Skip to main content
NCBI home page
Infection and Immunity logoLink to Infection and Immunity
. 2021 Sep 16;89(10):e00296-21. doi: 10.1128/IAI.00296-21

Lactate-Induced Dispersal of Neisseria meningitidis Microcolonies Is Mediated by Changes in Cell Density and Pilus Retraction and Is Influenced by Temperature Change

Sara Sigurlásdóttir a, Kenny Lidberg a, Fanglei Zuo a, Jane Newcombe b, Johnjoe McFadden b, Ann-Beth Jonsson a,✉
Editor: Manuela Raffatelluc
PMCID: PMC8445170  PMID: 34125601

ABSTRACT

Neisseria meningitidis is the etiologic agent of meningococcal meningitis and sepsis. Initial colonization of meningococci in the upper respiratory tract epithelium is crucial for disease development. The colonization occurs in several steps and expression of type IV pili (Tfp) is essential for both attachment and microcolony formation of encapsulated bacteria. Previously, we have shown that host-derived lactate induces synchronized dispersal of meningococcal microcolonies. In this study, we demonstrated that lactate-induced dispersal is dependent on bacterial concentration but not on the quorum-sensing system autoinducer-2 or the two-component systems NarP/NarQ, PilR/PilS, NtrY/NtrX, and MisR/MisS. Further, there were no changes in expression of genes related to assembly, elongation, retraction, and modification of Tfp throughout the time course of lactate induction. By using pilT and pptB mutants, however, we found that lactate-induced dispersal was dependent on PilT retraction but not on phosphoglycerol modification of Tfp even though the PptB activity was important for preventing reaggregation postdispersal. Furthermore, protein synthesis was required for lactate-induced dispersal. Finally, we found that at a lower temperature, lactate-induced dispersal was delayed and unsynchronized, and bacteria reformed microcolonies. We conclude that lactate-induced microcolony dispersal is dependent on bacterial concentration, PilT-dependent Tfp retraction, and protein synthesis and is influenced by environmental temperature.

KEYWORDS: Neisseria meningitidis, lactate, microcolony dispersal

INTRODUCTION

Bacterial pathogens encounter constant changes in their environment and must respond quickly to survive and proliferate (1). Neisseria meningitidis is a human-restricted pathogen that is well adapted to survival in the upper respiratory tract. The nasopharyngeal epithelium is the natural reservoir for meningococci; however, bacteria can penetrate the cell barrier and cause sepsis and/or meningitis (2). Initial colonization of the mucosal epithelium is crucial for disease development and is mediated by type IV pili (Tfp). Once Tfp-mediated attachment to the mucosa has been established, meningococci start forming microcolonies. Microcolony formation on host cells stimulates cytoskeletal rearrangement that can contribute to bacterial resistance against physical forces (3). However, to invade the mucosa, bacteria must disperse from the microcolonies and form close contacts with host cells (4–6).

Several factors have been demonstrated to contribute to the dispersal of microcolonies. The ATPase PilT is responsible for Tfp retraction. A pilT deletion mutant exhibited a hyperpiliated aggregative phenotype unable to disperse and form intimate adhesion to host cells (5). It has been proposed that an initial contact with host cells results in increased expression of pptB encoding pilin phosphotransferase B. Upregulation of pptB results in posttranslational modifications (PTM) by adding phosphoglycerol to PilE, which blocks the bundle formation and leads to dispersal (6). Environmental oxygen concentration has been demonstrated to be important for microcolony formation and dispersal in pathogenic Neisseria. At low oxygen concentrations, the loss of the proton motive force leads to microcolony instability and dispersal (7). Recently, we demonstrated that a host-derived metabolite, lactate, can induce microcolony dispersal (8). Lactate is known to promote neisserial metabolic rate and oxygen consumption (9, 10). However, the lactate-induced dispersal did not depend on metabolic utilization and reduced oxygen concentration, suggesting lactate as a signaling cue (8). In addition, we demonstrated that lactate was unable to prevent microcolony formation (8). This suggests that another mechanism must be involved in order to sense lactate. The bacteria had to form microcolonies in order to respond to the metabolite, indicating the involvement of additional factors.

Quorum sensing (QS) plays an important role in bacterial behavior in a density-dependent manner. The role of QS in Neisseria is poorly understood. It is known that meningococcal LuxS produces the QS molecule autoinducer-2 (AI-2) (11, 12). However, the presence of a luxP homologue, encoding the AI-2 receptor protein has not yet been detected, and meningococci have been shown to be nonresponsive to AI-2 (11, 13). Deletion of luxS in meningococci has been reported to affect virulence in a rat model (12). Later, it was speculated that accretion of toxin metabolic intermediate due to deletion of luxS was the reason for the observed phenotype (14).

Another way for bacteria to sense and adapt to external signals is to use two-component systems (TCS). Pathogenic Neisseria is known to encode only four TCS (15). The MisR/MisS system is activated upon host cell contact and regulates the expression of genes involved in adaptation to growth on host cells (16–18). The NarP/NarQ and NtrX/NtrY systems control the expression of genes involved in denitrification, thus promoting anaerobic survival. (19–22). Finally, the meningococci also encode the PilR/PilS system. In Pseudomonas aeruginosa, the PilR/PilS system is known to control piliation (23). A system resembling the PilR/PilS exists in Neisseria, but it was shown not to affect piliation (24).

N. meningitidis can experience fluctuations in temperature during its colonization. It is transmitted through aerosol droplets to the human nasopharynx with an environmental temperature that can alternate between 32 and 34°C (25, 26). Changes in the environmental temperature can affect the virulence of N. meningitidis. A recent study has shown that when N. meningitidis is grown at 32°C, this increases aggregation, adherence to host cells, and biofilm formation compared to processes at 37°C, and the protein levels of virulence factors involved in this process are increased (27). In addition, meningococci use RNA thermosensors to detect temperature changes, which can influence the expression of virulence factors (28, 29).

Here, we sought to understand the mechanism behind lactate-induced microcolony dispersal in N. meningitidis. We demonstrated that the dispersal required protein synthesis and occurred in a density-dependent manner, although the QS system autoinducer AI-2 was not involved. Further, deletion of each of the four TCS had no effect on microcolony dispersal. Deletion of pilT blocked dispersal, suggesting its dependence on Tfp retraction. The phosphoglycerol modification by PptB was required for bacteria to remain dispersed but not for dispersal itself. Finally, we found that dispersed bacteria reformed microcolonies at 32°C but not at 37°C, suggesting that a temperature-dependent mechanism is involved.

RESULTS

Initiation of N. meningitidis lactate-induced microcolony dispersal is dependent on bacterial concentration but not on AI-2 production.

We have previously shown that host-derived lactate induces fast and synchronized microcolony dispersal in N. meningitidis (8). We found that lactate, although required for microcolony dispersal, did not prevent microcolony formation. When bacteria were inoculated in growth medium (107 CFU/ml) with 2 mM lactate, it took 2 h to form microcolonies and, after an additional 30 min, the microcolonies dispersed in a synchronized way (8). We therefore examined whether the lactate-mediated dispersal was dependent on cell density. First, we incubated bacteria at different concentrations in the presence of lactate and followed the timing of dispersal by live-cell microscopy. As shown in Fig. 1A, the initiation of microcolony dispersal was dependent on bacterial concentration; the more bacteria were present in the suspension, the earlier the dispersal occurred. Consequently, we speculated that a density-dependent mechanism such as QS might trigger dispersal. To examine the role of quorum sensing, we constructed a luxS-deficient mutant (ΔluxS). However, the ΔluxS mutant showed no difference in timing of dispersal from that of the wild-type strain (Fig. 1B). Taken together, these results show that N. meningitidis lactate-induced dispersal occurs in a density-dependent manner; however, it is not affected by disruption of AI-2 production.

FIG 1.

FIG 1

Open in a new tab

Initiation of N. meningitidis lactate-induced microcolony dispersal is dependent on bacterial concentration but not on AI-2 production. (A) Bacteria were resuspended in medium with of 2 mM l-lactate, filtered through a 5-μm filter to break preexisting aggregates, and diluted to suspensions with different concentrations ranging from 2 × 106 to 2 × 107 CFU/ml. The timing of microcolony dispersal was examined by live-cell imaging. (B) Induction assays comparing microcolony dispersal of the wild-type (WT) and ΔluxS bacteria. Bacteria were resuspended to 107 CFU/ml in DMEM containing 1% FBS and allowed to form aggregates for 3 h. Lactate solutions were added to the final concentrations of 10 mM at a 1:1 ratio, and microcolony dispersal was followed by live-cell imaging. A black horizontal line represents the 3-h time point of induction in panel B. DMEM was added as a control. The bars represent the means of three independent experiments. Error bars represent the standard deviations. ns, nonsignificant.

The TCS PilR/PilS, NarP/NarQ, NtrY/NtrX, and MisR/MisS are not required for N. meningitidis lactate-induced dispersal.

To further identify the potential signaling behind the lactate-induced dispersal, we examined the role of TCS. In Sigurlásdóttir et al. (8), we found no difference in the mRNA level of the TCS-regulator MisR upon lactate-induced dispersal. However, not only the amount of the response regulator but also the phosphorylation level can affect the genes controlled by the systems (30). We therefore attempted to generate deletion mutants of all the TCS regulators encoded by N. meningitidis FAM20 to examine their involvement. We successfully generated ΔnarP (regulator of NarP/NarQ), ΔpilR (regulator of PilR/PilS), and ΔntrX (regulator of NtrY/NtrX) deletion mutants in strain FAM20 and confirmed them by PCR. Despite several attempts, we were unable to create a FAM20 ΔmisR (regulator of MisR/MisS) deletion mutant, indicating heterogeneity among strains and a possible essential role of MisR in FAM20. Therefore, we used an already existing ΔmisR mutant in the serogroup C isolate N. meningitidis L91543 (31). In induction assays, we observed that deletion of narP and pilR did not affect the timing of dispersal in the presence of lactate (Fig. 2A). Although we observed dispersal of ΔntrX aggregates upon addition of l-lactate, we noted that ΔntrX mutant gave rise to unusual cell morphology in live-cell images, suggesting that ΔntrX mutant might suffer abnormalities during cell division (Fig. 2B). We also observed dispersal of both L91543 wild-type and ΔmisR (previous known as ΔphoP [31]) aggregates upon addition of l-lactate. However, the dispersal duration was longer than that of FAM20 and the microcolonies could not completely disperse (Fig. 2C). In summary, the data suggest that regulators of NarP/NarQ, PilR/PilS, NtrX/NtrY, and MisR/MisS TCS are not involved in lactate-induced N. meningitidis microcolony dispersal.

FIG 2.

FIG 2

Open in a new tab

The TCS PilR/PilS, NarP/NarQ, NtrX/NtrY, and MisR/MisS are not involved in N. meningitidis microcolony dispersal. (A) Induction assays comparing microcolony dispersal of wild-type (WT), ΔnarP, and ΔpilR bacterial strains. Bacteria were resuspended to 107 CFU/ml in DMEM containing 1% FBS and allowed to form aggregates for 3 h. Lactate solutions were added to the final concentrations of 10 mM at a 1:1 ratio, and microcolony dispersal was followed by live-cell imaging. A black horizontal line represents the 3-h time point of induction. DMEM was added as a control. The bars represent the means of three independent experiments. Error bars represent the standard deviations. ns, nonsignificant. (B) Microscopy images showing FAM20 wild-type (WT) and ΔntrX strains upon the addition of 10 mM l-lactate. Black arrows mark examples of abnormal bacterial morphologies. DMEM was added as a control. Representative images are shown for 0.5, 1, and 3 h. Scale bar, 20 μm. (C) Microscopy images showing M96255789 wild-type (WT) and ΔmisR strains upon the addition of 10 mM l-lactate. Black arrows mark minor remaining microcolonies. DMEM was added as a control. Representative images are shown for 0.5 h, 1 h, and 3 h. Scale bar, 20 μm.

N. meningitidis lactate-induced microcolony dispersal requires PilT retraction and PptB to remain dispersed.

Pilus-associated factors are well known to affect clumping and aggregation of the bacteria. We next investigated the transcripts of genes related to assembly (pilE, pilD, and pilQ), elongation (pilF), retraction (pilT), and modification (pptB) of Tfp throughout the time course of lactate induction. However, no significant changes in gene expression were detected at 1, 5, 10, 20, 30, or 60 min after lactate addition (see Fig. S1 in the supplemental material).

Upregulation of pptB upon host-cell contact has previously been shown to hinder Tfp interactions that lead to microcolony dispersal (6). Although mRNA level of pptB indicates that it is not involved in lactate-induced dispersal (8), we wanted to confirm this by using a ΔpptB mutant. We observed that deletion of pptB in FAM20 resulted in increased microcolony formation as described previously (6; data not shown). No difference in the timing of microcolony dispersal was detected compared to the wild type (Fig. 3A). Shortly after dispersal of the ΔpptB mutant, we observed reformation of microcolonies, indicating that PptB might be important for bacteria to remain in a planktonic state (Fig. 3B).

FIG 3.

FIG 3

Open in a new tab

Meningococci depend on PptB to remain dispersed. (A) Microcolony dispersal was examined in wild-type (WT) and ΔpptB bacteria (1 × 107 CFU/ml) upon the addition of 10 mM l-lactate. A black horizontal line represents the 3-h time point of induction. The bars represent the means of three independent experiments. Error bars represent the standard deviations. ns, nonsignificant. (B) Microscopy images showing wild-type (WT) and ΔpptB bacteria upon addition of 10 mM l-lactate. DMEM was added as a control. Representative images are shown for 15, 50, 60, and 90 min after the addition of lactate. Scale bar, 20 μm. White arrows mark examples of microcolonies reformed after dispersal.

Previous studies have shown that a loss of pilT in meningococci results in a hyperpiliated phenotype unable to retract the Tfp (32). Deletion of pilT also inhibits microcolony dispersal and intimate adhesion to host cells. To demonstrate that lactate-induced dispersal in liquid cultures was dependent on PilT-mediated retraction, we used a ΔpilT mutant in induction assays. The addition of lactate did not induce dispersal in the ΔpilT mutant, which remained in aggregates throughout the time-lapse experiment (Fig. 4). This suggests that PilT-mediated retraction rather than PTM, similar to phosphoglycerol modification by PptB, mediates lactate-induced dispersal in FAM20. Since Tfp retraction requires protein synthesis (33), we treated meningococci with spectinomycin 30 min before the addition of lactate. Spectinomycin treatment selectively inhibits protein synthesis, and the treatment delayed the dispersal, suggesting that protein synthesis was required (Fig. 5A). Since antibiotics frequently result in bacterial death, we performed a live-dead staining using flow cytometry. Treatment with spectinomycin did not increase bacterial death (Fig. 5B), suggesting that the phenotype was not due to a substantial proportion of the cells being dead compared to the untreated control. These results suggest that microcolony dispersal induced by lactate is dependent on PilT-mediated retraction and protein synthesis. PptB modification is not required for synchronized dispersal but is necessary for meningococci to remain dispersed.

FIG 4.

FIG 4

Open in a new tab

Lactate-induced dispersal is dependent on PilT retraction. (A) Microcolony dispersal was examined in wild-type (WT) and ΔpilT bacteria (1 × 107 CFU/ml) upon the addition of 10 mM l-lactate. A black horizontal line represents the 3-h time point of induction. The bars represent the means of three independent experiments. Error bars represent the standard deviations. *, P < 0.05. (B) Microscopy images showing wild-type (WT) and ΔpilT bacteria (1 × 107 CFU/ml) upon the addition of 10 mM l-lactate. Representative images are shown for 0.5, 1 h, 2. and 3 h. Scale bar, 20 μm.

FIG 5.

FIG 5

Open in a new tab

Effect of spectinomycin on microcolony dispersal. (A) Bacteria were resuspended to 107 CFU/ml in DMEM containing 1% FBS and allowed to form aggregates for 2.5 h. The antibiotic spectinomycin was added at a final concentration of 100 μg/ml 30 min before the induction assay. After 3 h of incubation, lactate was added to final concentrations of 2 mM at a 1:1 ratio. DMEM was added as a control. The bars represent the means of two independent experiments. Error bars represent the standard deviations. *, P < 0.05. (B) Live-dead assays were performed to verify that bacteria were not killed by spectinomycin. Bacteria were stained in a live/dead assay at 60 min postinduction and analyzed by flow cytometry. Experiment was performed three times in duplicates. ns, nonsignificant.

Temperature affects N. meningitidis dispersal and reformation of microcolonies.

Reduced temperature has been previously shown to affect protein expression of several virulence factors that enhance microcolony formation (27). Since the temperature in the nasopharynx is approximately 33°C ± 2°C (25), we were interested in examining the timing of dispersal at a lower temperature. We performed induction assays as previously described; bacteria were incubated at 32°C for 3 h, 10 mM lactate was added to the microcolonies, and timing of dispersal was examined. At 37°C, the synchronized dispersal phase occurred consistently at the same time, 30 min after lactate addition, and was fully dispersed within 1 h (Fig. 6A, 37°C l-lactate). In contrast, at 32°C, bacteria started to disperse around 1 h postinduction and then reformed microcolonies (Fig. 6A). Two representative examples are shown in Fig. 6B (32°C l-lactate lanes), where the bacteria started to disperse after 1 h and after some time re-entered the aggregation phase. Similar results were found using 2 mM lactate (data not shown). Although bacteria formed aggregates at 32°C and responded to lactate, the dispersal was delayed and microcolonies reformed again after 2 to 3 h. These results indicate that not only the lactate concentrations but also the environmental temperature can influence microcolony dispersal in meningococci.

FIG 6.

FIG 6

Open in a new tab

Reduced environmental temperature promotes reformation of microcolonies after dispersal. (A) Induction assays comparing microcolony dispersal of the wild-type (WT) at 32°C and 37°C. Bacteria were resuspended to 107 CFU/ml in DMEM containing 1% FBS and allowed to form aggregates for 3 h. Lactate was added to final concentrations of 10 mM at a 1:1 ratio, and microcolony dispersal was followed by live-cell imaging. A black horizontal line represents the 3-h time point of induction. DMEM was added as a control. The bars represent the means of three independent experiments. Error bars represent the standard deviations. *, P < 0.05. (B) Microscopy images showing microcolony dispersal at 32°C compared to 37°C. Microcolonies had been allowed to form for 3 h before the addition of 10 mM lactate. For incubation at 32°C, two representative examples are shown for 1, 1.5, 2, and 3 h after induction with l-lactate. DMEM was added as a control. A representative example at 37°C is also shown. Experiment was performed three times in duplicates. Scale bar, 20 μm. White arrows mark examples of microcolonies reformed after dispersal.

DISCUSSION

Understanding the mechanism behind microcolony dispersal is a major challenge in the field of meningococcal pathogenesis. Recently, we discovered that host-derived lactate induced the dispersal of meningococcal microcolonies (8). The answer to the question of how microcolonies respond to increased lactate concentration in the environment could help us to further understand disease progression. In this study, we focused on further characterization of factors contributing to lactate-induced dispersion. We showed that microcolony dispersal depended on bacterial concentration, although the QS-system AI-2 was not involved. Deletion of the response regulators of the TCS NarP/NarQ, PilR/PilS, NtrY/NtrX, and MisR/MisS had no effect on dispersal. Microcolony dispersal was dependent on pilT-mediated retraction and protein synthesis. Our results showed that the activity of PptB was not responsible for lactate-induced dispersal, but it prevented reaggregation. Finally, we suggest that environmental temperature can regulate microcolony formation and dispersal.

We found that dispersal in the presence of lactate was dependent on bacterial density. Little is known about N. meningitidis QS; the bacteria are known to produce functional QS signaling molecule AI-2, and its production is dependent on the luxS gene (12). The effect of QS on meningococcal microcolony dispersal has not been explored yet. Thus far, AI-2 is the only characterized QS system in Neisseria. We observed no differences in the timing of meningococcal microcolony dispersal upon the deletion of luxS. This finding indicates that AI-2-mediated QS does not affect lactate-induced microcolony dispersal. However, QS is involved in biofilm dispersal in several other pathogens, including Pseudomonas aeruginosa, Staphylococcus aureus, and Vibrio cholerae (reviewed in reference 34).

TCS are commonly used by bacterial pathogens to sense metabolite levels and other environmental stimuli such as QS molecules, temperature, pH, antimicrobials, and oxygen levels (35). Since TCS enable bacteria to sense and respond to extracellular signals, we sought to determine whether they might play a role in the lactate-induced dispersal. Lactate has previously been demonstrated to affect the TCS activity. In Escherichia coli, d-lactate can boost activated ArcB QS-regulator (36, 37). Lactate can also activate the three-component system LrbS/LrbA/LrbR in Shewanella putrefaciens. The LrbS/LrbA/LrbR system contains two response regulators that negatively regulate biofilm formation upon activation (38). In addition, pyruvate, the downstream metabolite of lactate, activates three TCS in S. aureus, thereby enhancing its virulence (39). However, inactivation of the meningococcal TCS NarP/NarQ, PilR/PilS, and NtrY/NtrX of MisR/MisS did not prevent the lactate-induced dispersal of microcolonies.

misR and misS deletion mutants have previously been successfully constructed in N. meningitidis serogroups A, B, and C, although not in strain FAM20. Deletion of the genes resulted in phenotypes that were severely growth deficient and sometimes unable to grow at low magnesium levels (15, 18, 31, 40, 41). We were not able to generate a misR deletion mutant in FAM20, and differences between strains might be the reason for this. Expression of misR and misS has been shown to be upregulated upon contact with host cells, and the TCS is proposed to be involved in adaptation to growth on cells (18).

When we examined the ΔntrX mutant in FAM20 by live-cell microscopy, we observed an unusual phenotype suggesting that the mutant was deficient in bacterial cell division. Deletion mutant of ntrX, encoding the regulator of the TCS NtrY/NtrX in Neisseria gonorrhoeae has been described previously. Expression of genes involved in aerobic and anaerobic respiration was downregulated, which resulted in defects in both biofilm formation and survival within human epithelial cells. However, the ntrX mutant was not growth deficient under both aerobic and microaerobic conditions (22). It is not known whether the ntrX mutation affects respiration in meningococci and whether this results in the observed deficiency in cell proliferation.

It is known that the absence of PilF ATPase activity and the presence of PilT ATPase activity in N. meningitidis leads to a rapid disappearance of pili from the bacterial surface and the dispersal of aggregates (42). Therefore, we examined whether the lactate-induced microcolony dispersal was a result of alterations in Tfp biogenesis. However, there were no detectable differences in the transcripts of Tfp-related genes during the process of meningococcal microcolony dispersal.

PptB modifies PilE posttranslationally by conjugating a phosphoglycerol moiety to the serine residue 93, which has a negative impact on pilus-pilus interactions and facilitates the detachment of bacteria from microcolonies (6). We observed that the ΔpptB mutant responded to l-lactate the same way as the wild type, showing that phosphoglycerol modification of PilE was not required for the induction of rapid and synchronized dispersal. We noted, however, that a loss of PptB activity resulted in subsequent reformation of microcolonies upon dispersal. The expression of pptB has been reported to be induced upon contact with host cells controlled by the CREN regulon (17). However, no increase in pptB expression was observed when microcolony dispersal was induced by lactate in liquid cultures (8). The PTM patterns can vary greatly between the different classes (6, 43). The expression level of pptB did not change over time but remained stable up to 60 min after lactate induction. It needs to be taken into account that the serogroup C strain 8013 used by Chamot-Rooke et al. expresses class I Tfp, whereas the FAM20 used in this study expresses class II Tfp.

We did not detect any detachment of bacteria from the microcolonies formed by ΔpilT mutant throughout the time-lapse (Fig. 4). This suggests that the process is dependent on Tfp retraction rather than PTM that block Tfp bundle formation. Since the mRNA and protein level of PilE did not increase upon lactate-induced dispersal (8), it also indicates that the retraction of the Tfp is needed, not the loss of piliation.

The filamentous prophage MDAΦ, expressed by meningococcal disease isolates, plays a role in colonization of the nasopharynx. MDAΦ structure resembles the Tfp and is also assembled through the PilQ porin (44, 45). Billie et al. have shown that bacteria in direct contact with epithelial cells mainly express Tfp mediating adhesion, while bacteria not in direct contact express the MDAΦ form bundles and mediate bacterial interaction (45). The strain used in our experiments, FAM20, is known to possess the MDA island encoding the filamentous prophage (44). The role of MDAΦ in microcolony dispersal has not been established. However, since lactate-induced dispersal has been reported in N. gonorrhoeae, which does not contain the genetic island (46), MDAΦ is unlikely to play a role.

It is becoming more evident that meningococcal virulence factors are thermally regulated. Our results suggest that microcolony dispersal is under thermal control. Although dispersal occurred at 32°C, the timing was not synchronized, and we observed aggregate formation shortly after the dispersal phase ended. Lappann et al. have shown that the protein levels of surface factors contributing to a carrier state are induced at 32°C, resembling the environmental temperature in the upper respiratory tract. Major changes were observed in levels of neisserial heparin binding antigen (NhbA), NMB1030, and adhesion complex protein (ACP), involved in meningococcal aggregation, adhesion, and biofilm formation (27). It is tempting to hypothesize that upregulation of these proteins might play a role in the subsequent reformation of the microcolonies upon dispersal.

Collectively, our results suggest a hypothetical model (Fig. 7). Meningococcal microcolony dispersal is dependent on the bacterial concentration but not on the QS system AI-2 and the TCS. N. meningitidis depends on PilT-mediated retraction and protein synthesis for lactate-induced microcolony dispersal. To remain in a dispersed state, meningococci require the PptB activity and an optimal environmental temperature. These findings contribute to the understanding of the complex actions of N. meningitidis during microcolony dispersal. Further research may provide new targets for disease prevention.

FIG 7.

FIG 7

Open in a new tab

Schematic model of the proposed sequence of events during lactate-induced microcolony dispersal. For meningococci to detach from microcolonies in the presence of lactate, PilT-mediated retraction, protein synthesis, and a certain bacterial density are required. To remain in planktonic phase, meningococci depend on PTM by PptB and optimal environmental temperature. At lower temperatures, meningococci reform microcolonies. Finally, the data suggest that AI-2, PilR/PilS, NarP/NarQ, NtrX/NtrY, and MisR/MisS are not involved.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The Neisseria meningitidis serogroup C strain FAM20 and its isogenic pilT mutant have been described previously (47). The misR (also called phoP) deletion mutant has been described (31). Prior to experiments, the strains were grown for 16 to 18 h on GC agar supplemented with 1% Kellogg medium at 37°C in 5% CO2. Dulbecco modified Eagle medium (DMEM; Thermo Fisher Scientific) containing 1% heat-inactivated fetal bovine serum (FBS; Sigma-Aldrich) was used in all experiments. Kanamycin was used at 50 μg/ml for the selection of mutants.

Construction of mutant strains.

All primers used for cloning are listed in Table 1. To construct deletion mutants, fusion PCRs were performed in two steps. First, upstream (UHS, primer pair number 1) and downstream (DHS, primer pair number 2) sequences of the genes of interest were amplified from chromosomal DNA. The DNA uptake sequence was incorporated into the primers if not present in the upstream and downstream sequences (Table 1). Antibiotic resistance cassettes were amplified by using primer pair number 3. Primers contained overlapping sequences; therefore, a fusion product of UHS_Resistance-cassette_DHS could be created from PCR products using separate fragments as the templates. The resulting product from the fusion PCR could be inserted into the genome of N. meningitidis FAM20 using homologous allelic replacement with spot transformation. High-Fidelity Phusion DNA polymerase (Thermo Fisher Scientific) was used for all PCRs. The FAM20 ΔpptB mutant was created using homologous allelic replacement after spot transformation with ΔpptB mutant chromosomal DNA (6). Mutants were sequenced (MWG Eurofins) to confirm the correct location and sequence.

TABLE 1.

Primers used in the study

Primer Sequence (5′–3′)a Source or reference
luxS_UHS_fwd_1 CACCATAGCCGCATTGTGTGT This study
luxS_UHS_rev_1 GGTCACTAATACGGTCATGGTTTTCGCCACG This study
luxS_DHS_fwd_2 AGTTTTTCTAACAATGCGGCACTTATCAAATG This study
luxS_DHS_rev_2 AAAATAGGGAAGGACGATGC This study
luxS_Kan_fwd_3 ACCATGACCGTATTAGTGACCTGTAGAATTCGAG This study
luxS_Kan_rev_3 TGCCGCATTGTTAGAAAAACTCATCGAGCATCAAATG This study
narP_UHS_fwd_1 GGCGGACGCTTTACCATGA This study
narP_UHS_rev_1 GGTCACTAATACTAATCATTTTGATGCCCGAGAGG This study
narP_DHS_fwd_2 AGTTTTTCTAACACCGTCAAAGTCCACGTTC This study
narP_DHS_rev_2 TTCAGACGGCATGGGATTCGGAATGGAACATTTTAC This study
narP_Kan_fwd_3 CAAAATGATTAGTATTAGTGACCTGTAGAATTCGAG This study
narP_Kan_rev_3 CTTTGACGGTGTTAGAAAAACTCATCGAGCATCAAATG This study
pilR_UHS_fwd_1 AAACAGCCCGGCTCGATTTC This study
pilR_UHS_rev_1 TCTACAGGTCACTAATACCCATTTTCATCAGGGTCATTTCC This study
pilR_DHS_fwd_2 CGATGAGTTTTTCTAAACCCCGATACCATGCAGATA This study
pilR_DHS_rev_2 TGTTTTGTGTCCGTTCGG This study
pilR_Kan_fwd_3 CCTGATGAAAATGGGTATTAGTGACCTGTAGAATTCGAGCT This study
pilR_Kan_rev_3 TGGTATCGGGGTTTAGAAAAACTCATCGAGCATCAAATG This study
ntrY_UHS_fwd_1 CAAGGAAATGCTGCACAACG This study
ntrY_UHS_rev_1 TCTACAGGTCACTAATACTAACCTTCGTCCTGCAGGATTT This study
ntrY_DHS_fwd_2 CGATGAGTTTTTCTAAAATGTGGCGGAAAGCCAAAA This study
ntrY_DHS_rev_2 TTCAGACGGCATTCTGAAAACAAAAGCCCGCA This study
ntrY_Kan_fwd_3 GCAGGACGAAGGTTAGTATTAGTGACCTGTAGAATTCGAGC This study
ntrY_Kan_rev_3 TTTCCGCCACATTTTAGAAAAACTCATCGAGCATCAAATG This study
rpsJ_fwd TTGGAAATCCGCACCCACTT 48
rpsJ_rev TACATCAACACCGGCCGACAAA 48
pilF_fwd TCCACCCTGCACACCAATAAT This study
pilF_rev GAACACAGCCTGCGTAAAAGAC This study
pilT_fwd GTCGACCGTATCGTGGACGTATT 49
pilT_rev TTCAGCAGGTTTTGGGAGATGAC 49
pilE_fwd TATTCCGACAACGGCACATTCCC 48
pilE_rev CCTTCAACCTTAACCGATGCCA 48
pilD_fwd TCGGTATGGGCAACGGAGAT This study
pilD_rev CAGCGAGGAAACAAAAATCAGC This study
pilQ_fwd GTCAAAATCAACAAGGACTCGC This study
pilQ_rev TTGTCTTCTTCATAAATACCGCC This study
pptB_fwd AAGGCGTGGAAGTCATCATC 8
pptB_rev TGTTTGAGGTAGGTAGCGGAAGGT 8
Open in a new tab
a

The DNA uptake sequence is market in italics. Overlapping sequences for fusion PCR are underlined.

Live-cell imaging.

N. meningitidis FAM20 and its isogenic mutants were resuspended in prewarmed DMEM containing 1% FBS, filtered through 5-μm filters to break existing aggregates, and diluted to preferred bacterial concentrations (2 × 107, 1 × 107, 8 × 106, 6 × 106, 4 × 106, and 2 × 106) in the presence of 2 mM l-lactate (L7022; Sigma-Aldrich). Microcolony dispersal was observed using time-lapse microscopy (Axiovert Z1; Zeiss). Three positions were chosen per well, and images were acquired every 10 min for 6 h using a 40× objective. The images were independently evaluated by visual inspection. The aggregation phase was defined as the time from the start of incubation until dispersal of bacteria starts (i.e., when the microcolonies reached maximal size and started to decrease size). The dispersal phase was defined as the time from initiation of bacterial dispersal until microcolonies were no longer visible in the images. The planktonic phase was described as dispersed single bacteria. For wild-type strain and 5 mM lactate, the dispersal was rapid and obvious and occurred from one image to another, i.e., within a 10-min time frame.

Induction assay.

The induction assays have been described previously (8). Briefly, bacteria were resuspended in prewarmed DMEM containing 1% FBS, filtered through 5-μm filters, and diluted to 107 CFU/ml. The bacterial solutions were transferred to 24-well glass-bottom plates (MatTek) and allowed to grow and form microcolonies for 3 h at 32°C or 37°C in a 5% CO2 environment in a live-cell observer (Axiovert Z1; Zeiss). Prewarmed DMEM supplemented with sodium l-lactate (L7022; Sigma-Aldrich) was added to microcolonies at a 1:1 ratio at final concentrations of 10 mM. During treatment with spectinomycin, the antibiotic was added at a final concentration of 100 μg/ml 30 min before the induction. Three positions were chosen per well, and images were acquired every 5 to 10 min for 4 or 5 h using a 40× objective. The aggregation phase is described as the start of incubation until the dispersal of bacteria starts. The dispersal phase is described as the initiation of bacterial dispersal until no aggregates are observed. The planktonic phase is described as dispersed single bacteria.

Live-dead staining.

Bacteria were treated with 100 μg/ml of spectinomycin 30 min before induction with l-lactate. At 60 min postinduction, bacteria were stained with a Live/Dead BacLight bacterial viability kit (L7012; Invitrogen) according to the manufacturer’s protocol. The samples were analyzed by flow cytometry using an LSRFortessa (BD Biosciences) with a PI channel for dead cells and FITC for live cells. For each sample, 15,000 bacterial cells were counted, and data are presented as the percentages of dead or alive bacteria within this population. Data were analyzed with the FlowJo software.

Quantitative real-time PCR analysis.

All of the primers used for quantitative real-time PCR analysis are listed in Table 1. Induction assays with l-lactate and control DMEM were performed on FAM20 wild type as indicated above in 1-ml volumes in 2.0-ml Eppendorf tubes. Samples were collected at 1, 5, 10, 20, 30, and 60 min immediately after the addition of l-lactate or DMEM and treated with RNAprotect bacterial reagent (Qiagen). Total RNA was purified using an RNeasy plus minikit (Qiagen) according to the manufacturer’s protocol. Reverse transcription was performed with random hexamers using a SuperScript VILO Master Mix (Thermo Fisher). The resulting cDNA was amplified using LightCycler 480 SYBR green I Master mix (Roche) in a LightCycler 480 real-time PCR system. The PCR program was adapted from the manufacturer using an annealing temperature of 55°C. The 30S ribosomal protein rpsJ was used as a reference gene. The target mRNA levels in the samples were normalized to the reference gene and then compared to the value of the noninduced DMEM control sample.

Statistical analysis.

For statistical analysis in induction assays, the differences between the lengths of the dispersal phase were analyzed. In Excel, two-tailed and unpaired Student t tests were used to compare differences between two groups. In GraphPad Prism (version 5), analysis of variance with Bonferroni’s post hoc test was used to compare differences between multiple groups. P values below 0.05 were accepted as statistically significant.

ACKNOWLEDGMENTS

We thank Guillaume Duménil for the generous gift of ΔpptB chromosomal DNA (6). We also thank Sunil D. Saroj for careful reading of the manuscript.

This study was supported by the Swedish Research Council (Dnr 2016-01279 and 2019-01355 to A.-B.J.), The Swedish Cancer Society (A.-B.J.), and Sven och Lilly Lawskis Fond för Naturvetenskaplig Forskning (N2018-0030 and P2019-0001 to F.Z.).

Footnotes

Supplemental material is available online only.

Supplemental file 1
Supplemental material. Download IAI.00296-21-s0001.pdf, PDF file, 0.3 MB (328.4KB, pdf)

Contributor Information

Ann-Beth Jonsson, Email: ann-beth.jonsson@su.se.

Manuela Raffatellu, University of California—San Diego School of Medicine.

REFERENCES

  • 1.Fang FC, Frawley ER, Tapscott T, Vázquez-Torres A. 2016. Bacterial stress responses during host infection. Cell Host Microbe 20:133–143. 10.1016/j.chom.2016.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Stephens DS. 2009. Biology and pathogenesis of the evolutionarily successful, obligate human bacterium Neisseria meningitidis. Vaccine 27(Suppl 2):B71–B77. 10.1016/j.vaccine.2009.04.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mikaty G, Soyer M, Mairey E, Henry N, Dyer D, Forest KT, Morand P, Guadagnini S, Prévost MC, Nassif X, Duménil G. 2009. Extracellular bacterial pathogen induces host cell surface reorganization to resist shear stress. PLoS Pathog 5:e1000314. 10.1371/journal.ppat.1000314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pujol C, Eugène E, de Saint Martin L, Nassif X. 1997. Interaction of Neisseria meningitidis with a polarized monolayer of epithelial cells. Infect Immun 65:4836–4842. 10.1128/iai.65.11.4836-4842.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Pujol C, Eugene E, Marceau M, Nassif X. 1999. The meningococcal PilT protein is required for induction of intimate attachment to epithelial cells following pilus-mediated adhesion. Proc Natl Acad Sci U S A 96:4017–4022. 10.1073/pnas.96.7.4017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chamot-Rooke J, Mikaty G, Malosse C, Soyer M, Dumont A, Gault J, Imhaus AF, Martin P, Trellet M, Clary G, Chafey P, Camoin L, Nilges M, Nassif X, Duménil G. 2011. Posttranslational modification of pili upon cell contact triggers Neisseria meningitidis dissemination. Science 331:778–782. 10.1126/science.1200729. [DOI] [PubMed] [Google Scholar]
  • 7.Dewenter L, Volkmann TE, Maier B. 2015. Oxygen governs gonococcal microcolony stability by enhancing the interaction force between type IV pili. Integr Biol (Camb) 7:1161–1170. 10.1039/C5IB00018A. [DOI] [PubMed] [Google Scholar]
  • 8.Sigurlásdóttir S, Engman J, Eriksson OS, Saroj SD, Zguna N, Lloris-Garcera P, Ilag LL, Jonsson AB. 2017. Host cell-derived lactate functions as an effector molecule in Neisseria meningitidis microcolony dispersal. PLoS Pathog 13:e1006251. 10.1371/journal.ppat.1006251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Britigan BE, Klapper D, Svendsen T, Cohen MS. 1988. Phagocyte-derived lactate stimulates oxygen consumption by Neisseria gonorrhoeae. An unrecognized aspect of the oxygen metabolism of phagocytosis. J Clin Invest 81:318–324. 10.1172/JCI113323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Exley RM, Shaw J, Mowe E, Sun YH, West NP, Williamson M, Botto M, Smith H, Tang CM. 2005. Available carbon source influences the resistance of Neisseria meningitidis against complement. J Exp Med 201:1637–1645. 10.1084/jem.20041548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dove JE, Yasukawa K, Tinsley CR, Nassif X. 2003. Production of the signaling molecule, autoinducer-2, by Neisseria meningitidis: lack of evidence for a concerted transcriptional response. Microbiology (Reading) 149:1859–1869. 10.1099/mic.0.26185-0. [DOI] [PubMed] [Google Scholar]
  • 12.Winzer K, Sun Y-h, Green A, Delory M, Blackley D, Hardie KR, Baldwin TJ, Tang CM. 2002. Role of Neisseria meningitidis luxS in cell-to-cell signaling and bacteremic infection. Infect Immun 70:2245–2248. 10.1128/IAI.70.4.2245-2248.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schauder S, Penna L, Ritton A, Manin C, Parker F, Renauld-Mongénie G. 2005. Proteomics analysis by two-dimensional differential gel electrophoresis reveals the lack of a broad response of Neisseria meningitidis to in vitro-produced AI-2. J Bacteriol 187:392–395. 10.1128/JB.187.1.392-395.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Heurlier K, Vendeville A, Halliday N, Green A, Winzer K, Tang CM, Hardie KR. 2009. Growth deficiencies of Neisseria meningitidis pfs and luxS mutants are not due to inactivation of quorum sensing. J Bacteriol 191:1293–1302. 10.1128/JB.01170-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tzeng Y-LL, Zhou X, Bao S, Zhao S, Noble C, Stephens DS. 2006. Autoregulation of the MisR/MisS two-component signal transduction system in Neisseria meningitidis. J Bacteriol 188:5055–5065. 10.1128/JB.00264-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Deghmane A-EE, Larribe M, Giorgini D, Sabino D, Taha M-KK. 2003. Differential expression of genes that harbor a common regulatory element in Neisseria meningitidis upon contact with target cells. Infect Immun 71:2897–2901. 10.1128/IAI.71.5.2897-2901.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Morelle S, Carbonnelle E, Nassif X. 2003. The REP2 repeats of the genome of Neisseria meningitidis are associated with genes coordinately regulated during bacterial cell interaction. J Bacteriol 185:2618–2627. 10.1128/JB.185.8.2618-2627.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jamet A, Rousseau C, Monfort J-BB, Frapy E, Nassif X, Martin P. 2009. A two-component system is required for colonization of host cells by meningococcus. Microbiology (Reading) 155:2288–2295. 10.1099/mic.0.027755-0. [DOI] [PubMed] [Google Scholar]
  • 19.Overton TW, Whitehead R, Li Y, Snyder LA, Saunders NJ, Smith H, Cole JA. 2006. Coordinated regulation of the Neisseria gonorrhoeae-truncated denitrification pathway by the nitric oxide-sensitive repressor, NsrR, and nitrite-insensitive NarQ-NarP. J Biol Chem 281:33115–33126. 10.1074/jbc.M607056200. [DOI] [PubMed] [Google Scholar]
  • 20.Jamet A, Euphrasie D, Martin P, Nassif X. 2013. Identification of genes involved in Neisseria meningitidis colonization. Infect Immun 81:3375–3381. 10.1128/IAI.00421-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lissenden S, Mohan S, Overton T, Regan T, Crooke H, Cardinale JA, Householder TC, Adams P, O’Conner CD, Clark VL, Smith H, Cole JA. 2000. Identification of transcription activators that regulate gonococcal adaptation from aerobic to anaerobic or oxygen-limited growth. Mol Microbiol 37:839–855. 10.1046/j.1365-2958.2000.02050.x. [DOI] [PubMed] [Google Scholar]
  • 22.Atack JM, Srikhanta YN, Djoko KY, Welch JP, Hasri NH, Steichen CT, Vanden Hoven RN, Grimmond SM, Othman DS, Kappler U, Apicella MA, Jennings MP, Edwards JL, McEwan AG. 2013. Characterization of an ntrX mutant of Neisseria gonorrhoeae reveals a response regulator that controls expression of respiratory enzymes in oxidase-positive proteobacteria. J Bacteriol 195:2632–2641. 10.1128/JB.02062-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hobbs M, Collie ES, Free PD, Livingston SP, Mattick JS. 1993. PilS and PilR, a two-component transcriptional regulatory system controlling expression of type 4 fimbriae in Pseudomonas aeruginosa. Mol Microbiol 7:669–682. 10.1111/j.1365-2958.1993.tb01158.x. [DOI] [PubMed] [Google Scholar]
  • 24.Carrick CS, Fyfe JA, Davies JK. 2000. The genome of Neisseria gonorrhoeae retains the remnants of a two-component regulatory system that once controlled piliation. FEMS Microbiol Lett 186:197–201. 10.1111/j.1574-6968.2000.tb09104.x. [DOI] [PubMed] [Google Scholar]
  • 25.Keck T, Leiacker R, Riechelmann H, Rettinger G. 2000. Temperature profile in the nasal cavity. Laryngoscope 110:651–654. 10.1097/00005537-200004000-00021. [DOI] [PubMed] [Google Scholar]
  • 26.Laver JR, Hughes SE, Read RC. 2015. Neisserial molecular adaptations to the nasopharyngeal niche. Adv Microb Physiol 66:323–355. 10.1016/bs.ampbs.2015.05.001. [DOI] [PubMed] [Google Scholar]
  • 27.Lappann M, Otto A, Brauer M, Becher D, Vogel U, Johswich K. 2016. Impact of moderate temperature changes on Neisseria meningitidis adhesion phenotypes and proteome. Infect Immun 84:3484–3495. 10.1128/IAI.00584-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Loh E, Kugelberg E, Tracy A, Zhang Q, Gollan B, Ewles H, Chalmers R, Pelicic V, Tang CM. 2013. Temperature triggers immune evasion by Neisseria meningitidis. Nature 502:237–240. 10.1038/nature12616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Loh E, Lavender H, Tan F, Tracy A, Tang CM. 2016. Thermoregulation of meningococcal fHbp, an important virulence factor and vaccine antigen, is mediated by anti-ribosomal binding site sequences in the open reading frame. PLoS Pathog 12:e1005794. 10.1371/journal.ppat.1005794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Groisman EA. 2016. Feedback control of two-component regulatory systems. Annu Rev Microbiol 70:103–124. 10.1146/annurev-micro-102215-095331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Newcombe J, Eales-Reynolds LJ, Wootton L, Gorringe AR, Funnell SG, Taylor SC, McFadden JJ. 2004. Infection with an avirulent phoP mutant of Neisseria meningitidis confers broad cross-reactive immunity. Infect Immun 72:338–344. 10.1128/IAI.72.1.338-344.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wolfgang M, Lauer P, Park HS, Brossay L, Hebert J, Koomey M. 1998. PilT mutations lead to simultaneous defects in competence for natural transformation and twitching motility in piliated Neisseria gonorrhoeae. Mol Microbiol 29:321–330. 10.1046/j.1365-2958.1998.00935.x. [DOI] [PubMed] [Google Scholar]
  • 33.Merz AJ, So M, Sheetz MP. 2000. Pilus retraction powers bacterial twitching motility. Nature 407:98–102. 10.1038/35024105. [DOI] [PubMed] [Google Scholar]
  • 34.Solano C, Echeverz M, Lasa I. 2014. Biofilm dispersion and quorum sensing. Curr Opin Microbiol 18:96–104. 10.1016/j.mib.2014.02.008. [DOI] [PubMed] [Google Scholar]
  • 35.Beier D, Gross R. 2006. Regulation of bacterial virulence by two-component systems. Curr Opin Microbiol 9:143–152. 10.1016/j.mib.2006.01.005. [DOI] [PubMed] [Google Scholar]
  • 36.Rodriguez C, Kwon O, Georgellis D. 2004. Effect of d-lactate on the physiological activity of the ArcB sensor kinase in Escherichia coli. J Bacteriol 186:2085–2090. 10.1128/JB.186.7.2085-2090.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Georgellis D, Kwon O, Lin EC. 1999. Amplification of signaling activity of the arc two-component system of Escherichia coli by anaerobic metabolites: an in vitro study with different protein modules. J Biol Chem 274:35950–35954. 10.1074/jbc.274.50.35950. [DOI] [PubMed] [Google Scholar]
  • 38.Liu C, Yang J, Liu L, Li B, Yuan H, Liu W. 2017. Sodium lactate negatively regulates Shewanella putrefaciens CN32 biofilm formation via a three-component regulatory system (LrbS-LrbA-LrbR). Appl Environ Microbiol 83:e00712-17. 10.1128/AEM.00712-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Harper L, Balasubramanian D, Ohneck EA, Sause WE, Chapman J, Mejia-Sosa B, Lhakhang T, Heguy A, Tsirigos A, Ueberheide B, Boyd JM, Lun DS, Torres VJ. 2018. Staphylococcus aureus responds to the central metabolite pyruvate to regulate virulence. mBio 9:e02272-17. 10.1128/mBio.02272-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Johnson CR, Newcombe J, Thorne S, Borde HA, Eales-Reynolds LJ, Gorringe AR, Funnell SG, McFadden JJ. 2004. Generation and characterization of a PhoP homologue mutant of Neisseria meningitidis. Mol Microbiol 39:1345–1355. 10.1111/j.1365-2958.2001.02324.x. [DOI] [PubMed] [Google Scholar]
  • 41.Tzeng Y-LL, Datta A, Ambrose K, Lo M, Davies JK, Carlson RW, Stephens DS, Kahler CM. 2004. The MisR/MisS two-component regulatory system influences inner core structure and immunotype of lipooligosaccharide in Neisseria meningitidis. J Biol Chem 279:35053–35062. 10.1074/jbc.M401433200. [DOI] [PubMed] [Google Scholar]
  • 42.Aubey F, Corre J-P, Kong Y, Xu X, Obino D, Goussard S, Lapeyrere C, Souphron J, Couturier C, Renard S, Duménil G. 2019. Inhibitors of the Neisseria meningitidis PilF ATPase provoke type IV pilus disassembly. Proc Natl Acad Sci U S A 116:8481–8486. 10.1073/pnas.1817757116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Gault J, Ferber M, Machata S, Imhaus A-FF, Malosse C, Charles-Orszag A, Millien C, Bouvier G, Bardiaux B, Péhau-Arnaudet G, Klinge K, Podglajen I, Ploy MC, Seifert HS, Nilges M, Chamot-Rooke J, Duménil G. 2015. Neisseria meningitidis type IV pili composed of sequence invariable pilins are masked by multisite glycosylation. PLoS Pathog 11:e1005162. 10.1371/journal.ppat.1005162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Meyer J, Brissac T, Frapy E, Omer H, Euphrasie D, Bonavita A, Nassif X, Bille E. 2016. Characterization of MDAΦ, a temperate filamentous bacteriophage of Neisseria meningitidis. Microbiology (Reading) 162:268–282. 10.1099/mic.0.000215. [DOI] [PubMed] [Google Scholar]
  • 45.Bille E, Meyer J, Jamet A, Euphrasie D, Barnier J-PP, Brissac T, Larsen A, Pelissier P, Nassif X. 2017. A virulence-associated filamentous bacteriophage of Neisseria meningitidis increases host-cell colonization. PLoS Pathog 13:e1006495. 10.1371/journal.ppat.1006495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Klee SR, Nassif X, Kusecek B, Merker P, Beretti JL, Achtman M, Tinsley CR. 2000. Molecular and biological analysis of eight genetic islands that distinguish Neisseria meningitidis from the closely related pathogen Neisseria gonorrhoeae. Infect Immun 68:2082–2095. 10.1128/IAI.68.4.2082-2095.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Jones A, Georg M, Maudsdotter L, Jonsson AB. 2009. Endotoxin, capsule, and bacterial attachment contribute to Neisseria meningitidis resistance to the human antimicrobial peptide LL-37. J Bacteriol 191:3861–3868. 10.1128/JB.01313-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kuwae A, Sjölinder H, Eriksson J, Eriksson S, Chen Y, Jonsson A-B. 2011. NafA negatively controls Neisseria meningitidis piliation. PLoS One 6:e21749. 10.1371/journal.pone.0021749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lee SW, Higashi DL, Snyder A, Merz AJ, Potter L, So M. 2005. PilT is required for PI (3,4,5)P3-mediated crosstalk between Neisseria gonorrhoeae and epithelial cells. Cell Microbiol 7:1271–1284. 10.1111/j.1462-5822.2005.00551.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Supplemental material. Download IAI.00296-21-s0001.pdf, PDF file, 0.3 MB (328.4KB, pdf)

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES