Effects of diet, BMP-2 treatment, and femoral skeletal injury on endothelial cells derived from the ipsilateral and contralateral limbs

Abstract

Type 2 diabetes (T2D) results in physiological and structural changes in bone, contributing to poor fracture healing. T2D compromises microvascular performance, which can negatively impact bone regeneration as angiogenesis is required for new bone formation. We examined the effects of bone morphogenetic protein-2 (BMP-2) administered locally at the time of femoral segmental bone defect (SBD) surgery, and its angiogenic impacts on endothelial cells (ECs) isolated from the ipsilateral or contralateral tibia in T2D mice. Male C57BL/6 mice were fed either a low fat diet (LFD) or high fat diet (HFD) starting at 8 weeks. After 12 weeks, the T2D phenotype in HFD mice was confirmed via glucose and insulin tolerance testing and echoMRI, and all mice underwent SBD surgery. Mice were treated with BMP-2 (5μg) or saline at the time of surgery. Three weeks post-surgery, bone marrow ECs were isolated from ipsilateral and contralateral tibias, and proliferation, angiogenic potential, and gene expression of the cells was analyzed. BMP-2 treatment increased EC proliferation by 2 fold compared to saline in LFD contralateral tibia ECs, but no changes were seen in surgical tibia EC proliferation. BMP-2 treatment enhanced vessel-like structure formation in HFD mice whereas, the opposite was observed in LFD mice. Still, in BMP-2 treated LFD mice, ipsilateral tibia ECs increased expression of CD31, FLT-1, ANGPT1, and ANGPT2. These data suggest that the modulating effects of T2D and BMP-2 on the microenvironment of bone marrow ECs may differentially influence angiogenic properties at the fractured limb versus the contralateral limb.

Introduction

At present, upwards of 24 million Americans have been diagnosed with T2D, while nearly 57 million more have pre-diabetes. One in three Americans born after 2000 are expected to develop Type 2 diabetes mellitus (T2D).¹ Numerous studies have shown that impaired fracture healing is an established sequelae of the disease in persons with T2D, and those individuals have a 69% increase in fracture risk, with 25.6% of patients having one or more bone healing complications, compared to individuals without T2D.^{2, 3} Clinical studies have shown that diabetic patients have impaired bone healing in long bones, the hip, and even the mandible.^4–6 Another study showed that persons with diabetes were more likely to have fracture-healing complications (malunion, nonunion, delayed union), suggesting that the micro and macro-vascular disease associated with diabetes may be responsible for the increased risk of fracture healing complications,⁷ such as the impaired angiogenic potential of endothelial cells (ECs) to (re)vascularize tissues during wound repair.⁸ Unfortunately, diabetes is often accompanied by angiogenic failure or the inadequate ability of ECs to fulfill their normally required roles (termed EC dysfunction).⁹

While tissue level changes observed in diabetes are well known, the molecular changes in growth factor reductions and their effects on the endothelium are still being studied.⁶ Bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) are the most studied growth factors in this context.^10–12

Aside from studies evaluating BMP-2 action on local (intra fracture) neovascularization during bone regeneration,^{13, 14} to the best of our knowledge, there has not been a study examining the effects of locally administered BMP-2 at the time of fracture surgery (femur) and its angiogenic impacts on ECs isolated from the ipsilateral tibia or the contralateral tibia. Furthermore, an examination of these effects in a T2D model has never been done.

The motivation to study the potential effects of locally administering a bone healing agent in a femoral segmental bone defect (SBD) model and examining the possible impacts to either the ipsilateral or contralateral tibia comes from two of our recently published bone healing spaceflight studies.^{15, 16} Specifically, in Dadwal et al.,¹⁵ we show that this same surgery resulted in significant changes in ipsilateral tibial trabecular bone volume fraction and cortical bone geometry, suggesting that other changes, such as angiogenic properties, could also occur. In another investigation by Zamarioli et al., using this same SBD model, but delivering a different bone healing agent, thrombopoietin, to the femoral defect site, changes were observed in tibial bone parameters. These data suggest that treatment alone or treatment in the context of other physiological changes (spaceflight in the previous study, but T2D here) may result in important functional alterations, in ipsilateral or contralateral tibias. Therefore, although in our recent manuscript,¹⁷ our primary goal was to examine the effects of BMP-2 treatment for healing a femoral SBD bone healing in a high fat diet (HFD)- induced T2D model, we also collected the ipsilateral and contralateral tibia for the present study.

The purpose of this study was to investigate the effects of local treatment of BMP-2 at the fracture site on bone marrow derived ECs (ECs) isolated from the ipsilateral and contralateral tibia in T2D-induced mice. Here we fed male C57BL/6 mice either a low fat diet (LFD) or HFD, and a critical size defect (CSD) surgery was performed on the right femur in all of the mice. CSD models have been established to study non-union and significant bone defects, particularly those that do not heal during the lifetime of an animal. All mice had collagen sponges implanted at the time of surgery, half soaked with BMP-2 and half soaked with saline. The ipsilateral (right) tibia and the contralateral (left) tibia were collected 3 weeks post-surgery for the isolation of ECs. The proliferation and angiogenic potential of the ECs were then analyzed.

Methods

Animal model of Type 2 Diabetes (T2D)

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at the Indiana University School of Medicine (IUSM) and were in compliance with the National Institutes of Health guide on the care and use of laboratory animals. Mice were bred and housed in the animal facility at the IUSM. The IUSM animal facility maintains a 12 hour/12 hour, light/dark cycle and is a specific pathogen free facility.

For this study, thirty-nine (n = 39) Tie2-CreERT2; Td-Tomato (Tie2CreERT2+) male mice were used. The generation of the Tie2CreERT2+ mice was previously reported.¹⁸ These mice were crossed with Rosa26-TD-Tomato mice (B6; 129S6-Gt (ROSA) 26Sortm9 (CAG-tdTomato) Hze/J stock number: 007905, The Jackson Laboratory). Mice were backcrossed more than 10 generations onto the C57BL/6J background before being used in these studies.

Supplemental Figure 1 illustrates the overall timeline of these studies and Supplemental Figure 2 provides a flow chart showing the distribution of mice into respective treatment groups. Briefly, mice were started on Rodent Diet with 10 kcal% fat (Research Diets Inc., New Brunswick, NJ), referred to as low-fat diet (LFD), at 6 weeks of age. After acclimating to the LFD, EchoMRI^™-100H Body Composition Analyzer (EchoMRI, LLC, Houston, TX) was used to measure baseline total, lean, and fat body mass followed by baseline glucose tolerance testing (GTT) at 7 weeks of age. One week later, baseline insulin tolerance testing (ITT) was performed. To complete GTT, mice were fasted for 6h and subsequently intraperitoneally injected with 2g/kg glucose. Blood was collected from the tail at 0, 10, 20, 30, 60, and 120 minutes post injection, and serum glucose was measured. To perform ITT, mice were fasted for 2 hours and subsequently injected with 0.75 IU/kg Humulin R insulin (Eli Lilly, Indianapolis, IN). Blood was collected every 15 minutes for one hour, and serum glucose concentration was measured. After baseline testing, mice were randomly separated by cages into 2 groups, one group continued to receive LFD (n=19), and the second group was given a high fat diet (HFD, Research Diets Inc., n=20) of 45 kcal% fat. Mice remained on the diet for 12 weeks to develop the T2D phenotype. In order to induce Cre-recombinase and Td-Tomato expression in Tie2+ ECs, as we previously reported,¹⁷ mice were administered intraperitoneal (IP) tamoxifen injections after 11 weeks on LFD or HFD, at a dose of 10 mg/kg body weight for three consecutive days. As a confirmation for the T2D phenotype, GTT, ITT, and echoMRI were repeated after 12 weeks on LFD/HFD.

Segmental bone defect creation and BMP-2 treatment

Surgery was performed at 22 weeks of age with aseptic conditions maintained for all surgical procedures. The LFD and HFD fed animals were randomly further divided into saline treated (Aqualite System, Hospira. Inc, Lake Forest, IL) or recombinant human BMP-2 (BMP-2) treated (Medtronic Sofamor Danek Inc, Memphis, TN) mice at the time of surgery. In preparation for surgery, mice were anesthetized with isoflurane (Patterson Veterinary, Greeley, CO), and ophthalmic ointment (Major Pharmaceuticals, Indianapolis, IN) was applied to each eye. The right hindlimb was shaved and cleaned with ethanol/betadine scrubs. After a 1cm incision was made laterally over the right upper hindlimb, blunt dissection was carried down to expose the femur, and the muscle was stripped in the diaphyseal region. Next, the knee was flexed, and a 27-gauge needle was used to split the patellar tendon, which was then manually advanced between the femoral condyles into the femoral intramedullary canal. A sterile Dremel rotary cutting tool (DREMEL, Racine, WI) was used to remove a 2mm intercalary segment from the femoral diaphysis, and the needle was advanced through a poly(propylene fumarate)/tricalcium phosphate synthetic scaffold (2 mm × 1 mm ID/2 mm ED, 0.7 mm side port to allow for fluid flow) and through the greater trochanter. To stabilize the scaffold in place, the needle was bent onto itself and was pulled in an anterograde direction tautly against the greater trochanter. Type 1 collagen membranes (RCM6 Resorbable Collagen Membrane, ACE, Brockton, MA) were treated with saline (negative control) or 5 μg of BMP-2 and were placed around the femoral diaphysis. The membrane was fixed into place with a 3–0 polyglycolic acid suture (J215H, Ethicon, Somerville, NJ). Muscle tissue and skin were then closed with 3–0 polyglycolic acid suture and standard 7mm wound clips (RF7CS, Braintree Scientific, Braintree, MA), respectively. X-ray images were used to confirm alignment of the pin/scaffold at the time of surgery and then were taken every two weeks to monitor bone healing. Mice were euthanized three weeks post-surgery for EC studies.

Isolation and proliferation analysis of endothelial cells

As previously described,¹⁹ endothelial cells were isolated from the ipsilateral and contralateral tibia bone marrow, with slight modifications. In brief, epiphyses and soft tissues were removed, whole bone marrow was extracted by centrifuging bones for 2 minutes at 14,000 × g in 750 μL of α-MEM (Gibco, Grand Island, NY) with 10% fetal bovine serum (FBS, Biowest, Riverside, MO, USA). Pelleted cells were resuspended in Complete EC Growth Media supplemented with 5% fetal bovine serum (FBS), EC Growth Supplement, and 1% Penicillin/Streptomycin (ScienCell, Carlsbad, CA). Whole bone marrow cells were seeded in a 12-well plate coated with 4 μg/mL fibronectin (Thermo Fisher Scientific, Waltham, MA) in Complete EC Growth Media and cultured for seven days. These culture conditions result in the enrichment of ECs after 7 days and are the ECs used in the assays below. Supplemental Figure 3 and our previous manuscripts,¹⁷ show the characterization of these ECs, including expression of Td-Tomato and CD31.

ECs were seeded in a 96-well plate at 5 × 10³ cells/well to assess proliferation. Cells were cultured for 24–48 hours and then fixed with 5% neutral buffered formalin (NBF) at room temperature for 20 min, stained with 0.05% crystal violet for 30 minutes, and washed under tap water before drying overnight. Images were taken with EVOS® FL Cell Imaging System and counted using ImageJ.1.52a software.

Vessel-like structure formation analysis

EC vessel-like structure formation was assessed as previously described with a Matrigel vessel-like structure assay.²¹ Briefly, Matrigel basement membrane matrix (Corning®, Corning, NY) was added to 96-well plates at 50 μl/well, and allowed to polymerize for 45 minutes at 37°C. ECs were plated on the Matrigel at a density of 10,000 cells/well. Images were obtained after cells were cultured for 8h at 37°C and 5% CO₂. The number of nodes and meshes were analyzed by the automated Angiogenesis Analyzer plugin using ImageJ.1.52a (NIH). The vessel-like structure formation was manually assessed by three independent readers (blinded to experimental treatment, diet, and tibia) using the Simple Neurite Tracer plugin within the ImageJ.1.52b Fiji software.²² Supplemental Figure 4 provides an annotated example of the measurements made.

Gene expression

RNeasy Mini kit (QIAGEN, Hilden, Germany) was used to isolate RNA from ECs. Next, cDNA was made using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Gene expression was analyzed using qPCR utilizing Power SYBR^™ Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA) and the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA). The analysis was performed on the following genes (Table 1): Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), (internal control), CD31, Fms Related Tyrosine Kinase 1 (FLT-1), Angiopoietin 1 (ANGPT1), and Angiopoietin 2 (ANGPT2). The 2^−ΔΔCT method was used to calculate relative gene expression.

Table 1.

Quantitative PCR primers used in the study.

Gene	Sequence (5’ → 3′)
	Forward	Reverse
GAPDH	CGTGGGGCTGCCCAGAACAT	TCTCCAGGCGGCACGTCAGA
CD31	ACGCTGGTGCTCTATGCAAG	TCAGTTGCTGCCCATTCATCA
FLT-1	CCACCTCTCTATCCGCTGG	ACCAATGTGCTAACCGTCTTATT
ANGPT1	CACATAGGGTGCAGCAACCA	CGTCGTGTTCTGGAAGAATGA
ANGPT2	CCTCGACTACGACGACTCAGT	TCTGCACCACATTCTGTTGGA

Statistical analysis

Statistical analyses were performed using GraphPad Prism (version 8.0.0 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com). ANOVA followed by Bonferroni’s post-hoc multiple-comparisons test was done to evaluate the significance of differences found between all groups when there were more than two present, whereas a Student’s t-test was performed to evaluate the significance of a difference found between two groups. Data are represented as mean ± standard deviation (SD), and p ≤ 0.05 was established as statistical significance. All experiments were repeated with 3 or more biological replicates, and each biological replicate was the average of 3–4 technical replicates (wells). A sample size of 3 was selected to minimize the number of mice required for these studies, while still allowing for significant differences to be detected. This sample size is consistent with that reported by others^23–26 completing similar in vitro angiogenesis studies, as well as our recently reported studies.¹⁷ The latter standard deviations were used for a power calculation, which suggested that a sample size of 3 would allow for 80% power to detect a significant difference with an alpha of 0.05.²⁷

Results

Development of T2D-like phenotype in mice

The mice that were fed a HFD for 12 weeks developed a T2D-like phenotype (Figure 1). The HFD group of mice gained a considerable amount of weight over time, compared to LFD group (Figure 1A). EchoMRI shows that HFD mice exhibited a significant increase in total body mass, especially in fat composition, as compared to LFD mice (Figures 1B and 1C). Baseline blood glucose levels were measured for a total of 39 animals as reference for GTT and ITT, respectively. Twelve weeks later, GTT and ITT were repeated. HFD mice developed glucose and insulin resistance (Figures 1D and 1F). The area under the curve (AUC) for GTT and ITT data further demonstrates this by showing HFD mice, on average, had a higher net blood glucose level and total insulin release during the test (Figure 1E and 1G). Together, these data indicate that, as expected, HFD for 12 weeks induced a T2D-like phenotype in male C57BL/6 mice.

Figure 1.

T2D-like phenotype induced in mice fed a HFD. Average body weight of 19 LFD and 20 HFD fed mice over the course of 22 weeks (A). Mice underwent echoMRI imaging to measure total body mass (B) and fat mass (C). GTT (D) and ITT (F) data showing baseline blood glucose levels for 39 mice. Mice were maintained on a LFD (n=19) or were switched to a HFD (n=20) and GTT (D) and ITT (F) were repeated 12 weeks later. Area under the curve (AUC) for GTT (E) ITT (G) data were calculated. Data are expressed as mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Characterization of ECs and induction of TdTomato expression

To examine the behavior of ECs at local (ipsilateral tibia) and distant anatomical sites (contralateral tibia) during the bone healing process, we isolated ECs three weeks after surgery. Briefly, tamoxifen injection resulted in induction of TdTomato expression in ECs that express Tie2-specific Cre recombinase (Supplemental Figure 3). The ECs retained TdTomato expression following the formation of vessel-like structures. In this study, ECs were characterized based on induced expression of TdTomato, their expression of CD31, and their functional ability to form vessel-like structures on Matrigel matrix.

EC Proliferation from ipsilateral and contralateral tibia bone marrow

There were no significant differences in the proliferation of ipsilateral tibia ECs, irrespective of diet or treatment. However, a significant increase in contralateral tibia EC proliferation was observed in the LFD, BMP-2 treated group as compared to the LFD, saline group. BMP-2 treatment did not alter contralateral tibia EC proliferation for the HFD group (Figure 2).

Figure 2.

Proliferation of ECs isolated from the ipsilateral (A) and contralateral (B) tibia. Data are expressed as the mean ± SD. *p< 0.05.

Vessel-like structure formation of ECs

The angiogenic potential of ECs was evaluated by vessel-like structure formation (Figure 3). Vessel-like structure formation was assessed by numbers of nodes, number of meshes, and number of vessel-like structure paths, as well as vessel-like structure path length. As shown in Figure 3, in HFD mice, BMP-2 treatment significantly increased ipsilateral and contralateral EC vessel-like structure formation for all but 2 parameters analyzed (no significant change was detected in the 2 parameters not following this trend). On the other hand, in LFD mice, BMP-2 treatment significantly reduced ipsilateral and contralateral EC vessel-like structure formation for all but 1 parameter analyzed, which was not significantly different from saline treatment.

Figure 3.

Angiogenesis parameters associated with ECs isolated from the ipsilateral (A, C, E, G) or contralateral tibia (B, D, F, H). The number of nodes (A, B), number of meshes (C, D), number of paths (E, F), and total path length (G, H) were quantified (n=3/group). Data are expressed as the mean ± SD. *p< 0.05, **p<0.01, ***p< 0.001, ****p<0.0001.

ECs gene expression analysis

Expression of CD31, FLT-1, ANGPT1, and ANGPT2 mRNA was examined in ECs isolated from ipsilateral as well as contralateral tibia (Figure 4). For the ipsilateral tibia, a significant increase in the expression of FLT-1, ANGPT1, and ANGPT2 was observed in the LFD group treated with BMP-2, compared with saline treatment (Figure 4C, 4E, and 4G). A similar trend was seen in the LFD, contralateral tibia group, where the BMP-2 treatment significantly increased the expression of CD31 and FLT-1 (Figure 4B and 4D). Likewise, in the HFD, contralateral group, BMP-2 also significantly increased the expression of FLT-1 and ANGPT1 (Figure 4D and 4F). However, a significant decrease in ANGPT1 and ANGPT2 was observed in ECs isolated from the contralateral tibia of LFD mice treated with BMP-2 (Figure 4F and 4H). BMP-2 treatment also decreased the expression of ANGPT1 and ANGPT2 in ECs isolated from the ipsilateral tibia of HFD mice (Figure 4E and 4G).

Figure 4.

Real-time PCR analysis of ECs isolated from the ipsilateral (A, C, E, G) or contralateral tibia (B, D, F, H). Relative mRNA expression was measured and calculated for the following genes: CD31 (A, B), FLT-1 (C, D), ANGPT1 (E, F), and ANGPT2 (G, H). LFD saline control expression was set to 1.0 and expression in all other samples are shown relative to the LFD saline control (n=3/group). Data are expressed as mean ± SD. *p< 0.05 and **p<0.01.

Discussion

In this study, we examined the angiogenic potential of ECs isolated from ipsilateral and contralateral tibia of HFD and LFD mice subjected to a femoral CSD surgery with BMP-2 or saline treatment. Angiogenesis was evaluated by EC proliferation, vessel-like structure formation, and expression of key angiogenic genes (CD31, FLT-1, ANGPT1, and ANGPT2). The role of these genes on angiogenesis has been previously described.^{22, 28–31}

As expected, we confirmed that 12 weeks of HFD results in a T2D-like phenotype and impaired bone healing in C57BL/6 male mice. We also confirmed that BMP-2 improved bone healing of CSDs in both LFD and HFD mice. Thus, this model recapitulates many aspects of diet-induced diabetes in humans. Important to these studies, microvascular injury is expected in up to 80% in T2D patients.²⁵ Therefore, in vivo, HFD should impair vessel formation over time.^32–34 However, when cells are removed from the HFD microenvironment and cultured in vitro, changes can be seen. Indeed, previous studies demonstrated that ECs isolated from HFD mice exhibited increased vessel-like structure formation in vitro compared to those isolated from LFD mice.^32–34 Here, we are focused on examining what happens to both the ipsilateral and contralateral tibia three weeks following injury to the ipsilateral femur. In vivo, the microenvironment of the ipsilateral limb may be different from the contralateral limb, and the microenvironments of both of these limbs will likely be different from that observed in the more distal forelimbs and other organs, which are provided blood after the exchange in the heart. Therefore, examining how these cells behave once removed from their microenvironment can provide clues as to functional changes these cells have experienced.

Here we observed similar patterns in vessel-like structure formation in ECs isolated from the ipsilateral and contralateral tibia for matched treatment (saline or BMP-2) and matched diet (LFD or HFD). In general, ECs isolated from saline-treated, LFD mice had enhanced vessel-like structure formation compared to ECs isolated from saline-treated, HFD mice. In LFD mice, BMP-2 treatment typically reduced vessel-like structure formation, whereas in HFD mice, BMP-2 treatment typically increased vessel-like structure formation. Additionally, it appears that at locations nearer to the injury site (ipsilateral tibia), with HFD, BMP-2 delivered at the time of surgery modifies EC function even three weeks post-surgery to improve vessel-like structure formation compared to that observed in the more distal, contralateral tibia, which was not seen in LFD ECs. These microenvironment-dependent actions of BMP-2 on EC function have also been reported by others.²¹

Interestingly, as we recently reported,¹⁷ in these same mice, complete union was observed in 10/10 or 100% of BMP-2 treated mice on HFD, whereas complete union was only observed in 6/9 or 66.7% of BMP-2 treated mice on LFD. In saline treated mice, irrespective of diet, all of the femurs failed to heal. This finding was somewhat unexpected given that impaired fracture healing is a well-known complication in patients with T2D.^{4, 5, 7, 35} While more work is required to better understand this finding, our current explanation is that fracture healing could be improved 3 weeks post-surgery in HFD mice treated with BMP-2 as compared to LFD mice treated with BMP-2 because of the synergistic effect of BMP-2 and a higher body weight. Specifically, the HFD mice have a higher body weight/body mass (Figures 1A&B) and weight bearing is known to improve fracture healing.^36–38

We also reported¹⁷ that in unhealed bones, in vivo measured vessel parameters were significantly reduced at the fracture site. These in vivo findings appeared to be consistent with respect to BMP-2 treated mice where healing potential exists. Specifically, in BMP-2 treated mice, those on LFD typically displayed reduced vessel-like formation (and 1/3 did not heal) compared to those on HFD (all healed), which is also consistent with the idea that impaired angiogenesis can result in impaired fracture healing.^6–9 Of note, all of the previous in vivo data, as well as this in vitro data, were from mice that were 3 weeks post-surgery. While it is formally possible that healing could occur over time in the mice that did not heal, based on our historical experience with this model,^{15, 37} since this is a critical sized defect, we do not believe the saline-treated mice will ever heal, and since robust healing has not initiated in the LFD BMP-2 treated mice that did not heal, we would not predict those to heal even with more time. That said, it may be possible that temporal changes would be observed in angiogenesis and/or fracture healing based on diet and/or treatment. Therefore, in ongoing studies, we are investigating the quality of the bone repair after longer durations post-surgery (6 and 12 weeks post-surgery) and will also be assessing how angiogenesis at the fracture site changes over time.

CD31 is also known as platelet endothelial cell adhesion molecule-1 (PECAM-1). It participates in the regulation of leucocyte detachment, T-cell activation, platelet activation, and angiogenesis, all of which are critical to the endothelial vascular pathogenesis.^{39, 40} Related to our studies, CD31 expression is known to increase proliferation.⁴¹ Examination of our proliferation data (Figure 2) along with our CD31 mRNA expression data (Figure 4A and 4B) reveals similar trends with respect to significant changes. Indeed, a significant increase in the number of crystal violet positive cells and CD31 mRNA expression was observed in ECs isolated from BMP-2 treated, LFD contralateral tibia compared to all other groups. Our data are also consistent with findings demonstrating that BMP-2 increases EC proliferation up to 67% compared to untreated ECs.⁴² Thus, it appears that in the absence of local injury and HFD conditions, BMP-2 stimulates both CD31 expression and EC proliferation.

Vascular endothelial growth factor A (VEGF-A) is known to regulate angiogenesis through the activation of two receptors, FLT-1/VEGFR-1 and FLK1/VEGFR2.⁴³ Due to limitations in available mRNA, here we restricted the analysis to the expression of FLT-1. Of note, FLT-1 can act as a negative regulator of angiogenesis, especially in embryos^43–45. However, under other conditions, FLT-1 acts as a positive regulator for angiogenesis and EC migration.^{30, 46, 47} Our data confirm previous findings where FLT-1 was demonstrated to promote the stability of the vessel branch, but also to restrict EC migration to avascular regions.⁴¹ As we see in our study, regions where no damage to local vascular ECs occurred (contralateral/HFD tibia) resulted in increased FLT-1 expression and increased vessel-like formation/stability. An opposite trend was observed in ECs isolated from the ipsilateral tibia of LFD mice, where a 4-fold increase in FLT-1 expression corresponded with a significant decrease in vessel-like structure formation. This might be attributed to a local avascular environment due to vascular interruption from the femoral injury. In future studies, examination of FLT-1 and FLK1, as well as their downstream signaling molecules, would be critical to better understand whether BMP-2 and diet impact tip and/or stalk cell number and/or their ability to direct vessel formation.

The most exhaustively studied angiopoietins are ANGPT1 and ANGPT2. ANGPT1 is a critical player in vessel maturation, and it mediates migration, adhesion, and survival of ECs. On the other hand, ANGPT2 disrupts the connections between the endothelium and perivascular cells and promotes cell death and vascular regression. Yet, in conjunction with VEGF, ANGPT2 promotes neovascularization. Although in many instances ANGPT1 and ANGPT2 act as agonist/antagonist,⁴⁸ our data demonstrate that ANGPT1 and ANGPT2 expression follows similar trends based on treatment, diet, and tibia from which ECs were isolated. This trend may be explained by the fact that our bone marrow ECs are heterogeneous in nature and, likely contain a mixture of ECs and perivascular cells, both of which express CD31 and Tie2,^{49, 50} which we used to characterize our cells. Further work characterizing these subpopulations would be required to formally test the possibility that subpopulations of cells can differentially express ANGPT1 and ANGPT 2.

In conclusion, we used a fracture healing, T2D model to examine the angiogenic potential of ECs isolated from the ipsilateral and contralateral tibia. Here we show that three weeks following femoral injury, EC function, in terms of in vitro vessel-like structure, was similar for cells isolated from ipsilateral and contralateral tibia. We also show that BMP-2 differentially impacts ECs isolated from LFD and HFD mice, which may indicate a temporal effect based on bone healing progression. Importantly, our data suggest that irrespective of treatment type, it is critical to take into consideration the disease state and healing progression when assessing angiogenic properties. With our aging population and the increasing incidence of T2D, understanding the complex relationship between diet, fracture healing, and angiogenesis will be critical to identifying novel therapies to improve fracture healing.