Abstract
Saccharomyces cerevisiae proteins Cdc4 and Cdc20 contain WD40 repeats and participate in proteolytic processes. However, they are thought to act at two different stages of the cell cycle: Cdc4 is involved in the proteolysis of the Cdk inhibitor, Sic1, necessary for G1/S transition, while Cdc20 mediates anaphase-promoting complex-dependent degradation of anaphase inhibitor Pds1, a process necessary for the onset of chromosome segregation. We have isolated three mutant alleles of CDC4 (cdc4-10, cdc4-11, and cdc4-16) which suppress the nuclear division defect of cdc20-1 cells. However, the previously characterized mutation cdc4-1 and a new allele, cdc4-12, do not alleviate the defect of cdc20-1 cells. This genetic interaction suggests an additional role for Cdc4 in G2/M. Reexamination of the cdc4-1 mutant revealed that, in addition to being defective in the onset of S phase, it is also defective in G2/M transition when released from hydroxyurea-induced S-phase arrest. A second function for CDC4 in late S or G2 phase was further confirmed by the observation that cells lacking the CDC4 gene are arrested both at G1/S and at G2/M. We subsequently isolated additional temperature-sensitive mutations in the CDC4 gene (such as cdc4-12) that render the mutant defective in both G1/S and G2/M transitions at the restrictive temperature. While the G1/S block in both cdc4-12 and cdc4Δ mutants is abolished by the deletion of the SIC1 gene (causing the mutants to be arrested predominantly in G2/M), the preanaphase arrest in the cdc4-12 mutant is relieved by the deletion of PDS1. Collectively, these observations suggest that, in addition to its involvement in the initiation of S phase, Cdc4 may also be required for the onset of anaphase.
Proteolytic degradation plays an important role in cell cycle progression. The initiation of S phase, the onset of anaphase, and the final exit from mitosis are three cell cycle transitions for which involvement of proteolysis has been studied in some detail. Ubiquitin-dependent destruction of the Cdk inhibitor Sic1 is essential for the initiation of S phase. The ubiquitination of phospho-Sic1 is catalyzed by SCFCdc4, a ubiquitin-ligase (E3) complex, comprising Skp1, Cdc53 (or cullin), and F-box-containing Cdc4 (12, 27, 39, 44, 48). These subunits appear to have distinct functions: Cdc34 acts as an E2 enzyme; Cdc53 is a scaffold protein for SCF (34, 51); and Cdc4, a WD40 repeat-containing protein, is responsible for docking specific substrates into this E3 complex (12, 44). Cdc4 is also required for Cdc6 proteolysis in late G1, S, and M phases (11, 35). The target specificity of SCF appears to be determined by the F-box-containing adapter proteins such as Cdc4, Grr1, and Met30. The SCF complex which contains Grr1 instead of Cdc4 targets G1 cyclins Cln1 and Cln2 (3) and the Cdc42 effector Gic2 (18), whereas the complex with Met30 ubiquitinates the tyrosine kinase Swe1 (20).
Proteolysis is also essential for the initiation of nuclear division, which requires another E3 enzyme called anaphase-promoting complex (APC) (reviewed in reference 15), also known as cyclosome (46). This is supported by the observation that temperature-sensitive (ts) mutants carrying mutations in three genes encoding APC components, CDC16, CDC23, and CDC27 (17, 23, 24, 47, 53), are arrested prior to nuclear division (14). The APC targets a number of proteins for proteolytic degradation in mitosis and G1: the anaphase inhibitors Pds1 (6) and Scc1 (29), mitotic cyclins like Clb2 (16, 17), and mitotic spindle-associated protein Ase1 (19). However, it is not clear what activates or regulates the initiation of their proteolysis at specific stages of mitosis.
Cdc20, which belongs to a family of WD40 (also known as β-transducin) proteins (31), has been implicated in the regulation of proteolysis and is essential for the chromosome segregation at the onset of anaphase. The cdc20-1 mutant is arrested with duplicated DNA, a short spindle, and an undivided nucleus, a phenotype very similar to that of cdc16, cdc23, and cdc27 mutants (14, 26, 40). For some time, CDC20 was thought to be involved in the regulation of microtubule depolymerization because the cdc20-1 ts mutant accumulates thickened spindles at the restrictive temperature (33, 40). Recent evidence, however, suggests that CDC20 function may not be required for spindle elongation (26); instead, it is essential for the regulation of the APC-dependent proteolysis (26, 49). Cdc20-related proteins have now been identified in other organisms: fizzy and fizzy-related in Drosophila melanogaster, p55CDC in mammalian cells (50), and slp1+ in fission yeast (28). fizzy is required for the degradation of both cyclins A and B during mitosis (9, 42), while fizzy-related is involved in down-regulating mitotic cyclins in interphase (43). Hct1/Cdh1, the Cdc20 homolog in budding yeast, has been implicated in Clb2 degradation in G1, but it is not essential for viability (38, 49).
To identify genes that functionally interact with CDC20, we conducted a second-site suppressor screen and identified three alleles of CDC4 which alleviate the nuclear division defect of the cdc20-1 mutant. We find that the previously characterized cdc4-1 mutant, the cdc4Δ mutant, and additional cdc4 ts mutants, isolated by PCR mutagenesis, all exhibit both G1/S and G2/M defects. The inability of the new cdc4 mutants to properly initiate anaphase is not due to the accumulation of Sic1, resulting from incomplete degradation during G1/S transition. Instead, the G2/M arrest in one of the newly isolated cdc4 mutants is relieved by the deletion of the PDS1 gene, allowing the mutant to undergo anaphase. Thus, we have uncovered an essential function of CDC4 during G2/M transition, which may be linked to the APC activity required for the onset of anaphase.
MATERIALS AND METHODS
Yeast media and reagents.
All strains used in this study were haploid (unless otherwise stated) and were derived from the wild-type strain W303. Cells were grown in standard yeast extract-peptone or selective medium supplemented with 2% glucose, raffinose, or raffinose-galactose. To obtain synchronized cultures in G1 or early S phase, cells were treated with α-factor (1 μg/ml for bar1 strains) or hydroxyurea (HU; 15 mg/ml), respectively.
Strains and plasmids.
The detailed genotypes of various strains used in this study are shown in Table 1. CDC4 was cloned by transforming a low-copy plasmid library into the cdc4-10 mutant and isolating plasmids that rescued the ts phenotype at 37°C. The shortest DNA fragment from a plasmid which rescued both cdc4-10 and cdc4-1 contained the full-length CDC4 gene. A fragment of about 3.2 kb, consisting of an 0.75-kb 5′ untranslated region, a 2.3-kb coding sequence, and an 0.2-kb 3′ untranslated region, was cloned into a CEN plasmid to obtain pUS456.
TABLE 1.
Strains used in this study
| Strain | Genotype | Source |
|---|---|---|
| K699 | MATa ade2-1 leu2-3,112 his3-11 trp1-1 ura3 | K. Nasmyth |
| US104 | MATa cdc4-1 leu2-3,112 his3-11 trp1-1 ura3 | K. Nasmyth |
| US504 | MATa cdc34-2 leu2-3,112 his3-11 trp1-1 ura3 | K. Nasmyth |
| US581 | MATa sic1Δ::LEU2 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US661 | MATa cdc4-10 cdc20-1 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US708 | MATa cdc4-1 cdc20-1 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US694 | MATa cdc20-1 leu2-3,112 his3-11 trp1-1 ura3 | K. Nasmyth |
| US701 | MATa cdc4-10 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US893 | MATa cdc4Δ::URA3 leu2-3,112 his3-11 trp1-1 pGAL-CDC4/TRP1/CEN | This study |
| US1198 | MATa cdc4Δ URA3 leu2-1,112 his3-11 trp1-1 pcdc4-12/TRP1/CEN | This study |
| US1427 | MATa pds1Δ::LEU2 cdc4Δ::URA3 his3-11 pcdc4-12/TRP1/CEN | This study |
| US1433 | MATa cdc4-12 cdc20-1 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US1678 | MATa cdc20-1 sic1Δ::LEU2 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US1679 | MATa cdc4-10 cdc20-1 sic1Δ::LEU2 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US1680 | MATa cdc4-10 sic1Δ::LEU2 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US1777 | MATa cdc34-2 cdc20-1 leu2-3,112 his3-11 trp1-1 ura3 | This study |
| US1778 | MATa cdc4Δ::URA3 sic1Δ::LEU2 his3-11 trp1-1 pGAL-CDC4/TRP1/CEN | This study |
GAL-CDC4 (pUS457) was constructed by triple ligation of a 180-bp BamHI-ClaI PCR fragment, a 2.8-kb ClaI-SphI fragment (SphI is from the vector) from pUS456, and the GAL1-10 promoter in a TRP1-marked CEN vector. GAL-myc3-CDC4 was constructed by inserting 3× c-myc sequence at the N-terminal BamHI site in frame with the CDC4 sequence in pUS457. The GAL-SIC1 construct and the sic1Δ strain were generously provided by Sara Zaman. The SIC1-myc3 construct was made by an in-frame insertion of a 3× c-myc cassette into a NotI site created immediately before the stop codon. When introduced into a sic1Δ strain, the SIC1-myc3 construct (on a CEN plasmid) allowed the mutant cells to grow as well as the wild-type cells (see Fig. 3B), suggesting that the epitope-tagged Sic1 was fully functional.
FIG. 3.
Suppression of cdc20-1 is not due to Sic1 protein accumulation. (A) Sic1 protein levels in the wild-type strain and the cdc4-1, cdc4-10, cdc4-12, and cdc34-2 mutants. The cells transformed with a plasmid carrying SIC1-myc3 were synchronized by HU treatment for 3 h at 24°C, shifted to 35°C for 1 h, and then released at 35°C. The DNA content, spindle morphology and Sic1 protein levels were analyzed. The progression through the cell cycle and the Sic1-degradation kinetics are very similar in the wild type and in cdc4-10 cells. cdc4-1 and cdc4-12 mutants are slower in transiting from G2/M to G1 and are arrested with a mixture of G1/S and G2/M phenotypes, while the cdc34-2 strain does not show a G2/M defect and is arrested quite uniformly in G1/S. cdc4-1, cdc4-12, and cdc34-2 strains are defective in Sic1 degradation upon release from HU. For spindle morphology, cells were classified into three categories: those with single asters (no spindle), those with short spindles (undivided nucleus), and those with anaphase spindles (spindles extended between the two well-separated nuclei). Numbers to the right of each FACScan graph and above the lanes of each gel are times (in minutes). (B) The SIC1-myc3 construct is functional in vivo. Equal numbers of cells from the sic1Δ strain, the sic1Δ strain carrying the native promoter-driven SIC1-myc3 (on a CEN vector), and the wild-type (wt) strains were plated on glucose plates and incubated at 24°C for 1 day. The photomicrographs show a representative section from each plate. SIC1-myc3 restores the growth of sic1Δ cells to the wild-type level. (C) The cdc4-10 cdc20-1 sic1Δ triple mutant grows better than the cdc20 sic1Δ double mutant at 30°C, indicating that the suppression is not due to accumulation of the Sic1 protein. A deletion of the SIC1 gene results in generally poor growth so that cdc4-10 cdc20-1 sic1Δ and cdc20-1 sic1Δ mutants are inviable at 35°C. cdc4-10 does not suppress sic1Δ, as sic1Δ and cdc4-10 sic1Δ mutants both grow at about the same rate.
The cdc4Δ strain was made by a one-step gene disruption (37). The CDC4 disruption plasmid (pUS476) consists of a 0.7-kb fragment from pUS456 (from the KpnI site in the vector to the ClaI-site in the coding region) and 225 bp of the 3′ coding region from HindIII to PstI, interrupted by the 1.1-kb URA3 gene in pBluescript. A haploid bar1Δ strain, carrying a GAL-CDC4 plasmid, was transformed with a KpnI-BamHI fragment from pUS476, and Ura+ transformants that were alive on the galactose plate but nonviable on the glucose plate were selected. Southern blot analysis was done to confirm that the integration had occurred at the CDC4 locus. One such transformant (US893) was used for further experiments.
Isolation of ts cdc4 mutants.
Low-fidelity PCR was used to mutagenize the WD40 region with primers USPY25 (5′GGGCTGATGACAAAATGATCA3′) and USPY26 (5′CCGTAGATTATAGATGTTGAA3′) in four reactions, each with one of the deoxynucleoside triphosphates reduced in a 1:5:5:5 ratio. The PCR products of all four reactions were pooled. The gap plasmid was obtained by dropping out a 0.85-kb fragment between NcoI and XbaI from pUS456. The PCR products and the gap plasmid overlap by about 100 bp at either end. The pooled PCR products and the gap plasmid were cotransformed into US893 and plated on Leu− Gal+ plates at a density of about 1,000 colonies per plate. The transformants were then replica plated on Leu− Glu+ plates at 23 and 37°C. Plasmids from the ts candidates were isolated and retransformed into US893 to confirm that they carried a ts cdc4 allele. Approximately 31,000 clones were screened, and 20 ts mutants were isolated. The ts alleles were maintained on a CEN plasmid in the cdc4Δ strain. Integrating cdc4-12 into the genome caused it to be predominantly defective in G1/S. It is unclear why this was so; the G2/M phenotype could be exhibited only when the cells carried several copies of the mutant gene. cdc4-12, cdc4-14, and cdc4-15 were not dominant because plasmids carrying these alleles, when transformed into wild-type cells, did not give rise to a ts phenotype.
Northern blot hybridization, flow cytometry, and immunofluorescence.
RNA extraction was done according to the method of Cross and Tinkelenberg (8), and Northern blot analysis was performed as described by Price et al. (36). Cells were prepared for FACScan analysis (flow cytometry) as in the work of Lim et al. (25). Cells were prepared for immunofluorescence as described in the work of Kilmartin and Adams (22), and microtubules and DNA were visualized with antitubulin monoclonal antibody YOL1/34 (gift from J. V. Kilmartin) and diamidinophenylindole, respectively.
RESULTS
Mutations in CDC4 suppress the nuclear division defect in the cdc20-1 mutant.
To identify genes that functionally interact with CDC20, we screened for second-site suppressors of the ts cdc20-1 mutant. Since cdc20-1 cells lose viability rapidly at 37°C, the screens were performed at 35°C, the temperature at which these cells still are arrested prior to nuclear division but remain viable. Two suppressors were obtained from a spontaneous revertant screen, and an additional one was identified in a genetic screen in which cells were mutagenized with ethyl methanesulfonate. In all three cases, the suppression was due to a single, recessive mutation. When segregated away from the cdc20-1 mutation, the suppressor mutations were found to render the segregants for growth at 37°C. To clone the corresponding genes, the mutants were transformed with a genomic library on a CEN vector and the plasmids were retrieved from the clones that grew well at 37°C. The complementing plasmids from all three suppressor mutants contained the CDC4 gene, suggesting that the suppressor mutations were in CDC4. This was supported by the observation that the suppressor mutations failed to complement the canonical cdc4-1 allele at 37°C when tested in a heteroallelic combination in a diploid. To further confirm that the suppressor mutations were indeed in the CDC4 gene, the wild-type CDC4 gene was first cloned into a URA3-selectable integrative vector. The integration of the entire plasmid was targeted to the CDC4 locus in the strain carrying one of the ts suppressor mutations (later named cdc4-10). Southern blot analysis confirmed that the integration had occurred at the CDC4 locus (data not shown). The resultant integrant was crossed to a wild-type strain; the diploid was allowed to sporulate, and in all, 21 tetrads were dissected. As expected, the URA3 marker showed a 2:2 segregation pattern in all tetrads. All segregants in 20 tetrads grew well at 37°C; the remaining tetrad showed an inexplicably abnormal segregation pattern (data not shown). The absence of any ts segregant in this cross, together with the complementation studies described above, suggest that the suppressor mutations are most likely at the CDC4 locus. Therefore, these mutations were named cdc4-10 (Fig. 1), cdc4-11, and cdc4-16. cdc4-10 was used for further studies.
FIG. 1.
cdc4-10 suppresses the growth defect of the cdc20-1 mutation. cdc4-10 is one of the three cdc4 alleles isolated as second-site suppressors of the cdc20-1 ts mutation. Various strains were streaked on yeast extract-peptone-dextrose plates, incubated for 2 (35°C) or 3 (24°C) days, and then photographed. The viability of the cdc20-1 strain at 35°C is enhanced by the presence of cdc4-10 but not by that of cdc4-1, cdc4-12, or cdc34-2. The cdc4-10 and cdc34-2 mutants are ts at 37°C but can grow at 35°C.
The cdc4-10 mutant grows well at 35°C (Fig. 1), but it is ts for growth at 37°C. When released from α-factor arrest or when shifted as an asynchronous culture to 37°C, it is arrested predominantly at the G1/S transition with an elongated and often deformed bud, a single nucleus, 1N DNA content, and an intensely stained aster of microtubules (presumably emanating from duplicated spindle pole bodies). This phenotype is very similar to that exhibited by the cdc4-1 mutant at 37°C, except that the cdc4-10 mutant shows a small population of cells with a 2N content of DNA (Fig. 2). Although the cdc4-10 mutant is defective in G1/S transition at 37°C, the cdc4-10 allele allows the cdc20-1 mutant to grow at 35°C (Fig. 1).
FIG. 2.
The cdc4-10 strain is defective in G1/S transition at 37°C. Exponentially growing cultures of cdc4-10 and cdc4-1 cells were shifted to 37°C for 4 h. The cdc4-10 strain is arrested like the cdc4-1 strain at G1/S with an elongated (and often deformed) bud and a single nucleus prior to DNA synthesis and bipolar spindle formation. Differential interference contrast (DIC) micrographs of undigested cells in a different field show the bud morphology. Antitubulin antibodies (YOL1/34; α-tub) stain a single aster of microtubules in a single nucleus stained with diamidinophenylindole (DAPI). FACScan analysis shows that the cdc4-1 strain is arrested with 1N DNA content while the DNA profile for the cdc4-10 strain contains a smaller 2N peak because it is slightly leaky at 37°C. Bar, 1 μm.
The functional interaction between CDC4 and CDC20 seems specific because while cdc4-10, cdc4-11, and cdc4-16 alleles (data shown only for cdc4-10) can alleviate the nuclear division defect of the cdc20-1 mutant, the canonical cdc4-1 allele or a newly generated ts mutation, cdc4-12 (see below) (Fig. 1), cannot. The specificity of interaction is further demonstrated by our observation that the cdc4-10 allele fails to suppress either the cdc34-2 mutation, which causes an arrest in G1/S, or cdc13-1, cdc27-1, and cdc28-1N mutations that, like cdc20-1, lead to growth arrest at the G2/M transition (data not shown). Moreover, the suppression activity of the new mutant alleles is not dominant because a strain heterozygous for cdc4-10 (or cdc4-11) and homozygous for cdc20-1 is not viable at 35°C, suggesting that the suppressor alleles do not have hypermorphic activity that can substitute for the function of another WD40-containing protein, Cdc20. This was further supported by the observations that the cdc20-1 mutant cannot be suppressed at 35 or 37°C by overexpression of the wild-type CDC4 gene driven by the GAL1 promoter and that the suppressor alleles cdc4-10 and cdc4-11 cannot compensate for the lack of the CDC20 gene. Taken together, these results suggest that the genetic interaction between CDC4 and CDC20 is specific. The fact that a mutation in another subunit of SCF, cdc34-2 (the cdc34-2 strain, like the cdc4-10 strain, is nonfunctional at 37°C but grows fairly well at 35°C), fails to suppress the nuclear division defect of the cdc20-1 mutant (Fig. 1) strengthens this conclusion.
The suppression activity of cdc4-10 is independent of Sic1 accumulation.
It has been previously reported that the cdc20-1 mutation can be suppressed by overexpression of SIC1 (38). Moreover, the inhibition of the mitotic kinase by Sic1 can lead to the activation of cyclosome-mediated proteolysis (1). Therefore, it is possible that the suppression of the cdc20-1 mutation by CDC4 alleles isolated in this study is a result of Sic1 accumulation due to a defect in Cdc4-mediated proteolytic degradation in G1. To test this possibility, we used a version of the SIC1 gene that had been tagged with three tandem copies of a sequence encoding the c-myc epitope. That the epitope-tagged SIC1 gene was functional was indicated by its ability to allow sic1Δ cells to grow as well as the wild-type cells (Fig. 3B). The cdc4-1, cdc4-10, cdc4-12, and cdc34-2 mutants and the wild-type cells carrying the native promoter-driven SIC1-myc3 gene (on a CEN plasmid) were released from HU arrest (a stage beyond the G1/S execution point of Cdc4) at 35°C. The cell cycle progression and Sic1 protein levels were monitored upon release from HU arrest (Fig. 3A). The wild-type and cdc4-10 cells traverse through S phase and mitosis at about the same rate. The degradation kinetics of the Sic1 protein are also quite similar in these two strains. Upon release, Sic1 is degraded at 60 min, coinciding with the completion of S phase, and increases again as cells undergo mitosis (10). However, in cdc4-1, cdc4-12, and cdc34-2 mutants, the Sic1 protein is not efficiently degraded upon release from HU arrest (Fig. 3A). This is expected, since Cdc4 and Cdc34 are required for the ubiquitination and hence for the proteolysis of Sic1 (12, 44). In all five strains, the small amount of Sic1 present in HU block could be due to the small percentage of cells that have not initiated S phase, possibly represented by the cells that have not formed a visible bipolar spindle (about 20%).
Hence, cdc4-1, cdc4-12, and cdc34-2 mutants accumulate Sic1 protein as they progress through G2/M but yet fail to suppress the cdc20-1 phenotype (Fig. 1). On the other hand, the cdc4-10 mutant, which is able to degrade Sic1 normally, suppresses the growth defect of cdc20-1 cells. Moreover, cdc4-10 can also suppress the growth defect of cdc20-1 cells at 30°C in the absence of SIC1, as the sic1Δ cdc4-10 cdc20-1 triple mutant grows better than the sic1Δ cdc20-1 double mutant (Fig. 3C). In this experiment, the triple mutant was tested for growth at 30 instead of 35°C because the deletion of the SIC1 gene causes cells to grow generally poorly; consequently, sic1Δ cdc4-10 cdc20-1 and sic1Δ cdc20-1 mutants are not viable at 35°C. These findings imply that the ability of the cdc4-10 mutation to suppress cdc20-1 is not due to the accumulation of Sic1 protein.
CDC4 serves a function in G2/M.
The ability of CDC4 alleles to suppress the defect of the cdc20-1 mutant was unexpected, since CDC4 is known to have a function only in the G1/S transition (13, 39) while CDC20 serves a function only in G2/M. That CDC4 may have a second role in addition to its G1/S function was first indicated by our observation that about 10% of cdc4-1 cells are arrested with a short mitotic spindle when an asynchronous culture is shifted to 37°C. To demonstrate the G2/M phenotype of the cdc4-1 strain more clearly, cdc4-1 cells were first synchronized in early S phase by HU treatment for 3 h before they were allowed to resume cell cycle progression at 37°C. In comparison to the wild-type strain, cdc4-1 cells undergo S phase about 15 min later but are delayed in G2/M transition from 60 to 150 min after release. At 60 min after the release, a large proportion of cdc4-1 cells had a short mitotic spindle (about 70% [Fig. 4]) while the wild-type cells had already undergone nuclear division. At 150 min, 50% of mutant cells were arrested with a short preanaphase spindle while the remainder had progressed to the next cycle and were arrested at the G1/S transition. Wild-type cells at this point were dividing asynchronously (Fig. 4). Approximately 40% of cdc4-1 cells still remained arrested with a short spindle at the end of the experiment.
FIG. 4.
The cdc4-1 mutant exhibits a delay in G2 when released from HU-induced arrest. cdc4-1 and wild-type cells were arrested by HU treatment for 3 h at 24°C, shifted to 37°C for an hour, and then released at 37°C in HU-free medium. Samples were taken for immunofluorescence and FACScan analysis. Photomicrographs show cells at 150 min after the release. At this point, about 50% of cdc4-10 cells remain blocked in G2/M with a short mitotic spindle while the remainder show a single aster of microtubules (arrows). The wild-type cells are dividing asynchronously at this time point. Differential interference contrast (DIC) micrographs of undigested cells from a different field show the bud morphology. α-tub, antitubulin. DAPI, diamidinophenylindole. Bar, 1 μm.
To confirm that CDC4 indeed has a G2/M function, we analyzed the phenotype of a strain lacking the CDC4 gene (the cdc4Δ mutant) kept alive by GAL-CDC4 on a CEN plasmid. When GAL-CDC4 transcription was shut off by growth in glucose, these cells were arrested only after 16 h at 24°C (Fig. 5). The arrested culture contained a mixture of cells with either an elongated or a deformed bud and a single aster similar to the G1/S phenotype of the cdc4-1 strain (∼34%) or with a round bud and a short mitotic spindle in an undivided nucleus (∼65%), similar to the G2/M phenotype of the cdc20-1 strain. FACScan analysis of cdc4Δ cells shows a 1N and a broad 2N peak, probably because, by the end of the incubation period, cells are highly enlarged and some undergo lysis. The two arrest phenotypes of Cdc4-depleted cells and the delay in G2/M transition of cdc4-1 cells strongly suggest that Cdc4 is required for two distinct functions in the cell cycle. The preanaphase arrest phenotype of cdc4Δ cells implies that Cdc4 function may be necessary for nuclear division.
FIG. 5.
cdc4Δ cells are defective in both G1/S and G2/M transitions, whereas the cdc4Δ sic1Δ double mutant is arrested mainly in G2/M when depleted of the Cdc4 protein. cdc4Δ and cdc4Δ sic1Δ cells kept alive by GAL-CDC4 on a CEN vector were shifted from galactose to glucose medium for 16 or 12 h, respectively, at 24°C to repress the GAL1 promoter. cdc4Δ cells contain a mixture of cells arrested at either G1/S or G2/M. The G1/S phenotype, seen in about 34% of cells, is identical to that of cdc4-1 cells shifted to 37°C (arrows), while 65% of the cells are arrested prior to anaphase with a short spindle. The FACScan analysis of cdc4Δ cells shows a 1N peak and a broad peak at a position slightly greater than 2N DNA content, perhaps because the cells are enlarged and some appear to be undergoing lysis. The cdc4Δ sic1Δ cells are round budded, and more than 85% of the cells contain short spindles. This predominant G2/M phenotype correlates with the 2N peak shown by FACScan analysis. Differential interference contrast (DIC) micrographs of undigested cells in a different field show the bud morphology. α-tub, antitubulin. DAPI, diamidinophenylindole. Bar, 1 μm.
Since overexpression of Sic1 can delay G2/M transition by inhibiting the mitotic kinase Cdc28/Clb, it can be argued that the G2/M delay or arrest seen in cdc4-1, cdc4-12 (see below), and cdc4Δ cells may be due to an accumulation of Sic1 caused by defective proteolysis during G1 in these mutants. To rule out this possibility, we constructed cdc4Δ sic1Δ and cdc4-12 sic1Δ double mutants and analyzed their behavior when Cdc4 was depleted or inactivated. The cdc4Δ sic1Δ cells kept alive by GAL-CDC4, when shifted to glucose medium, were arrested within 12 h as round-budded cells with short spindles (>85% [Fig. 5]) and predominantly 2N DNA content. The proportion of cells with the G1/S phenotype (i.e., with 1N DNA content) was very small in this culture, suggesting that the arrest at G1/S transition exhibited by cdc4Δ cells (Fig. 5, left panels) is mainly due to their inability to degrade Sic1. Once these cells are allowed to traverse through S phase due to the deletion of the SIC1 gene, they are arrested at the second execution point in G2. To ensure that the G2/M arrest exhibited by the cdc4Δ mutant (after 18 h in glucose medium) was not due to a rapid loss of viability, the arrested cells were transferred back to galactose plates. Almost 85% of the arrested cells budded within 5 h, indicating that they remained viable. Deletion of SIC1 in the cdc4-12 strain, a ts mutant which arrests at both G1/S and G2/M stages (see below), similarly shows an enrichment of cells with G2/M phenotype when grown at 37°C (data not shown). A previous study had also reported that the cdc4-1 sic1Δ double mutant is arrested prior to nuclear division at the nonpermissive temperature (39). Thus, our results are strongly suggestive of a requirement for Cdc4 function during G2/M transition.
If CDC4 participates in both G1/S and G2/M transitions, it may be transcriptionally active at both of these stages of the division cycle. To determine when the CDC4 gene is expressed during the cell cycle, wild-type cells were synchronized in G1 with α-factor treatment and then released into α-factor-free medium. Samples were withdrawn at 10-min intervals, and RNA levels were analyzed by Northern blotting. The CDC4 RNA is expressed constitutively and shows no dramatic variation as cells progress through the cell cycle (data not shown). Cdc4 protein tagged with 3× c-myc epitope and expressed from the GAL promoter was localized to the nucleus at all stages of the cell cycle (data not shown). This is consistent with a previous report that Cdc4 is a nuclear scaffold protein (4).
Isolation of cdc4 ts mutants with a G2/M phenotype.
The notion that CDC4 may serve an additional function in mitosis prompted us to isolate mutations in the CDC4 gene which would render it exclusively defective in its G2/M function. The CDC4 gene was mutated by error-prone PCR and gap-repair methods (see Materials and Methods) (30). The ts alleles were selected in a cdc4Δ strain kept viable by GAL-CDC4 on a CEN plasmid. We specifically targeted the region that encodes the WD40 repeats for mutagenesis, since these motifs are thought to facilitate multiprotein complex formation (reviewed by Neer et al. [31]). The repaired plasmids were isolated and retransformed into the parental strain to confirm that they conferred a ts phenotype. None of the ts mutants obtained exhibited exclusively a G2/M arrest. Four of the eleven ts mutants showed a predominant G1/S phenotype, and the remaining seven showed a mixture of G1/S and G2/M phenotypes at 37°C when shifted from the permissive temperature as cycling cultures to 37°C. Attempts to mutate regions outside the WD40 repeats yielded five additional mutants, which arrested mainly in G1/S at 37°C. It appears that mutations that affect the G2/M function also affect G1/S function.
The seven mutant alleles that showed a mixed phenotype were sequenced. The amino acid changes in the cdc4-12, -14, and -15 alleles are shown in Fig. 6A. Interestingly, all the mutations are found between the first and second WD repeats while cdc4-12 has one mutation adjacent to (G434S) and one within (D442G) the first WD40 repeat. None of the mutants contained substitutions in the WD residues that are highly conserved in the WD40 family of proteins. Of the newly isolated alleles, cdc4-12 showed the most marked increase in the proportion of cells arrested in G2/M (about 44%; compare with the canonical cdc4-1 allele) when an exponentially growing culture was shifted to 37°C (Fig. 6B; compare with Fig. 2). Therefore, the cdc4-12 mutant was selected for further studies.
FIG. 6.
The nuclear division defect in the cdc4-12 mutant can be alleviated by the deletion of the PDS1 gene. (A) Positions of mutations in some cdc4 alleles that cause a proportion of cells to be arrested in G2/M. The region that was amplified by error-prone PCR (arrows indicating the primers) in cdc4-12, cdc4-14, and cdc4-15 was sequenced, and the changes that produced amino acid substitutions (vertical bars) are indicated. All the amino acid changes map between the first and second WD40 repeats (black boxes). (B) The cdc4-12 mutant is defective in both G1/S and G2/M transitions. The exponentially growing mutant cells at 24°C were filtered and resuspended in fresh medium prewarmed at 37°C. Samples for immunofluorescence and FACScan analysis were withdrawn at various times. The photomicrographs show the phenotype of cells 4 h after the temperature shift. About 55% of the cells have a single aster of microtubules, while 44% are arrested with a short spindle (arrows). Differential interference contrast (DIC) photomicrographs showing bud morphology are of undigested cells in a different field. (C) The wild-type (data identical to that in Fig. 4), cdc4-12, and cdc4-12 pds1Δ cells were arrested in HU block for 3 h 15 min at 24°C, shifted to 37°C for 45 min, and then released at 37°C. Samples were withdrawn every 30 min for immunofluorescence and FACScan analysis. While the percentage of wild-type cells with a short spindle drops dramatically 1 h after the release (Fig. 4), 70 to 75% of cdc4-12 cells remain arrested with a short spindle (left panels and graphs). The photomicrographs show phenotypes of cdc4-12 cells (left panels) 150 min after the release from HU block. The cdc4-12 pds1Δ cells (right panels) undergo anaphase at about 60 min after release from HU, with approximately 40% of cells showing anaphase spindles at 2 to 2.5 h after the release (graphs). Photomicrographs show cells at 150 min after HU release. The mid-region of anaphase spindles tends to become thin. Arrows indicate cells in which nuclear division occurred within one cell. Anaphase spindles are defined as those extended between two well-separated masses of nuclear DNA. The number of G1 cells with single asters of microtubules increases as cells exit from mitosis. Differential interference contrast photomicrographs showing bud morphology are of undigested cells in a different field. Bar, 1 μm. For panels B and C, α-tub means antitubulin and DAPI means diamidinophenylindole.
To examine the cell cycle progression of the cdc4-12 strain upon release from S-phase arrest, cdc4-12 and wild-type cells were synchronized in early S phase by HU treatment and then released at 37°C. The wild-type cells showed similar cell cycle progression, as shown in Fig. 4. Like the cdc4-1 strain, the cdc4-12 strain was slightly delayed (by about 15 min compared to wild type) in the initiation of S phase but showed a more marked delay or arrest in its progression through G2/M (Fig. 6C, left panel) compared to the cdc4-1 strain. While wild-type cells underwent mitosis within 1 h, more than 70% of cdc4-12 cells stalled with a short mitotic spindle even 2.5 h after the release. At the end of the experiment, approximately 70% of the cells remained arrested with a short mitotic spindle (Fig. 6B). The remainder of the cells escaped the G2/M block and came to be arrested in G1/S in the next cell cycle. Collectively, these data strengthen our assertion that CDC4 serves a second function in G2/M in addition to its G1/S role.
Deletion of PDS1 in the cdc4-12 strain relieves its preanaphase block.
Recent evidence (26, 49) suggests that the essential function of Cdc20 in the metaphase-to-anaphase transition is to mediate proteolytic destruction of the anaphase inhibitor Pds1. Consistent with this proposal, deletion of the PDS1 gene allows the cdc20-1 mutant to undergo anaphase (26, 52). Since CDC4 interacts genetically with CDC20, we tested if the preanaphase arrest in the cdc4-12 mutant could also be relieved by deletion of PDS1. We monitored the progression of the double mutant cdc4-12 pds1Δ through the cell cycle after the release from HU-induced arrest. While the control strain, the cdc4-12 strain, remained largely arrested with a short mitotic spindle throughout the course of the experiment, the cdc4-12 pds1Δ strain underwent anaphase (Fig. 6B). At 2 to 2.5 h after the release, up to 40% of cdc4-12 pds1Δ cells (four times as many as the number of cdc4-12 cells) contained anaphase spindles. A small proportion of cells succeeded in completing anaphase normally, so that the nuclei were segregated into mother and daughter cells. However, many cells elongated the spindle within the mother cell. These cells may have been defective in spindle orientation, which may explain why they could not fully extend their spindle into the daughter cell. Another striking feature is the thin appearance of the mid-region of the anaphase spindles, which is also seen in the cdc20-1 pds1 double mutant (26). Unlike the cdc20-1 pds1 mutant, which remains arrested in telophase with high Clb2-associated kinase (26), however, the cdc4-12 pds1 strain progressed through anaphase and then exited mitosis, giving rise to many G1 cells (represented by cells with single asters of microtubules) by 3 h after the release. These results may imply that the role of Cdc4 during G2/M transition is related to the proteolytic destruction mechanism operative during the onset of anaphase (but see Discussion).
DISCUSSION
The mechanisms responsible for the proteolytic destruction of mitotic regulators have become subjects of considerable investigation for their now-obvious importance in the cell cycle progression. The E3 enzyme complexes SCF and APC are of particular interest as they control the initiation of S phase and the onset of anaphase, respectively. Cdc4 and Cdc20, both WD40 repeat-containing proteins, are crucial for the activities of these proteolytic systems: while Cdc4 is a component of SCFCdc4 (12, 39, 44, 48), Cdc20 is an activator of the APC-dependent proteolysis (26, 49). Thus far, no functional overlap between the two proteolytic systems has been reported. It is therefore surprising that the three mutations that we have isolated in this study as suppressors of the cdc20-1 mutation are all in the CDC4 gene. Consistent with the role of CDC4 in G1/S transition, all three alleles exhibit a G1/S defect. However, they are also able to suppress the nuclear division defect of cdc20-1 cells. Furthermore, reexamination of the original cdc4-1 allele and the characterization of cdc4-12 and cdc4Δ mutants show that they are also defective in the onset of anaphase. The evidence presented in this report strongly suggests that Cdc4 serves an essential function during G2/M transition.
Since both Cdc4 and Cdc20 contain WD40 repeats and play important roles in proteolytic processes, it is conceivable that Cdc4 can substitute for the Cdc20 function in G2. However, several observations argue against this possibility: (i) Cdc4 overexpression does not suppress cdc20-1; (ii) two of the cdc4 suppressor alleles tested cannot complement the cdc20Δ mutant at permissive or restrictive temperatures, suggesting that these are not bypass-suppressor alleles but instead require the presence of the cdc20-1 mutation for the suppression; and (iii) the suppressor activities of cdc4-10 and cdc4-11 alleles are recessive.
It can be argued that the suppression of cdc20-1 by the CDC4 alleles isolated in this study is due to indirect causes. We have considered and tested some of these possibilities. (i) Sic1 overexpression can both suppress the cdc20-1 mutation and activate anaphase (1, 38). Since CDC4 is required for Sic1 proteolysis, Sic1 may accumulate in the cdc4 alleles, which can then suppress the nuclear division defect of the cdc20-1 mutant. However, cdc4-1, cdc4-12, and cdc34-2 mutants accumulate Sic1 when released from HU arrest, and yet they are unable to suppress cdc20-1 (Fig. 1 and 3A). Furthermore, the suppressor mutation cdc4-10 can alleviate the defect of cdc20-1 even in the absence of the SIC1 gene (Fig. 3C). Hence, the accumulation of Sic1 does not contribute to the suppression by the CDC4 alleles. (ii) Cdc20 contains a destruction box in its N terminus and is rapidly degraded in G1 (12a, 40). As Cdc4 is a component of an E3 complex, it may be responsible for the degradation of Cdc20. The suppressor activity of CDC4 alleles could be due to their failure to degrade the mutant Cdc20-1 protein, allowing its accumulation to levels sufficient to mediate nuclear division. This explanation is clearly untenable because we have found that Cdc20 proteolysis in G1 is not dependent on Cdc4 function (data not shown). (iii) The suppression of the cdc20-1 mutation by cdc4-10 might be due to a slower progression through G2/M, which may allow the mutant cdc20-1 protein to accumulate and partially perform its function in G2/M. This is not likely since the cdc4-10 mutant undergoes mitosis at about the same rate as do wild-type cells at 35°C (Fig. 3). Moreover, cdc4-1 and cdc4-12 strains show a delay or an arrest in G2/M but cannot suppress the nuclear division defect of cdc20-1 cells. Thus, the ability to suppress cdc20-1 and the G2/M phenotype are distinctly the characteristics of cdc4 alleles themselves. We have detected no physical interaction between Cdc4 and Cdc20 in coimmunoprecipitation experiments and two-hybrid assays. Hence, the nature of this specific interaction between Cdc4 and Cdc20 remains largely unknown.
SCF is required for the degradation of Gcn4, Far1, Cln1, Cln2, Swe1, and Cdc6. It appears that the substrate specificity is conferred by adapters such as Cdc4, Grr1, and Met30. Although the proposed role of Cdc4 in G1/S transition is to promote ubiquitination and degradation of phospho-Sic1 (12, 39, 44, 48), the activities of Cdc4 and SCFCdc4 are also required in both G2 and M phases for the degradation of the Cdc6 protein (11, 35). Moreover, Skp1, another component of SCFCdc4, is involved in both G1/S and G2/M transition (2). The cdc34 sic1Δ double mutant also exhibits a G2 delay (39). Collectively, these data imply that SCFCdc4 may be active through a large part of the cell cycle. Thus, the requirement for Cdc4 in G2/M transition, as suggested by our results, is not entirely inconceivable. The constitutive transcription of the CDC4 gene and the presence of the Cdc4 protein in the nucleus throughout the cell cycle are consistent with this notion. The region between the first and second well-conserved WD repeats, in which the ts mutations (isolated in this study) were mapped, may define the part of the Cdc4 protein which is important for its function in both G1/S and G2/M transitions. It has been suggested previously that WD repeats form propeller-like structures that may confer a rigid scaffold for surface embellishments (32).
Our assertion that Cdc4 serves an essential function in G2/M cannot be accounted for by the requirement of SCFCdc4 for Cdc6 degradation, since overexpression of wild-type or a nondestructible Cdc6 does not cause any discernible phenotype (11). Incidentally, Skp1, a component of the centromere binding complex (7, 45), was isolated as a high-dosage suppressor of cdc4-1 and interacts with Cdc4 via its F-box. Hence, it is possible that the G2/M delay exhibited by the cdc4-12 allele may be due to a defective interaction between Cdc4-12 and Skp1, giving rise to a faulty kinetochore function. Alternatively, a checkpoint control may be induced by such a defective interaction (such as incomplete attachment of chromosomes to the spindle). However, we find that the overexpression of SKP1 cannot suppress the G2/M defect of the cdc4-12 strain when released from HU arrest at 37°C (data not shown).
The alleviation of preanaphase arrest in the cdc4-12 strain by the deletion of PDS1 (Fig. 6B) suggests that the Cdc4 function in G2/M may be linked to the degradation of Pds1. Pds1, an anaphase inhibitor, is a nonessential protein whose overexpression delays the metaphase-to-anaphase transition (6). Deletion of PDS1 allows cdc16, cdc23, cdc27, and cdc20 mutants to undergo nuclear division at the nonpermissive temperature (26, 52). This is expected, since these four genes are involved in the APC-dependent degradation of Pds1. Cdc23, Cdc16, and Cdc27 are the components of APC (17, 53), and Cdc20 acts either as a substrate-specific activator of Pds1 proteolysis (49) or as a general activator of APC (26). The facts that CDC4 and CDC20 interact genetically and that the PDS1 deletion relieves the cdc4-12 mutant of its nuclear division defect strongly implicate Cdc4, directly or indirectly, in the regulation of the proteolytic mechanism during the metaphase-to-anaphase transition. Since the cdc4-12 pds1Δ double mutant undergoes nuclear division and subsequently exits mitosis, Cdc4 may be involved in Pds1 degradation as well as Clb2 proteolysis. This is unlike the cdc20 pds1 double mutant, which undergoes nuclear division but is arrested in telophase, most probably due to Clb2 accumulation (26), which prevents exit from mitosis. Although it is tempting to suggest that Cdc4 function in G2 may be associated with the proteolytic mechanism operative during the onset of anaphase, it must be noted that PDS1 deletion can also allow a number of other mutants to escape their G2/M arrest. Moreover, it has recently been suggested that Pds1 is an essential component of an S-phase checkpoint control system (5). Therefore, it may be argued that the cdc4-12 mutant cells are arrested in G2 not because they are defective in the proteolytic mechanism required for the onset of anaphase but due to a defect in progression through S phase. The deletion of PDS1 may “force” these cells to undergo anaphase prematurely, leading to mitotic spindles with thin mid-regions and somewhat defectively segregated nuclear masses (Fig. 6). Since this possibility cannot be discounted at present, the question of the role of Cdc4 in nuclear division remains largely open. We are currently conducting genetic screens for the suppressors of G2/M-defective cdc4 mutations in the hope of identifying genes that may mediate the G2/M function of CDC4.
The mitotic spindles in the cdc4-12 pds1Δ double mutant are often misoriented so that spindle elongation occurs within one cell (presumably the mother cell) (Fig. 6B) and chromosomes fail to segregate into the daughter cell. The failure to orient the spindle is not due to the loss of Pds1 function, since other cdc20 pds1 double mutants are able to elongate their spindles normally through the mother-daughter neck. Cdc4 function might be important in the proper orientation of mitotic spindles. However, it is difficult to envision the nature of its involvement, given that the only known function of Cdc4 to date is to recruit substrates for ubiquitination by SCFCdc4. Clearly, further investigations are required to elucidate the role of Cdc4 in the metaphase-to-anaphase transition.
ACKNOWLEDGMENTS
We thank Alice Tay and her lab members for sequencing the DNA clones, Sara Zaman for the sic1Δ strain and the SIC1-myc3 plasmid, and the technical staff for their help. We are grateful to Breck Byers for the pds1Δ strain and John Kilmartin for antitubulin antibody.
This work was supported by the National Science and Technology Board, Singapore.
REFERENCES
- 1.Amon A. Regulation of B-type cyclin proteolysis by Cdc28-associated kinase in budding yeast. EMBO J. 1997;15:2693–2702. doi: 10.1093/emboj/16.10.2693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bai C, Sen P, Hofmann K, Ma L, Goebl M, Harper J W, Elledge S J. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell. 1996;86:263–274. doi: 10.1016/s0092-8674(00)80098-7. [DOI] [PubMed] [Google Scholar]
- 3.Barral Y, Jentsch S, Mann C. G1 cyclin turnover and nutrient uptake are controlled by a common pathway in yeast. Genes Dev. 1995;9:399–409. doi: 10.1101/gad.9.4.399. [DOI] [PubMed] [Google Scholar]
- 4.Choi W-J, Clark M W, Chen J X, Jong A Y. The CDC4 gene product is associated with the yeast nuclear skeleton. Biochem Biophys Res Commun. 1990;172:1324–1330. doi: 10.1016/0006-291x(90)91594-i. [DOI] [PubMed] [Google Scholar]
- 5.Clarke D J, Segal M, Mondesert G, Reed S. The Pds1 anaphase inhibitor and Mec1 kinase define distinct checkpoints coupling S phase with mitosis in budding yeast. Curr Biol. 1999;9:365–368. doi: 10.1016/s0960-9822(99)80163-8. [DOI] [PubMed] [Google Scholar]
- 6.Cohen-Fix O, Peters J-M, Kirschner M W, Koshland D. Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p. Genes Dev. 1996;10:3081–3093. doi: 10.1101/gad.10.24.3081. [DOI] [PubMed] [Google Scholar]
- 7.Connelly C, Heiter P. Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression. Cell. 1996;86:275–285. doi: 10.1016/S0092-8674(00)80099-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cross F, Tinkelenberg A H. A positive feedback loop controlling CLN1 and CLN2 gene expression at the START of yeast cell cycle. Cell. 1991;65:875–883. doi: 10.1016/0092-8674(91)90394-e. [DOI] [PubMed] [Google Scholar]
- 9.Dawson I A, Roth S, Artavanis-Tsakonas S. The Drosophila cell cycle gene fizzy is required for normal degradation of cyclins A and B during mitosis and has homology to the CDC20 gene of Saccharomyces cerevisiae. J Cell Biol. 1995;129:725–737. doi: 10.1083/jcb.129.3.725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Donovan J D, Toyn J H, Johnson A L, Johnston L H. P40SDB25, a putative CDK inhibitor, has a role in the M/G1 transition in Saccharomyces cerevisiae. Genes Dev. 1994;8:1640–1653. doi: 10.1101/gad.8.14.1640. [DOI] [PubMed] [Google Scholar]
- 11.Drury L S, Perkins G, Diffley J F X. The Cdc4/34/53 pathway targets Cdc6p for proteolysis in budding yeast. EMBO J. 1997;16:5966–5976. doi: 10.1093/emboj/16.19.5966. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Feldman R M R, Cornell C C, Kaplan K B, Deshaies R J. A complex of Cdc4p, Skp1p, and Cdc53/cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p. Cell. 1997;91:221–230. doi: 10.1016/s0092-8674(00)80404-3. [DOI] [PubMed] [Google Scholar]
- 12a.Goh, P.-Y., and U. Surana. Unpublished observations.
- 13.Hartwell L H. Genetic control of the cell division cycle in yeast. II. Genes controlling DNA replication and its initiation. Genetics. 1971;59:183–194. doi: 10.1016/0022-2836(71)90420-7. [DOI] [PubMed] [Google Scholar]
- 14.Hartwell L H, Mortimer R K, Culotti J, Culotti M. Genetic control of cell division cycle in yeast. V. Genetic analysis of cdc mutants. Genetics. 1973;74:267–286. doi: 10.1093/genetics/74.2.267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hoyt M A. Eliminating all obstacles: regulated proteolysis in the eukaryotic cell cycle. Cell. 1997;91:149–151. doi: 10.1016/s0092-8674(00)80396-7. [DOI] [PubMed] [Google Scholar]
- 16.Irniger S, Nasmyth K. The anaphase-promoting complex is required in G1 arrested yeast cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase. J Cell Sci. 1997;110:1523–1531. doi: 10.1242/jcs.110.13.1523. [DOI] [PubMed] [Google Scholar]
- 17.Irniger S, Piatti S, Michaelis C, Nasmyth K. Genes involved in sister chromatid separation are needed for B-type cyclin proteolysis in budding yeast. Cell. 1995;81:269–277. doi: 10.1016/0092-8674(95)90337-2. [DOI] [PubMed] [Google Scholar]
- 18.Jaquenoud M, Gulli M-P, Peter K, Peter M. The Cdc42p effector Gic2p is targeted for ubiquitin-dependent degradation by the SCFGrr1 complex. EMBO J. 1998;17:5360–5373. doi: 10.1093/emboj/17.18.5360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Juang Y L, Huang J, Peters J-M, McLaughlin M E, Tai C Y, Pellman D. APC-mediated proteolysis of Ase1 and the morphogenesis of the mitotic spindle. Science. 1997;275:1311–1314. doi: 10.1126/science.275.5304.1311. [DOI] [PubMed] [Google Scholar]
- 20.Kaiser P, Sia R A L, Bardes E G S, Lew D J, Reed S I. Cdc34 and the F-box protein Met30 are required for degradation of the Cdk-inhibitory kinase Swe1. Genes Dev. 1998;12:2587–2597. doi: 10.1101/gad.12.16.2587. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kaplan K B, Hyman A A, Sorger P K. Regulating the yeast kinetochore by ubiquitin-dependent degradation and Skp1p-mediated phosphorylation. Cell. 1997;91:491–500. doi: 10.1016/s0092-8674(00)80435-3. [DOI] [PubMed] [Google Scholar]
- 22.Kilmartin J V K, Adams A M E. Structural arrangement of tubulin and actin during the cell cycle of Saccharomyces. J Cell Biol. 1984;98:922–933. doi: 10.1083/jcb.98.3.922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.King R W, Peters J-M, Tugendreich S, Rolfe M, Heiter P, Kirschner M W. A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell. 1995;81:279–288. doi: 10.1016/0092-8674(95)90338-0. [DOI] [PubMed] [Google Scholar]
- 24.Lamb J R, Michaud W A, Sikorski R S, Heiter P A. Cdc16p, Cdc23p and Cdc27p form a complex essential for mitosis. EMBO J. 1994;13:4321–4328. doi: 10.1002/j.1460-2075.1994.tb06752.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lim H H, Goh P-Y, Surana U. Spindle pole body in Saccharomyces cerevisiae requires dephosphorylation of the tyrosine 19 residue of Cdc28. Mol Cell Biol. 1996;16:6385–6397. doi: 10.1128/mcb.16.11.6385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lim H H, Goh P-Y, Surana U. Cdc20 is essential for APC-mediated proteolysis of both Pds1 and Clb2 during M phase in budding yeast. Curr Biol. 1998;8:231–234. doi: 10.1016/s0960-9822(98)70088-0. [DOI] [PubMed] [Google Scholar]
- 27.Mathias N, Johnson S L, Winey M, Adams A E, Goetsch L, Pringle J R, Byers B, Goebl M G. Cdc53 acts in concert with Cdc4, Cdc34 to control the G1 to S-phase transition and identifies a conserved family of proteins. Mol Gen Genet. 1996;253:138–148. doi: 10.1128/mcb.16.12.6634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Matsumoto T. A fission yeast homolog of CDC20/p55CDC/Fizzy is required for recovery from DNA damage and genetically interacts with p34cdc2. Mol Cell Biol. 1997;17:742–750. doi: 10.1128/mcb.17.2.742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Michaelis C, Ciosk R, Nasmyth K. Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell. 1997;91:35–45. doi: 10.1016/s0092-8674(01)80007-6. [DOI] [PubMed] [Google Scholar]
- 30.Mulrad D, Hunter R, Parker R. A rapid method for localized mutagenesis of yeast genes. Yeast. 1992;8:79–82. doi: 10.1002/yea.320080202. [DOI] [PubMed] [Google Scholar]
- 31.Neer E J, Schmidt C J, Nambudripad R, Smith T. The ancient regulatory-protein family of WD-repeat proteins. Nature. 1994;371:297–300. doi: 10.1038/371297a0. [DOI] [PubMed] [Google Scholar]
- 32.Neer E J, Smith T F. G protein heterodimers: new structures propel new questions. Cell. 1996;84:175–178. doi: 10.1016/s0092-8674(00)80969-1. [DOI] [PubMed] [Google Scholar]
- 33.O’Toole E T, Mastronarde D N, Giddings T H, Jr, Winey M, Burke D, McIntosh J R. Three-dimensional analysis and ultrastructural design of mitotic spindles from the cdc20 mutant of Saccharomyces cerevisiae. Mol Biol Cell. 1997;8:1–11. doi: 10.1091/mbc.8.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Patton E E, Willems A R, Sa D, Kuras L, Thomas D, Craig K L, Tyers M. Cdc53 is a scaffold protein for multiple Cdc34/Skp1/F-box protein complexes that regulate cell division and methionine biosynthesis in yeast. Genes Dev. 1998;12:692–705. doi: 10.1101/gad.12.5.692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Piatti S, Bohm T, Cocker J H, Diffley J F X, Nasmyth K. Activation of S-phase-promoting CDKs in late G1 defines a “point of no return” after which Cdc6 synthesis cannot promote DNA replication in yeast. Genes Dev. 1996;10:1516–1531. doi: 10.1101/gad.10.12.1516. [DOI] [PubMed] [Google Scholar]
- 36.Price C, Nasmyth K, Schuster T. A general approach to the isolation of cell cycle-regulated genes in the budding yeast Saccharomyces cerevisiae. J Mol Biol. 1991;218:543–556. doi: 10.1016/0022-2836(91)90700-g. [DOI] [PubMed] [Google Scholar]
- 37.Rothstein R J. One-step disruption in yeast. Methods Enzymol. 1983;101:202–210. doi: 10.1016/0076-6879(83)01015-0. [DOI] [PubMed] [Google Scholar]
- 38.Schwab M, Lutum A S, Seufert W. Yeast Hct1 is a regulator of Clb2 cyclin proteolysis. Cell. 1997;90:683–693. doi: 10.1016/s0092-8674(00)80529-2. [DOI] [PubMed] [Google Scholar]
- 39.Schwob E, Bohm T, Mendenhall M D, Nasmyth K. The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae. Cell. 1994;79:233–244. doi: 10.1016/0092-8674(94)90193-7. [DOI] [PubMed] [Google Scholar]
- 40.Sethi N, Monteagudo C, Koshland D, Hogan E, Burke D. The CDC20 gene product of Saccharomyces cerevisiae, a β-transducin homolog, is required for a subset of microtubule-dependent cellular processes. Mol Cell Biol. 1991;11:5592–5602. doi: 10.1128/mcb.11.11.5592-5602.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Shirayama M, Zachariae W, Ciosk R, Nasmyth K. The Polo-like kinase Cdc5p and the WD-repeat protein Cdc20/fizzy are regulators and substrates of the anaphase promoting complex in Saccharomyces cerevisiae. EMBO J. 1998;17:1336–1349. doi: 10.1093/emboj/17.5.1336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sigrist S J, Jacobs H, Stratmann R, Lehner C F. Exit from mitosis is regulated by Drosophila fizzy and the sequential destruction of cyclins A, B and B3. EMBO J. 1995;14:4827–4838. doi: 10.1002/j.1460-2075.1995.tb00164.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sigrist S J, Lehner C F. Drosophila fizzy-related down-regulates mitotic cyclins and is required for cell proliferation arrest and entry into endocycles. Cell. 1997;90:671–681. doi: 10.1016/s0092-8674(00)80528-0. [DOI] [PubMed] [Google Scholar]
- 44.Skowyra D, Craig K L, Tyers M, Elledge S J, Harper J W. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell. 1997;91:209–219. doi: 10.1016/s0092-8674(00)80403-1. [DOI] [PubMed] [Google Scholar]
- 45.Stemmann O, Lechner J. The S. cerevisiae kinetochore contains a cyclin-CDK complex homolog, as identified in in vitro reconstitution. EMBO J. 1996;15:3611–3620. [PMC free article] [PubMed] [Google Scholar]
- 46.Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca F C, Ruderman J V, Hershko A. The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell. 1995;6:185–198. doi: 10.1091/mbc.6.2.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tugendreich S, Tomkiel J, Earnshaw W, Hieter P. CDC27Hs colocalizes with CDC16Hs to the centromere and mitotic spindle and is essential for the metaphase to anaphase transition. Cell. 1995;81:261–268. doi: 10.1016/0092-8674(95)90336-4. [DOI] [PubMed] [Google Scholar]
- 48.Verma R, Annan R S, Huddleston M J, Carr S A, Reynard G, Deshaies R J. Phosphorylation of Sic1p by G1 Cdk required for its degradation and entry into S phase. Science. 1997;278:455–459. doi: 10.1126/science.278.5337.455. [DOI] [PubMed] [Google Scholar]
- 49.Visintin R, Prinz S, Amon A. CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis. Science. 1997;278:460–463. doi: 10.1126/science.278.5337.460. [DOI] [PubMed] [Google Scholar]
- 50.Weinstein J, Jacobsen F W, Hsu-Chen J, Wu T, Baum L G. A novel mammalian protein, p55CDC, present in dividing cells is associated with protein kinase activity and has homology to the Saccharomyces cerevisiae cell division cycle proteins Cdc20 and Cdc4. Mol Cell Biol. 1994;14:3350–3363. doi: 10.1128/mcb.14.5.3350-3363.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Willems A R, Lanker S, Patton E E, Craig K L, Nason T F, Mathias N, Kobayashi R, Wittenberg C, Tyers M. Cdc53 targets phosphorylated G1 cyclins for degradation by the ubiquitin proteolytic pathway. Cell. 1996;86:453–463. doi: 10.1016/s0092-8674(00)80118-x. [DOI] [PubMed] [Google Scholar]
- 52.Yamamoto A, Guacci V, Koshland D. Pds1p, an inhibitor of anaphase in budding yeast, plays a critical role in the APC and checkpoint pathways. J Cell Biol. 1996;133:99–110. doi: 10.1083/jcb.133.1.99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zachariae W, Shin T H, Galova M, Obermaier B, Nasmyth K. Identification of subunits of the anaphase-promoting complex of Saccharomyces cerevisiae. Science. 1996;274:1201–1204. doi: 10.1126/science.274.5290.1201. [DOI] [PubMed] [Google Scholar]








