 90 and 110% (-3.6 slope -3.1). The results are partially discussed and justified with the presence of polymerase inhibitors, without verification (241-243, 278, 387-390). Observing the amplification curves of Figs. 5-8 and 10, some systems shown low efficiency, especially D. caulivora.

There are many figures and only one Table 4, reporting Cq, no statistical analysis eg mean, SDr and RSDr have been provided and discussed.

Therefore, the partial specificity and low efficiency for some singleplex and duplex methods are not sufficient to consider the quadruplex method reliable and to support the conclusion.

If not already known and considered useful, I recommend the following document “Guidelines for the single-laboratory validation of qualitative real-time PCR methods-BVL 2016”, but now I do not consider the article to be published.

Reviewer #3:

The authors created a robust detection system that accurately identified four related species of the genus Diaporthe. By creating a multiplex real-time PCR assay, the authors created a scientifically valuable diagnostic that has the potential to quickly identify four closely related emerging soybean pathogens with lower time and handling costs than current methods. The authors presented clear data that their singleplex assays worked with high levels of PCR efficiency and that the assays did not interact negatively in a multiplex format.

My main concern regards the clarification of certain points of the methodologies used and better explanation of the fungal strains sampled.

Abstract: Please identify how many fungal strains of each species were tested for both the target and non-target fungi

Introduction:

What is the current geographic distribution of these fungi? Are the environmental conditions in central Europe conducive to the spread of the fungus? What are those environmental conditions? Will future predicted climate change patterns make the spread of these fungi more likely?

How does the fungus spread? Is it just through spores being transfered from seed to seed? Is distribution through infected seed lots a current or predicted pathway to spread infection (this particular question may fit better in the conclusions)

Materials and Methods:

Were the stem and leaf samples artificially inoculated with the known strains (that is how I interpreted it but it is unclear)?

Were the seed naturally infected with known or unknown strains? (this I could not determine from the text, but I believe it was known fungal species but unknown strains)?

Were the strains on the naturally infected seeds diagnosed outside of the RT-PCR assay presented? Such as by the culture techniques or classical PCR methods.

What is the known genetic diversity of the tested fungi?

Do the strains tested in vivo represent known diversity?

What is the likelihood that non-target, non-pathogenic fungi could react with the primers and probes? (can be answered better with in silico methods)

The authors used bioinformatic tools to test the primers and probe against the known sequences for the four target fungal species and several non-target species. They need to indicate how many different sequences per species were tested. This will give a better idea of how well the primers and probes work across more strains than were tested in vivo. They should also test, in silico, more non-target fungi that could occur future sampling environments and sister species or sister genera to Diaporthe to test for cross reactions.

Results:

Figures 5 - 7 make better sense as supplemental material

Seed Validation study - Were these done from single seeds or a group of seeds? How are seeds typical screened for the fungus? Did they determine the quantity of fungi present separate from the rt-PCR results? - Can be answered in the methods section

Discussion:

395-396 : The suitability of this assay for detection of Diaporthe species in infected plant material was proven via detection of D. longicolla from stem samples inoculated with this species. - worded too strongly since you only tested one species this way

Reviewer #4:

Title: Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Manuscript: PONE-D-20-38183

Line 34. “…………..the genus Diaporthe (syn. Phomopsis)…………...”

Line 36. Check the authority name for D. longicolla - Resolving the Diaporthe species occurring on soybean in Croatia (nih.gov)

Line 89. Check authority names for the fungal names.

Lines 113-115. Why were the other species not tested on the stems? Was there seeds inoculated with these four species?

Line 157. How is the PCR product (efficiency in %) > 100 for DPCE/DE? (Table 2).

Line 172. Define higher efficiencies.

Lines 206. The section on results reads more like a discussion. I would suggest reading research papers related to development of qPCR to rewrite this section. For example, there are no results on the primer blast? Or on the cut-off values for the assays.

Lines 237-238. The authors describe that they obtained good efficiencies and lower efficiencies, it would be better to provide what the Ct values look like. There is no information on the cutoff- values of Ct for each of the primer/ probe combination.

Line 281. Table 4. Please list the Cq cut-off values.

Line 330. More information needed on how much Cq value was obtained on the different species on each of the seed samples tested. How did this compare with the traditional isolation method in terms of fungal recovery?

Lines 384-394. I agree with the thoughts, but the main concern is about Diaporthe eres, which is believed to be a complex of species rather than a phylogenetically distinct species. Any thoughts about this? https://core.ac.uk/display/81525550

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

Reviewer #1: Yes: Renaud Ioos

Attachment

Submitted filename: PONE-D-20-38183_reviewer comments.pdf

Click here for additional data file.^{(79.2KB, pdf)}

PLoS One. 2021 Sep 10;16(9):e0257225. doi: 10.1371/journal.pone.0257225.r002

Author response to Decision Letter 0

18 Aug 2021

Rebuttal Letter

General remarks

We appreciate the effort of both the editor and also the reviewers. With so many reviewers, however, it is not surprising that that some comments were contradictory. Also the overall assessment of our work by the reviewers differed. Nonetheless, we have tried to address all comments below.

When we decided to publish, our plan was to separate primer design and primer testing in singleplex and multiplex reactions from application of the primers to plant and especially field samples, which we wanted to publish separately. Because of the recurrent criticism that our assay is not fully tested yet, we decided to do additional experiments and include additional data concerning primer specificity and quantification.

We acknowledge that our primer-probe-combination for D. eres was not optimal. We have designed a new one. Based on the additional experiments and data considered unnecessary from the first submission we have strongly restructured our paper.

Due to the major revisions needed, additional experiments performed, problems encountered, and other commitments it took us very long to provide this revised manuscript and we want to apologize to all people involved.

Answers to reviewer’s comments

Reviewer#1

The manuscript reports the design of primers/probe sets to be used in a multiplex real-time PCR assay to identify four Diaporthe species causing disease on soybean.

I recommend major revisions before acceptance.

We are planning to study Diaporthe epidemiology in Germany and here we want to distinguish between the species. Beyond our own assessment (Hosseini 2020) no studies determining the prevalent Diaporthe sp. in Germany exist. We now mention this in the introduction. We agree that for standard seed testing a primer probe combination with genus specificity could be more economical.

We were surprised by the reviewer’s statement that D. longicolla and D. eres should be considered as the same species since we recently published on Diaporthe phylogeny ourselves and did not receive any objection against considering these as two different species. We have checked https://nt.ars-grin.gov/fungaldatabases/new_allView.cfm?whichone=Nomenclature&thisName=Diaporthe%20eres&fromallCount=true&organismtype=Fungus and found that the statement of the reviewer is accurate. We, however, disagree with the database entry. Apart from our analysis also the studies of Gomes et al. (2013), Persoonia 31:1-41 and Udayanga et al. (2015), Fungal Biology 119, 383-407, put D. longicolla and D. eres into completely different taxa. There is no indication that these should be considered the same species. Why the database is calling D. eres and D. longicolla the same species we do not understand. The database cites J.M. Santos 2011 for the identity between D. eres and D. longicolla. We cannot follow this argument. We realized that the database is now also citing our own publication. Possibly the database entry should be considered outdated in this case.

We did additional experiments testing our primers against additional non target species. We also did additional experiments regarding quantification. We do not feel that protocols for testing seed samples need to be part of this publication.

We reduced the number of figures.

L34: remove “anamorph: Phomopsis” since this nomenclature is no longer in force in fungal taxonomy (one fungus, one name)

We removed it. The name Phomopsis no longer appears in the manuscript, except in the literature list.

L71: “providing species specificity”: this part of the sentence does not make sense. Please reword.

We rephrased the sentence.

L72-74: this sentence referring to reviews is useless here.

We chose to keep the references illustrating the uses of qPCR but have rephrased the sentence.

L74-L77: why identification of pathogen would provide information on diseases threshold. There is no connection.

We rephrased the sentence.

Based purely on what we described in the manuscript this criticism is justified. However, we have studied polymorphism in Diaporthe in central Europe in our earlier publication [4. Hosseini B, El-Hasan A, Link T, Voegele RT. Analysis of the species spectrum of the Diaporthe/Phomopsis complex in European soybean seeds. Mycological Progress. 2020; 19:455-469. doi: 10.1007/s11557-020-01570-y.]. In this study we did not find any additional intra specific polymorphism that is not covered here. Indeed, the alignment shown in Figure 1 is an excerpt from the alignments used to build the phylogenies shown in [4]. The selected sequences were chosen to represent all polymorphisms. We have added a sentence to the legend of Figure 1 explaining this.

We checked all Accession Numbers for TEF sequences listed in Table 1 using the NCBI search panel and the corresponding sequences were returned.

To address this issue we tested additional non-target species, including other Diaporthe species (D. aspalathi, D. foeniculina).

L113: four-month-old

Changed.

L116: seed lots

Changed.

L148: how many sequences were used?

Here in Material and Methods we only mention the software and algorithms that were used together with the settings. The concrete data are described in Results. In the corresponding section in the Results we have added a description of which data were used for the alignments.

L187: “replicates” means how many?

“Replicate” was replaced by duplicate.

L201: copy numbers are described here, but never used later in the manuscript and in the results section. Why is so?

These dilution series were performed mainly to determine primer efficiencies. The early idea to also use the standard curves to determine detection limits was discarded as irrelevant for test with real samples. We have now reviewed these data and partially repeated the experiments and do mention an estimated detection limit based on copy numbers.

We initially thought that it could be ok to ignore these late amplifications. Getting rid of this caused a considerable amount of work. During repeating the experiment, we realized that there were contaminations in some of our materials. After eliminating all contaminations we now have no late amplifications any more. S1 Fig. was redone, it is now S3 Fig. We also replaced parts of Fig 10 (it is now S4 Fig.).

To us the duplex experiments seemed important. But we do see the point the referee is making. We moved these results to supplementary information. We found the concentrations in our records. The experiments involving D. eres were redone with the new primer-probe set.

We now included new standard curves designed for quantification of the pathogens for the quadruplex.

L275: Competing

Corrected in Supporting Information.

L302: Which DNA concentration have been used here?

Concentrations of genomic DNA preparations were only determined by spectroscopy and did not seem important for the general message of the experiment. We now mention the range of concentrations in the legend of Fig 2.

This is true. Since our paper deals with the establishment of a method, we found it hard to find issues to discuss. We have now included more text discussing how our assay can help in assessing Diaporthe epidemiology and determine what are the dominant Diaporthe species. We also discuss the difficulties of establishing a multiplex assay.

L395-398: the data showing correlation of isolation and real-time assay are not shown, which is unfortunate. The work should definitely include real-world field samples, not only individual seeds.

We are not quite sure what kind of data should be shown here. A table of the plants that were infected? Pictures of stems or plates with mycelium? We stated our plans for including results with field samples in a later publication at the top of this document.

L400-L404: please provide information regarding DPC, instead of general seed-borne diseases.

L408-411: this is irrelevant here, it is like presenting the objectives of another work.

L415: the authors should clearly describe why the assay offers a potential to “dramatically” improve lab diagnostic.

This part of the discussion was included to explain why this manuscript does not yet include results from field samples.

The word dramatically was removed.

We now also show the results of sampling two seed lots. This is discussed in the light of what additional information our assay provides.

Reviewer #2:

We thank reviewer #2 for recommending “Guidelines for the single-laboratory validation of qualitative real-time PCR methods-BVL 2016”. Indeed, the document was unknown to us so far. We have read the document and it became clear that reviewer #2 used the criteria formulated there for assessing the manuscript. We do agree that the document is useful and we are aware that there are experiments still to be performed before our assay can be used for certification of soybean seed lots. At the same time, we think that the criteria that were formulated by a committee within the German federal office for consumer protection and food safety (BVL) for assessing methods to detect GM plants before including them in the BVL’s Official Collection of Methods cannot without reservations be applied for publications reporting experimental results. We do want our method to be developed into a standard tool for detection of Diaporthe species in Germany, but this is not our application for registration of this tool yet, rather a report on our current results.

We repeated the analysis with a wider species range (Diaporthe, Fungi, Phythium, Phytophthora, Glycine). We added a couple of sentences in results to describe that using these settings the primer-probe combinations are perfectly suited for what they are needed for. More details about the primer BLAST results are given in a newly written S1 Text. Some unintended targets might limit the geographic range of our assay or possible detection of two different species has to be accepted. Since the goal of our assay is to distinguish between the four species reported here, there does not seem to be a problem with primer specificity.

DNA concentrations are now reported. “Replicates” was replaced with duplicates or triplicates. Additional species were tested.

We agree that the missing sensitivity test is a shortcoming. We have performed tests with dilution series of DNA prepared from the isolates with precisely determined concentrations. These can be used for quantifications of the pathogen. From these curves also the sensitivity can be deduced even though we still cannot fully define the LOD.

Robustness was not performed.

The test for robustness should be performed at some instance to register the assay but development of the assay has not yet progressed so far. Robustness should not a criterion for a publication. None of the previous publications on qPCR detection of Diaporthe pathogens features a test for robustness.

New efficiency tests are provided for part of the primer-probe sets, especially for the new DPCE..

There are many figures and only one Table 4, reporting Cq, no statistical analysis eg mean, SDr and RSDr have been provided and discussed.

Development of our method has not progressed so far yet. We will provide these data in later publications.

Therefore, the partial specificity and low efficiency for some singleplex and duplex methods are not sufficient to consider the quadruplex method reliable and to support the conclusion.

We disagree, see earlier comments. Also, further progress was made in the meantime.

We already commented on this above. We thank reviewer #2 for recommending “Guidelines for the single-laboratory validation of qualitative real-time PCR methods-BVL 2016”. Indeed, the document was unknown to us so far. We do agree that the document is useful but we also think that these criteria should not be applied to a publication.

Reviewer #3:

We thank reviewer #3 for this overall very positive assessment of our study.

My main concern regards the clarification of certain points of the methodologies used and better explanation of the fungal strains sampled.

Abstract: Please identify how many fungal strains of each species were tested for both the target and non-target fungi

We considered adding this information to the abstract but found that it would add considerably to the length of the abstract and decided that this information is not so highly relevant that it should be represented in the abstract.

Introduction:

All four species have previously been identified in southern and south eastern Europe. We now refer to this in the discussion. Mostly we rely on our own identification of the species in central Europe. Mostly so far the species are limited in their spread throughout central Europe because there is little soybean so far. Spread of the fungi in central Europe will, therefore, be accelerated mainly by the increase in soybean production.

Indeed, the fungi grow into the seeds and infected seeds lead to infected new plants. Apart from that there is sporulation on the stems and infected plant residues also are a major source of inoculum. It is now mentioned in the introduction that research is necessary regarding these questions and that our assay will help in answering them.

Materials and Methods:

Were the stem and leaf samples artificially inoculated with the known strains (that is how I interpreted it but it is unclear)?

It is somewhat unfortunate that the reviewer did not provide line numbers. It is not fully clear what the questions refer to. Not sure if our answers meet with the questions. – Yes, the samples were inoculated with the known strains mentioned in Table 1. We changed a few words to make this more clear.

Were the seed naturally infected with known or unknown strains? (this I could not determine from the text, but I believe it was known fungal species but unknown strains)?

Were the strains on the naturally infected seeds diagnosed outside of the RT-PCR assay presented? Such as by the culture techniques or classical PCR methods.

This probably refers to l116ff. We think in this case that a broader explanation than what is provided is not necessary. Since our method of preparing DNA from seeds is destructive, diagnosis with culture techniques is not possible. Classical PCR would not be a true corroboration since it depends on the same principle. So no, no diagnosis outside qPCR. However, we used the same samples as used in our earlier study identifying the strains, so these results should serve as an independent diagnosis.

What is the known genetic diversity of the tested fungi?

Do the strains tested in vivo represent known diversity?

We assumed that our isolates from [4] represent the genetic diversity of the tested fungi in central Europe. This diversity was represented by the strains tested.

What is the likelihood that non-target, non-pathogenic fungi could react with the primers and probes? (can be answered better with in silico methods)

This likelihood is very small. We did a new primer BLAST. This is now described in S1 text. Our claim that our assay distinguishes between D. caulivora, D. eres, D. longicolla, and D. novem was fully corroborated.

We changed the wording in results (l220ff) explaining this. We initially included all sequences from our earlier phylogenetic study but then removed all identical sequences. We hope that our new wording explains this properly.

Results:

Figures 5 - 7 make better sense as supplemental material

We changed several figures. We reduced the number of figures and put some into the supplementary material. Figures 5 -7 were made into one. We hope that this meets with this comment.

This was done with single seeds. The full seed screening methodology still needs to be established. We have now added extra results showing testing of two seed samples and also added the calculated quantification.

Discussion:

Changed the wording from proven to supported.

Reviewer #4:

Title: Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Manuscript: PONE-D-20-38183

Line 34. “…………..the genus Diaporthe (syn. Phomopsis)…………...”

According to the recommendation of reviewer #1 we removed “anamorph Phomopsis”.

Line 36. Check the authority name for D. longicolla - Resolving the Diaporthe species occurring on soybean in Croatia (nih.gov)

Line 89. Check authority names for the fungal names.

Did so. As to our current knowledge, these are all correct.

Lines 113-115. Why were the other species not tested on the stems? Was there seeds inoculated with these four species?

Only stems inoculated with D. longicolla were available. Since seeds were available with natural infections for all four species no artificial inoculations were performed.

Line 157. How is the PCR product (efficiency in %) > 100 for DPCE/DE? (Table 2).

We were not sure either. Question is no longer relevant since the DPCE primer probe set was replaced.

Line 172. Define higher efficiencies.

101.7 % or 98.3 % respectively as shown in Table 2, now also irrelevant because the DPCE primer probe set was replaced.

Part of this is very general criticism. We hope that with all the changes made our results section reads better now. We have added a description of the primer BLAST results. We did additional experiments and have added standard curves for the quadruplex reaction that allow for quantification of the Diaporthe species in a given sample. From these standard curves also detection limits and cut-off values can be deduced, even though the exact LOD still needs to be determined.

See comments above. Describing our experiments we did find it suitable to mention the results of our primer efficiency tests.

Line 281. Table 4. Please list the Cq cut-off values.

We have done an estimate for Cq cut-off values.

We now show an example for testing a full seed sample. A comparison for recovery from single seeds cannot be done, since the seed is destroyed by DNA-preparation and cannot be used for the traditional method. Using the traditional method on a full seed sample was not yet performed.

It cannot be denied that the taxonomic status of D. eres is ambiguous. However, our own results (Hosseini 2020) indicate that in Central Europe (Germany) we are dealing with a single species. In Hosseini 2020 we also discuss the taxonomic issues of all four species tested here. We feel that a discussion on taxonomic issues is not called for in this paper dealing with diagnostics.

Attachment

Submitted filename: Rebuttal Letter.docx

Click here for additional data file.^{(29.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0257225.r003

Decision Letter 1

Ruslan Kalendar

27 Aug 2021

Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

PONE-D-20-38183R1

Dear Dr. Link,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ruslan Kalendar

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer #1:

Just a few minor editorial comments left (based on track change version numbering):

L104: affiliation of Mrs Pertrovic should be added

L224: I suggest to remove this sentence, which is useless

Table 2: the sequence of the reverse primers is usually written in the 5' - 3' direction.

L427: should read SYBR

PLoS One. doi: 10.1371/journal.pone.0257225.r004

Acceptance letter

Ruslan Kalendar

2 Sep 2021

PONE-D-20-38183R1

Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Dear Dr. Link:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Ruslan Kalendar

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Standard curves to determine the efficiency of the primer probe sets DPCL, DPCC, DPCE, and DPCN in singleplex reactions.

(TIF)

Click here for additional data file.^{(2.4MB, tif)}

S2 Fig. Specificity test for each species-specific TaqMan primer-probe set with Diaporthe species.

Specificity test for primer-probe set (A) DPCL, (B) DPCC, (C) DPCE, and (D) DPCN with DNA from D. longicolla, D. caulivora, D. eres, and D. novem (from left to right), respectively.

(TIF)

Click here for additional data file.^{(2.5MB, tif)}

S3 Fig. Screening soybean seeds via the quadruplex real-time PCR assay.

(TIF)

Click here for additional data file.^{(2.4MB, tif)}

S1 Text. Primer BLAST results.

(DOCX)

Click here for additional data file.^{(14.2KB, docx)}

S2 Text. Test of the primer-probe sets in Duplex reactions with both templates.

(DOCX)

Click here for additional data file.^{(15.9KB, docx)}

S1 File. Excel file with multiple datasheets with contents and Cq values from the qPCR experiments reported in this publication.

(XLSX)

Click here for additional data file.^{(68.4KB, xlsx)}

Attachment

Submitted filename: PONE-D-20-38183_reviewer comments.pdf

Click here for additional data file.^{(79.2KB, pdf)}

Attachment

Submitted filename: Rebuttal Letter.docx

Click here for additional data file.^{(29.3KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0257225.ref001] 1.Baird RE, Abney TS, Mullinix BG. Fungi associated with pods and seeds during the R6 and R8 stages of four soybean cultivars in southwestern Indiana. Phytoprotection. 2001; 82:1–11. doi: 10.7202/706210ar [DOI] [Google Scholar]

[pone.0257225.ref002] 2.Sinclair JB. Phomopsis seed decay of soybeans—a prototype for studying seed disease. Plant Disease. 1993; 77:329–334. [Google Scholar]

[pone.0257225.ref003] 3.Sinclair JB. Discoloration of soybean seeds: an indicator of quality. Plant Disease. 1992; 76:1087–1091. [Google Scholar]

[pone.0257225.ref004] 4.Hosseini B, El-Hasan A, Link T, Voegele RT. Analysis of the species spectrum of the Diaporthe/Phomopsis complex in European soybean seeds. Mycological Progress. 2020; 19:455–469. doi: 10.1007/s11557-020-01570-y [DOI] [Google Scholar]

[pone.0257225.ref005] 5.Rehner SA, Uecker FA. Nuclear ribosomal internal transcribed spacer phylogeny and host diversity in the coelomycete Phomopsis. Canadian Journal of Botany. 1994; 72:1666–1674. doi: 10.1139/b94-204 [DOI] [Google Scholar]

[pone.0257225.ref006] 6.Zhang AW, Hartman GL, Riccioni L, Chen WD, Ma RZ, Pedersen WL. Using PCR to distinguish Diaporthe phaseolorum and Phomopsis longicolla from other soybean fungal pathogens and to detect them in soybean tissues. Plant Disease. 1997; 81:1143–1149. doi: 10.1094/PDIS.1997.81.10.1143 [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref007] 7.Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia. 2013; 31:1–41. doi: 10.3767/003158513X666844 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0257225.ref008] 8.Mathew FM, Alananbeh KM, Jordahl JG, Meyer SM, Castlebury LAG, T. J., Markell SG. Phomopsis stem canker: A reemerging threat to sunflower (Helianthus annuus) in the United States. Phytopathology. 2015; 105:990–997. doi: 10.1094/PHYTO-11-14-0336-FI [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref009] 9.Santos JM, Correia VG, Phillips AJL. Primers for mating-type diagnosis in Diaporthe and Phomopsis: their use in teleomorph induction in vitro and biological species definition. Fungal Biology. 2010; 114:255–270. doi: 10.1016/j.funbio.2010.01.007 [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref010] 10.Udayanga D, Liu X, Mckenzie EHC, Chukeatirote E, Bahkali AHA, Hyde KD. The genus Phomopsis: biology, applications, species concepts and names of common phytopathogens. Fungal Diversity. 2011; 50:189–225. doi: 10.1007/s13225-011-0126-9 [DOI] [Google Scholar]

[pone.0257225.ref011] 11.Schena L, Nigro F, Ippolito A, Gallitelli D. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. European Journal of Plant Pathology. 2004; 110:893–908. doi: 10.1007/s10658-004-4842-9 [DOI] [Google Scholar]

[pone.0257225.ref012] 12.Schena L, Li Destri Nicosia MG, Sanzani SM, Faedda R, Ippolito A, Cacciola SO. Development of quantitative PCR detection methods for phytopathogenic fungi and oomycetes. Journal of Plant Pathology. 2013; 95:7–24. [Google Scholar]

[pone.0257225.ref013] 13.Schena L, Hughes KJ, Cooke DE. Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real-time PCR. Molecular Plant Pathology. 2006; 7:365–379. doi: 10.1111/j.1364-3703.2006.00345.x [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref014] 14.Schaad NW, Frederick RD, Shaw J, Schneider WL, Hickson R, Petrillo MD, et al. Advances in molecular-based diagnostics in meeting crop biosecurity and phytosanitary issues. Annual Review of Phytopathology. 2003; 41:305–324. doi: 10.1146/annurev.phyto.41.052002.095435 [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref015] 15.Taylor EJA, Bates J, Kenyon D, Maccaferri M, Thomas J. Modern molecular methods for characterization and diagnosis of seed-borne fungal pathogens. Journal of Plant Pathology. 2001; 83:75–81. [Google Scholar]

[pone.0257225.ref016] 16.Schaad NW, Frederick RD. Real-time PCR and its application for rapid plant disease diagnostics. Canadian Journal of Plant Pathology. 2002; 24:250–258. doi: 10.1080/07060660209507006 [DOI] [Google Scholar]

[pone.0257225.ref017] 17.Zhang AW, Hartman GL, Curio-Penny B, Pedersen WL, Becker KB. Molecular detection of Diaporthe phaseolorum and Phomopsis longicolla from soybean seeds. Phytopathology. 1999; 89(9):796–804. doi: 10.1094/PHYTO.1999.89.9.796 [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref018] 18.Kontz B, Adhikari S, Subramanian S, Mathew FM. Optimization and application of a quantitative polymerase chain reaction assay to detect Diaporthe species in soybean plant tissue. Plant Disease. 2016; 100:1669–1676. doi: 10.1094/PDIS-10-15-1204-RE [DOI] [PubMed] [Google Scholar]

[pone.0257225.ref019] 19.Liu D, Coloe S, Baird R, Pedersen J. Rapid mini-preparation of fungal DNA for PCR. Journal of Clinical Microbiology. 2000; 38:471. doi: 10.1128/JCM.38.1.471-471.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0257225.ref020] 20.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999; 41:95–98. [Google Scholar]

[pone.0257225.ref021] 21.Hu R, Fan C, Li H, Zhang Q, Fu YF. Evaluation of putative reference genes for gene expression normalization in soybean by quantitative real-time RT-PCR. BMC Mol Biol. 2009; 10:93. doi: 10.1186/1471-2199-10-93 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0257225.ref022] 22.Carbone I, Kohn LM. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999; 91:553–556. doi: 10.1080/00275514.1999.12061051 [DOI] [Google Scholar]

[pone.0257225.ref023] 23.Siebert L, Tränkner-Benslimane K. Value chain of soybeans in China and Germany 2020. 11/19/2020:[27 p.]. Available from: https://www.dcz-china.org/en/dcz-publications.html. [Google Scholar]

[pone.0257225.ref024] 24.Petrović K, Riccioni L, Vidić M, Đorđević V, Balešević-Tubić S, Đukić V, et al. First report of Diaporthe novem, D. foeniculina, and D. rudis associated with soybean seed decay in Serbia. Plant Disease. 2016; 100(11):2324. doi: 10.1094/PDIS-03-16-0353-PDN [DOI] [Google Scholar]

[pone.0257225.ref025] 25.Krsmanović S, Petrović K, Ćeran M, Đorđević V, Ranđelović P, Jaćimović S, et al. Diversity of phytopathogenic fungi on soybean seed in Serbia. Ratar Povrt. 2020; 57(3):80–86. doi: 10.5937/ratpov57-27516 [DOI] [Google Scholar]

[pone.0257225.ref026] 26.Walcott RR. Detection of seedborne pathogens. HortTechnology. 2003; 13:40–47. doi: 10.21273/HORTTECH.13.1.0040 [DOI] [Google Scholar]

[pone.0257225.ref027] 27.Ramiro J, Ciampi-Guillardi M, Caldas DGG, de Moraes MHD, Barbieri MCG, Pereira WV, et al. Quick and accurate detection of Sclerotinia sclerotiorum and Phomopsis spp. in soybean seeds using qPCR and seed-soaking method. Journal of Plant Pathology. 2019; 167:273–282. doi: 10.1111/jph.12796 [DOI] [Google Scholar]

PERMALINK

Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean

Behnoush Hosseini

Ralf T Voegele

Tobias I Link

Roles

Abstract

Introduction

Materials and methods

Fungal strains and plant material

Table 1. Diaporthe strains used in this study and their corresponding GenBank accession numbers.

DNA extraction from mycelia

DNA extraction from plant material

Design of TaqMan primer-probe sets

Table 2. TaqMan primer-probe combinations for detection and distinguishing D. longicolla, D. caulivora, D. eres and D. novem.

Real-time PCR

Dilution series of PCR products and genomic DNA

Results

Design of TaqMan primer-probe sets for specific detection of D. longicolla, D. caulivora, D. eres, and D. novem in a multiplex real-time PCR

Fig 1. Primer and probe specificity based on alignment.

Assessing the specificity and efficiency of the TaqMan primer-probe sets

Singleplex reactions

Multiplex reactions

Fig 2. Specificity of the quadruplex real-time PCR assay.

Fig 3.

Standard curves for quantification using the quadruplex real-time PCR assay

Fig 4. Standard curves for quantification of Diaporthe spp. using the quadruplex qPCR assay.

Table 3. Functions and additional information derived from standard curves.

Validation of the quadruplex real-time PCR assay

Infected soybean stems

Fig 5. Validation of the quadruplex real-time PCR assay.

Screening soybean seeds

Fig 6. Sampling soybean seed lots via the quadruplex real-time PCR assay.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Ruslan Kalendar

Roles

Author response to Decision Letter 0

Decision Letter 1

Ruslan Kalendar

Roles

Acceptance letter

Ruslan Kalendar

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases