Structural basis of bilin binding by the chlorophyll biosynthesis regulator GUN4

Abstract

The chlorophyll biosynthesis regulator GENOMES UNCOUPLED 4 (GUN4) is conserved in nearly all oxygenic photosynthetic organisms. Recently, GUN4 has been found to be able to bind the linear tetrapyrroles (bilins) and stimulate the magnesium chelatase activity in the unicellular green alga Chlamydomonas reinhardtii. Here, we characterize GUN4 proteins from Arabidopsis thaliana and the cyanobacterium Synechocystis sp. PCC 6803 for their ability to bind bilins, and present the crystal structures of Synechocystis GUN4 in biliverdin‐bound, phycocyanobilin‐bound, and phytochromobilin‐bound forms at the resolutions of 1.05, 1.10, and 1.70 Å, respectively. These linear molecules adopt a cyclic‐helical conformation, and bind more tightly than planar porphyrins to the tetrapyrrole‐binding pocket of GUN4. Based on structural comparison, we propose a working model of GUN4 in regulation of tetrapyrrole biosynthetic pathway, and address the role of the bilin‐bound GUN4 in retrograde signaling.

Short abstract

PDB Code(s): 7E2R, 7E2S, 7E2T and 7E2U;

Abbreviations

BV

biliverdin IXα

D_IX

deuteroporphyrin IX

GUN

genomes uncoupled

PCB

phycocyanobilin

P_IX

protoporphyrin IX

PΦB

phytochromobilin

1. INTRODUCTION

The genomes uncoupled (gun) phenotypes were reported for Arabidopsis thaliana mutants with perturbed plastid‐to‐nucleus retrograde signaling.¹ Among the six GUN genes (GUN1–GUN6), GUN2–GUN6 encode components of the tetrapyrrole biosynthetic pathway.², ³, ⁴ The gene products of GUN2, GUN3, GUN5, and GUN6 are heme oxygenase (HMOX/HO), phytochromobilin (PΦB) synthase, the CHLH subunit of magnesium chelatase, and ferrochelatase, respectively.⁵ The GUN4 protein possesses no enzyme activity, and further functional characterizations of A. thaliana GUN4 (AtGUN4) have demonstrated that it regulates chlorophyll synthesis by interacting with GUN5/CHLH and its C‐terminal region undergoes phosphorylation, which in turn modulates the magnesium chelatase activity.⁶, ⁷, ⁸, ⁹

GUN4 is found in oxygenic photosynthetic organisms including cyanobacteria, green algae, and plants. Previous studies on cyanobacterial GUN4 from Synechocystis sp. PCC 6803 (SyGUN4),¹⁰, ¹¹, ¹² algal GUN4 from Chlamydomonas reinhardtii (CrGUN4),¹³, ¹⁴, ¹⁵ and Oryza sativa GUN4 (OsGUN4)¹⁶ have confirmed their regulatory role in chlorophyll biosynthesis, and suggested that the algal and plant GUN4 proteins participate in retrograde signaling, although the molecular basis is unclear.¹⁷ Structural analyses of SyGUN4,¹⁸, ¹⁹ Thermosynechococcus elongatus GUN4 (TeGUN4),²⁰ and CrGUN4²¹ have revealed that these proteins consist of two α‐helical bundle domains (Figure 1a). The N‐terminal domain has five α‐helices (αA–αE) and the C‐terminal porphyrin‐binding domain has nine α‐helices (α1, α2, α2/3, α3–α8). The structures of SyGUN4 in respective complexes with deuteroporphyrin IX (D_IX) and magnesium deuteroporphyrin IX (MgD_IX) have shown that the porphyrin‐binding pocket is amphiphilic and half open.¹⁹ The low selectivity of the pocket supports the findings that GUN4 can bind a variety of porphyrins including cobalt P_IX and heme.⁶, ¹⁸

FIGURE 1.

GUN4 topology and the ligand‐free AtGUN4 structure. (a) Topology of SyGUN4. The N‐terminal five‐helical bundle domain is in transparence and the C‐terminal tetrapyrrole‐binding domain is in gray. α‐Helices are shown as cylinders and are labeled. (b) Overall structure of AtGUN4 dimer. Two protomers (chains A and B) are colored in gray and purple, respectively. Chain A is shown in orientation similar to that in Figure 1a. The C‐terminal plant‐specific region is not observed. The unobserved region within the α6/α7 loop is drawn as dashed curves. (c) Dimerization interface. Inter‐protomer hydrogen bonds are shown as dashed lines, which include backbone‐to‐backbone Pro188‐Thr213, Asp189‐Gln214, and Phe191‐Arg211, backbone‐to‐side Ala186‐Thr163, and side chain‐to‐side chain Glu98‐Arg211

Bilin molecules, such as PΦB, phycobilins, and bilirubin, are derived from the heme precursor.²², ²³ Bilin production comprises two steps: first, HMOX/HO cleaves heme to produce biliverdin IXα (BV); second, different reductases convert BV to the reduced bilins. In A. thaliana, the two canonical enzymes are GUN2 (HY1) and GUN3 (HY2/PΦB synthase). Cyanobacteria produce phycobilins such as phycocyanobilin (PCB) and phycoerythrobilin, and their second‐step bilin reductases include PcyA, PebA, PebB, and PebS. Plant PΦB synthase and cyanobacterial bilin reductases belong to the ferredoxin‐dependent bilin reductase family, which differ from the animal biliverdin reductase that produces bilirubin in an NAD(P)H‐dependent way.²⁴ The model green alga C. reinhardtii retains HMOX1 and PCYA1 but lacks phycobiliproteins, indicating that the bilin molecules (BV and PCB), rather than harvest light as in cyanobacteria, possibly act as a retrograde signal and blue light sensor(s).²⁵, ²⁶ Recently, it was discovered that BV or PCB noncovalently binds to CrGUN4, and the bilin‐bound GUN4 regulates chlorophyll biosynthesis by stimulating and stabilizing magnesium chelatase.²⁷ Here, we describe the bilin‐binding site at atomic resolutions and explain the essential roles of GUN4 in oxygenic phototrophs.

2. RESULTS

2.1. AtGUN4 structure

As the first characterized GUN4, AtGUN4 serves as a prototype to study its biological function in plants. Plant GUN4 proteins differ from their cyanobacterial and algal homologs in that their mature forms lack the N‐terminal domain but possess a C‐terminal extension region. We expressed and purified recombinant AtGUN4 protein (residues 70–265) without the chloroplast targeting sequence (Table S1). AtGUN4 was a monomer in solution as indicated by size‐exclusion chromatography (SEC), and isothermal titration calorimetry (ITC) of BV to AtGUN4 gave an apparent dissociation constant (K _D) of 0.10 μM (Figure S1). The complexes of AtGUN4 with bilin molecule (BV and PΦB, respectively) were also purified. However, attempts to crystallize these complexes were unsuccessful. Only the ligand‐free AtGUN4 crystals were obtained, which diffracted to 2.30‐Å resolution (Table 1). AtGUN4 forms a dimer with a pseudo two‐fold symmetry in crystal (Figure 1b). The N‐terminal 4 residues (Ala70‐Thr73), a 6‐residue fragment (Leu175‐Val180) from the loop between α6 and α7 (α6/α7 loop), and the C‐terminal extension (Ala228‐Phe265) are missing. Continuous density is observed for residues Thr74‐Leu174 and Gln181‐Thr227, with eight α‐helices (α1, α2, α2/3, α3–α7) being well defined. Dimerization interface is mainly composed of the α6/α7 loop, and the major inter‐protomer interactions are nonspecific hydrogen bonds between the backbone atoms (Figure 1c). The center of the dimer, expected to harbor the tetrapyrrole‐binding site, has an asparagine pair formed by Asn208 from each protomer. This asparagine corresponds to Asn211 in SyGUN4, where it acts as a key porphyrin‐interacting residue.¹⁹ Thus, dimerization prevents the α6/α7 loop from folding to a tetrapyrrole‐binding state.

TABLE 1.

Data collection and refinement statistics for GUN4 structures

	AtGUN4	SyGUN4‐BV	SyGUN4‐PCB	SyGUN4‐PΦB
PDB code	7E2R	7E2S	7E2T	7E2U
Data collection
Space group	P21	P212121	P212121	P212121
Resolution (Å)a	50.00–2.30 (2.38–2.30)	50.00–1.05 (1.09–1.05)	29.02–1.10 (1.14–1.10)	41.18–1.70 (1.76–1.70)
Cell dimensions
a, b, c (Å)	47.8, 64.1, 55.7	32.5, 64.4, 106.9	32.5, 64.7, 106.5	32.5, 64.6, 106.9
α, β, γ (°)	90, 91.6, 90	90, 90, 90	90, 90, 90	90, 90, 90
No. of unique reflections	15,047 (1495)	105,355 (10,208)	91,915 (9050)	25,494 (2325)
R merge b	0.140 (0.813)	0.089 (0.477)	0.148 (0.820)	0.110 (0.712)
R pim c	0.084 (0.486)	0.027 (0.158)	0.050 (0.270)	0.046 (0.340)
I/σI	9.0 (1.8)	22.4 (3.9)	15.5 (2.3)	16.8 (2.1)
Completeness (%)	99.8 (100)	99.8 (98.2)	100 (100)	99.1 (92.6)
Redundancy	3.7 (3.8)	12.0 (9.5)	9.6 (9.7)	6.4 (5.0)
Wilson B‐factor	29.26	15.73	16.44	14.32
CC 1/2 d	0.981 (0.651)	0.997 (0.916)	0.994 (0.838)	0.989 (0.688)
Refinement
Resolution (Å)	38.29–2.30 (2.38–2.30)	32.22–1.05 (1.09–1.05)	29.02–1.10 (1.14–1.10)	41.18–1.70 (1.76–1.70)
Rworke/Rfreef (%)	19.5/22.5	11.8/13.4	12.5/15.6	15.7/19.4
No. of proteins residues	290	233	230	230
No. of nonhydrogen atoms	2,582	2,400	2,365	2,331
Protein	2,404	1929	1934	1877
Ligand/ion	—	55	44	76
Water	178	416	387	378
RMSD bond (Å)	0.004	0.006	0.007	0.006
RMSD angels (°)	0.71	0.92	1.02	0.99
Average B‐factor	32.57	20.31	23.27	16.45
Protein	32.31	17.05	19.94	14.13
Ligand	—	26.56	29.11	19.89
Solvent	36.10	34.58	39.25	27.30
Ramachandran plot
Most favored (%)	97.87	99.13	99.12	99.12
Allowed (%)	2.13	0.87	0.88	0.88

^a Numbers in parentheses are for highest‐resolution shell.

^b R_merge = ∑_hkl∑_i|I _i(hkl) – < I(hkl) > |/∑_hkl∑_i I _i(hkl), where I _i(hkl) is the ith observation of reflection hkl and < I(hkl) > is the weighted intensity for all observations i of reflection hkl.

^c R_pim = R _merge[1/(N‐1)]^1/2.

^d The values for CC _1/2 are for the highest‐resolution shell.

^e R_work = ∑| |F _o| − |Fc||/∑|F _o|, where F _o and F _c are the observed and calculated structure factors, respectively.

^f R_free is the cross‐validated R factor computed for a test set of 5% of the reflections, which were omitted during refinement.

2.2. Structure of BV‐bound SyGUN4

The recombinant SyGUN4 was mixed with purchased BV, purified by SEC, crystallized, and diffracted to 1.05‐Å resolution (Table 1). The BV‐bound SyGUN4 structure was determined by molecular replacement method, and its high resolution allows a precise analysis of the BV‐binding mode (Figure 2a). Unlike the bilin chromophores of phytochrome, which typically adopt the C5‐Z,syn, C10‐Z,syn, C15‐Z,anti (ZZZssa) configuration,²⁸ BV bound to SyGUN4 is in a ZZZsss configuration. The A to D pyrrole rings are arranged in a left‐handed (M) helix, with the A‐ and D‐rings forming a parallel‐displaced arrangement.

FIGURE 2.

The BV‐bound SyGUN4 structure. (a) Electron density map for BV (stick and ball model; silver green for carbon, blue for nitrogen, red for oxygen). The 2F _o–F _c map (gray mesh) is contoured at 1.0 σ level. (b) BV in the tetrapyrrole‐binding site. Glycerol (green) and the BV‐interacting residues of SyGUN4 (coffee) are shown as lines. Polar interactions are shown as dotted dashes. (c) Comparison of binding pockets (surface model) of BV‐bound SyGUN4 (top) with D_IX‐bound SyGUN4 (bottom)

The A‐ and B‐rings are clamped in the pocket mainly formed by the α6/α7 loop, and the C‐ and D‐rings are half‐exposed with a solvent glycerol molecule sitting on top of the C ring (Figure 2b). The glycerol hydroxyl groups form polar interactions with the backbone amide and carbonyl groups of Trp192. Polar interactions between BV and SyGUN4 include a hydrogen bond between the A‐ring oxygen and the carbonyl group of Thr190, an electrostatic interaction from the B‐ring propionate to the side chain of Arg214, a hydrogen bond between the B‐ring propionate and the side‐chain amide of Asn211, a hydrogen bond between the D‐ring nitrogen and the side‐chain oxygen of Asn211, and a hydrogen bond between the D‐ring oxygen and the backbone amide of Gln212. While glycerol directly interacts with BV in crystal, it is not needed for BV binding as tested with ITC assay (Figure S2). Titration of BV to SyGUN4 was performed in the absence of glycerol. The K _D value of SyGUN4 to BV is 0.63 μM, which is smaller than the K _D values to D_IX (0.80 μM) and MgD_IX (1.36 μM).¹⁹ The fact that BV has higher affinity than the cyclic porphyrins to the tetrapyrrole‐binding site is consistent with structural comparison (Figure 2c). The pocket clamping the A‐ and B‐rings of BV is tighter than that clamping the A‐ and D‐rings of D_IX, suggesting that the bilin molecule is better accommodated than the more strained porphyrin.

2.3. Structures of PCB‐bound and PΦB‐bound SyGUN4

The synthesis of PCB and PΦB was achieved by heterologous expression in Escherichia coli.²⁹ The PCB‐ or PΦB‐bound SyGUN4 crystals were obtained by co‐lysis of pigment and protein expressing bacteria, followed by co‐purification and crystallization screening. The PCB‐bound and PΦB‐bound SyGUN4 crystals diffracted to 1.10‐ and 1.70‐Å resolutions, respectively (Table 1). PCB differs from PΦB only at the 18 position, where an ethyl group substitutes the vinyl group of PΦB. As the two structures are nearly identical with a root‐mean‐square deviation (RMSD) of 0.083 Å, we use the PCB‐bound SyGUN4 structure to describe their binding mode due to its higher resolution and the lacking of PΦB in natural cyanobacteria (Figures 3a and S3).

FIGURE 3.

The PCB‐bound SyGUN4 structure. (a) Electron density (2F _o–F _c map at 1.0 σ level) for PCB (silver blue for carbon). (b) PCB in the tetrapyrrole‐binding site. SyGUN4 is in bronze, and the two PCB‐interacting waters are shown as red spheres. (c) Conformational comparison of PCB and BV. Left panels, superimposition of the SyGUN4 structures; right panels, superimposition of four pyrrole rings of PCB and BV

PCB also adopts a ZZZsss configuration and forms an M helix, but unlike BV whose C‐ and D‐rings are located outside the pocket, the C‐ and D‐rings of PCB are clamped in the pocket. A water molecule sits near PCB, forming hydrogen bonds with the nitrogens of the B and D pyrrole rings. Another nearby water forms hydrogen bond with the oxygen of D‐ring. The two waters appear to replace the glycerol in the BV‐bound structure for fixing the PCB (Figure 3b). Polar interactions between PCB and SyGUN4 coincide with those in the BV‐bound SyGUN4 structure except for the numbering of A–D rings. The overall structures of SyGUN4 bound with BV and PCB are strikingly similar with an RMSD of 0.14 Å. Their main difference lies in the bilin structure (Figure 3c). The pyrrole rings of BV and PCB are related via a 180°‐rotation along the horizontal axis passing through the 10 position and the center of M helix, while the propionate groups are highly congruent to each other without such rotation. When the four pyrrole rings are superimposed, the orientation of the propionate groups flips. The ZZZsss configuration is the most stable one for linear tetrapyrroles.³⁰ The PCB‐bound and PΦB‐bound SyGUN4 structures provide the atomic coordinates and hence detailed geometry for non‐covalently bound bilin chromophores.

2.4. Conservation of the tetrapyrrole‐binding residues

The tetrapyrrole‐binding site is formed by the α6/α7 loop (Figure 4a). Its length is ~40 residues and its C‐terminal half has a 13‐residue motif, PxGHLPLxNxLRG, where the pyrrole‐interacting asparagine (Asn211 in SyGUN4) is located. Two leucines (Leu209 and Leu213 in SyGUN4) flanking the asparagine provide a hydrophobic platform (Figure 4b). A conserved arginine (Arg214 in SyGUN4) interacts with the propionate group on the pyrrole ring clamped in the pocket. Sequence of the N‐terminal half of the α6/α7 loop is more variable but rich with aromatic residues (Trp183, Trp189, Trp192, Phe196, and Trp198 in SyGUN4). Notably, the aromatic residue (Trp192 in SyGUN4) preceding a cis‐proline stacks on a pyrrole ring, and its opposite residue is the pyrrole‐interacting asparagine. By analogy with heme binding by myoglobin, this aromatic residue is referred to as the distal Trp/Phe/Tyr, and the asparagine is referred to as the proximal Asn (as the proximal His in myoglobin). Hydrophobicity is ensured by the aforementioned aromatic residues on the distal side.

FIGURE 4.

The conserved tetrapyrrole‐binding site. (a) Amino‐acid sequence alignment for the α6/α7 loops. Key residues from the distal and proximal fragments are indicated by red squares and circles, respectively. Numbers on top correspond to the position in SyGUN4. (b) Superimposition of the α6/α7 loops of BV‐bound, PCB‐bound, and D_IX‐bound SyGUN4 structures. The color scheme is as indicated. (c) Comparison of the α6/α7 loops from representatives of known GUN4 structures. The color scheme is as indicated, and the corresponding PDB entry codes are 7E2S, 1Y6I, 1Z3X, 4YKB, and 7E2R for SyGUN4‐BV, SyGUN4, TeGUN4, CrGUN4, and AtGUN4, respectively

To summarize, the tetrapyrrole‐binding site can be described as composed of two fragments: the proximal fragment LxNxLR and the distal fragment Wx_5‐12Ωx₂ΩPx₂FxΩ (where Ω represents any aromatic residue, and the subscript denotes the number of any residue). Conservation of these residues suggests a conserved role for GUN4 from cyanobacteria to higher plants. To examine the tetrapyrrole‐binding site of AtGUN4, we removed one protomer from the dimeric AtGUN4 structure and found a pocket rich in aromatic residues (Figure S4). Compared with the ligand‐free SyGUN4 structure without such pocket and the TeGUN4 and CrGUN4 structures that have partially formed pockets,¹⁸, ²⁰, ²¹ significant conformational difference occurs in a 20‐residue fragment (Met172‐Phe191, including the unobserved 6‐residue fragment) of the α6/α7 loop (Glu170‐Thr213) (Figure 4c). Conformational variation in the α6/α7 loop reflects the flexibility that allows the possibility for accommodating another tetrapyrrole as suggested by Zhang et al.²⁷

3. DISCUSSION

The structures of BV‐bound, PCB‐bound, and PΦB‐bound SyGUN4 reported here reveal the molecular basis for bilin binding. All the three bilin molecules adopt a ZZZsss configuration and an M helix conformation (Figures 2a and 3a), suggesting that GUN4 prefers the M helix to the right‐handed helix. The ZZZsss configuration is the one with the lowest energy among 64 conformers for bilins.³⁰ It appears that the ZZZsss conformer fits better into the binding pocket than the more rigid porphyrin (Figures 2c and 4b). One possible role of GUN4 is to maintain the lowest‐energy conformation, and thus preventing photoisomerization as observed in a cyanobacterial photoreceptor that has an atypical PCB chromophore.³¹ The function of the N‐terminal domain conserved in cyanobacterial and algal GUN4 remains unclear. Its αA–αE arrange like the armadillo‐repeats, which are often found to be involved in protein–protein interactions.³² As the CHLH subunit of magnesium chelatase also has armadillo‐like repeats at its C‐terminal end,³³ possibly GUN4 and CHLH interact through these repeats. Therefore, the N‐terminal domain of GUN4 is proposed to act as an anchor that docks the tetrapyrrole‐loaded C‐terminal domain to CHLH to regulate the chlorophyll branch.

AtGUN4 is a single domain protein. We obtained the full‐length mature AtGUN4 protein without the N‐terminal 69‐residue transit peptide. The resolved ligand‐free structure has eight α‐helices (α1, α2, α2/3, α3–α7) but lacks the plant‐specific extension region that regulates interaction with GUN5/CHLH. The C‐terminal extension (Ala228‐Phe265) is not observed with traceable density disappearing near α5, the helix on the backside of the tetrapyrrole‐binding pocket (Figure 1a,b). We speculate that the extension has a role similar to the cyanobacterial and algal N‐terminal α‐helical bundle domain, and hence its phosphorylation regulates interaction with target protein.⁹

The tetrapyrrole‐binding site is strictly conserved (Figure 4). The proximal fragment LxNxLR provides the platform for binding, and the distal fragment Wx_5‐12Ωx₂ΩPx₂FxΩ forms a hydrophobic environment. The bound tetrapyrrole is solvent accessible from the distal side (Figures 2b and 3b). Pyrrole nitrogens coordinate the solvent molecule near the center of open‐chain tetrapyrroles, where a water molecule is often found in the core of bilin chromophores.³⁴ The pyrrole water resembles the O₂ carried by the heme prosthetic group within myoglobin/hemoglobin. This scenario suggests an intriguing possibility: the bilin‐bound GUN4 may bind singlet oxygen (¹O₂) via the distal side and participate in ¹O₂‐dependent process. Recent proposals predict that ¹O₂ is an activator of retrograde signals³⁵; GUN4 acts either as a ¹O₂ sensor or as a ¹O₂ generator.¹⁴, ¹⁵ Such a possibility offers an explanation of GUN4's involvement in ¹O₂‐mediated retrograde signaling and awaits further exploration.

In this study, we depict the structural basis for bilin binding to GUN4 by solving three complex structures of SyGUN4, identify a conserved binding mode by comparing the known GUN4 structures from cyanobacteria to A. thaliana, and propose the working mechanism for this pleiotropic protein. The predictions, and especially how GUN4 coordinates bilins and porphyrins and regulates the magnesium chelatase activity, will be investigated in the future.

4. MATERIALS AND METHODS

4.1. Protein expression and purification

For AtGUN4 expression, the At3g59400 locus (referred to as Arabidopsis Gene Initiative identifiers) lacking the nucleotide sequence encoding the N‐terminal 69‐residue signal peptide was PCR‐amplified using an A. thaliana cDNA library as template. The amplified sequence was inserted into pET‐22b(+) (Novagen) between the NdeI and XhoI sites. The resulting plasmid encodes a C‐terminal His tag fused to AtGUN4 (residues 70–265), and was transformed into E. coli BL21(DE3) cells for expression using lysogeny broth. Induction was performed with 0.4 mM isopropyl‐β‐D‐thiogalactopyranoside when culture turbidity had an optical density at 600 nm of 0.6. Cells were grown for 18 hr at 16°C before being harvested by centrifugation. Cell pellets were resuspended in lysis buffer (20 mM Tris–HCl, pH 7.5, and 200 mM NaCl) and were sonicated at 0°C. The lysate was cleared by centrifugation and was loaded onto a Ni‐NTA His‐Bind column (Novagen) equilibrated with lysis buffer. The His‐tagged protein was eluted with a 20–500 mM imidazole gradient and the elution fractions were subjected to SDS‐PAGE. Fractions containing AtGUN4 were pooled, concentrated using a 10‐kDa Millipore Amicon centrifugal filter, and further purified using a HiLoad 16/60 Superdex 75 column (GE Healthcare) equilibrated and eluted with lysis buffer. The procedure for expression and purification of SyGUN4 was described previously.¹⁹

4.2. Isothermal titration calorimetry

ITC assays were performed on a MicroCal iTC200 calorimeter (Malvern) at 25°C. BV was purchased from Frontier Scientific (Logan, UT), dissolved with 30 mM NaOH in ITC buffer (20 mM Tris–HCl, pH 7.5, and 150 mM NaCl) to a concentration of 6 mM, and diluted 6× with ITC buffer. The purified GUN4 fractions were pooled, concentrated to 0.1 mM, and changed to ITC buffer plus 5 mM NaOH. Each titration consisted of 20 injections of 2 μl of 1 mM BV into 200 μl of 0.1 mM GUN4 sample (or reference control). Reference experiment was conducted by injecting BV into ITC buffer plus 5 mM NaOH, and the reference values (heats of BV dilution) were subtracted from the isotherm data. The raw ITC data were processed using MicroCal Origin and the integrals were fitted to a single‐site binding model.

4.3. Preparation of bilin‐bound GUN4

The BV‐bound GUN4 sample was obtained by mixing BV and GUN4 (1:1 M ratio) in the lysis buffer plus 5 mM NaOH. The sample was then purified by running through a HiLoad 16/60 Superdex 200 column equilibrated and eluted with lysis buffer. The peak fractions were pooled and concentrated for crystallization.

The preparation of PCB‐ and PΦB‐bound GUN4 samples was achieved by a co‐lysis and co‐purification approach. The procedure for production of PCB and PΦB was established by Gambetta and Lagarias with the following modifications.²⁹ The PCB‐ and PΦB‐synthetic operons within pPL‐PCB and pPL‐PΦB, which encode HO‐1 and PcyA from Synechocystis sp. PCC 6803, and HO‐1 and A. thaliana GUN3, respectively, were inserted into pET‐28a(+) between the restriction sites SalI and NotI, for production of PCB and PΦB. The sense primer was 5′‐ACGCGTCGACGTATGAGTGTCAACTTAGCTTC‐3′ (the SalI site is underlined), and the antisense primer was 5′‐ATAAGAATGCGGCCGCTCATTAGCCGATAAATTG‐3′ for pET‐28a(+)‐PCB or 5′‐ATAAGAATGCGGCCGCTCATTATTGGATAACATCAAATA‐3′ for pET‐28a(+)‐PΦB (the NotI sites are underlined). The resulting two plasmids were transformed into E. coli BL21(DE3) cells, respectively, and the production procedure of PCB and PΦB was same as the expression procedure for GUN4 protein. For PCB or PΦB production, 1 L of lysogeny broth was prepared, and equal volume was used for GUN4 expression. Co‐lysis of cells producing PCB or PΦB and cells expressing GUN4 followed the same procedure as for the lysis of GUN4‐expressing cells alone; the purification procedure for PCB‐ and PΦB‐bound GUN4 samples was also the same as for the protein alone. This co‐lysis and co‐purification approach ensured enough amount of PCB or PΦB needed for GUN4 binding, and the purified PCB‐ and PΦB‐bound GUN4 samples achieved the homogeneity for crystallization.

4.4. Crystallization

Crystallization was performed by sitting‐drop vapor diffusion method using 1 μl protein sample mixed with 1 μl reservoir solution against reservoir well with a volume of 200 μl at 4°C unless specified otherwise. BV‐bound SyGUN4 was concentrated to 6 mg·ml⁻¹, and crystals grew using the reservoir condition of 0.1 M HEPES, pH 7.0, and 30% (v/v) Jeffamine M‐600. PCB‐bound SyGUN4 was concentrated to 7 mg ml⁻¹ and crystals grew using the reservoir condition of 10 mM nickel chloride, 0.1 M Tris–HCl, pH 8.5, and 20% (w/v) PEG 2000 MME at 16°C. PΦB‐bound SyGUN4 was concentrated to 9 mg ml⁻¹ and crystals grew using the reservoir condition of 0.1 M magnesium chloride, 0.1 M HEPES, pH 7.0, and 15% (w/v) PEG 4000. AtGUN4 was concentrated to 5 mg ml⁻¹ and crystals grew using the reservoir condition of 0.1 M Bis‐Tris, pH 6.5, and 28% (w/v) PEG 2000. Before diffraction, the crystals were cryo‐protected with 15% (v/v) glycerol and flash‐cooled in liquid nitrogen.

4.5. Data collection and structure determination

Diffraction data were collected at beamlines BL17U1 and BL19U1 of the Shanghai Synchrotron Radiation Facility.³⁶ Data sets were indexed, integrated, and scaled using HKL‐3000.³⁷ The structure was solved by the molecular replacement with the porphyrin‐bound SyGUN4 structure (PDB entry 4XKC being used as the template model). Initial model building was done with PHENIX AutoBuild.³⁸ Manual corrections and refinement were performed using Coot and the phenix.refine program.³⁹, ⁴⁰ The quality of the structures was evaluated using MolProbity.⁴¹ All structure figures were rendered with PyMOL (Schrödinger, LLC).

AUTHOR CONTRIBUTIONS

Jiu‐Hui Hu: Investigation (lead); visualization (supporting). Jing‐Wen Chang: Investigation (supporting); visualization (supporting). Tao Xu: Investigation (supporting); visualization (supporting). Jia Wang: Investigation (supporting); validation (supporting). Xiao Wang: Investigation (supporting); validation (lead). Rongcheng Lin: Conceptualization (equal); writing—original draft (supporting). Deqiang Duanmu: Conceptualization (equal); writing—original draft (supporting). Lin Liu: Conceptualization (equal); funding acquisition (lead); visualization (lead); writing—original draft (lead).

Supporting information

Table S1 Constructs information.

Figure S1. Bilin binding by AtGUN4.

Figure S2. Isothermal titration of SyGUN4 with BV.

Figure S3. Structures of PΦB and PCB and their binding pockets.

Figure S4. The tetrapyrrole‐binding region in the dimeric structure of AtGUN4.

Hu J‐H, Chang J‐W, Xu T, Wang J, Wang X, Lin R, et al. Structural basis of bilin binding by the chlorophyll biosynthesis regulator GUN4 . Protein Science. 2021;30:2083–2091. 10.1002/pro.4164