Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

Sayaka Takahashi; Shingo Takada; Hiroki Yamanaka; Reiji Masuda; Akihide Kasai

doi:10.1371/journal.pone.0255576

. 2021 Sep 16;16(9):e0255576. doi: 10.1371/journal.pone.0255576

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

Sayaka Takahashi ^1,^2,^3,^*, Shingo Takada ⁴, Hiroki Yamanaka ^5,⁶, Reiji Masuda ³, Akihide Kasai ⁷

Editor: Hideyuki Doi⁸

PMCID: PMC8445453 PMID: 34529685

Abstract

Environmental DNA (eDNA) analysis with species-specific primer/probe sets is promising as a tool to quantify fish abundance and distribution. Nevertheless, several factors could reduce the accuracy of this method. Here, we aimed to analyze whether intraspecific variability and diel activity rhythm affect eDNA detection in Japanese eels (Anguilla japonica). For this purpose, we performed tank experiments focusing on two points. First, we assessed the effects of base pair sequences with probe region polymorphism on eDNA detection. Next, we evaluated the influences of diel rhythm, activity, and individual differences in eDNA release rate on eDNA concentration. We examined the base pair sequences of the probe regions of 20 individuals and found genetic mismatches in two of them. The eDNA concentration was estimated to be much lower in these variants than it was in the other individuals. We conducted a rearing experiment on four non-variant individuals to explore the influences of diel activity and inter-individual differences in eDNA detection. Nocturnal eel activity was reflected in the eDNA detection but the inter-individual differences remained large. The observed weak positive correlations between eDNA concentration and activity suggest that eDNA emission is highly dependent on basal metabolism. The present study suggests that consideration of polymorphic sites at the probe region and diel activity rhythms should improve the accuracy and precision of abundance estimation through eDNA. Such fine-tuning is applicable not only for eels but also for other fishes to be targeted by eDNA technology.

Introduction

Since antiquity, Japanese eel (Anguilla japonica) has been an important food fish in East Asian countries. However, its populations have dramatically declined in recent decades because of climate change and overexploitation [1]. Consequently, it has been listed as “an endangered species in the near future” [2]. To protect natural Japanese eel populations, it is necessary to determine when, where, and how many animals are located in each habitat. Japanese eels spawn near the Mariana Islands [3]. The newly hatched preleptocephali and more developed leptocephali are transported northward by the Kuroshio Current [4]. They then metamorphose into glass eels when they reach rivers or brackish water, develop into elvers, become yellow and silver eels, and return to the offshore spawning site [5]. However, the precise spatiotemporal distributions of the eels in various river sites are yet to be established. Today, environmental DNA (eDNA) analyses have been applied in the establishment of eel distribution [6,7].

Analyses of eDNA estimate target species composition and abundance using DNA fragments left by animals and plants in water, soil, and air [8–12]. The technique has been used for spatiotemporal monitoring of endangered land and aquatic animal species [13] such as marine sturgeon [14] and freshwater carp [15]. It has also been applied to detect the reproductive activity of endangered species such as freshwater Macquarie perch [16]. It is necessary to identify factors that influence eDNA detection when eDNA analysis is used to quantify species.

In quantitative PCR (qPCR) analyses using species-specific primers/probes, mutations and polymorphisms may influence eDNA detection rate. Base pair mismatches between target species and probes have been reported to reduce the detection of DNA in humans [17] or primers in fish [18]. In addition, haplotype diversity in Japanese eel [19] may affect the sensitivity of eDNA detection activities. This is a fundamental problem that should be adequately addressed when developing eDNA assays.

Conversely, ecological and physiological traits of target species could pose challenges when eDNA concentrations are used as proxies in biomass estimation activities. Some field studies demonstrated that there is a positive correlation between eDNA concentration and fish biomass/abundance in freshwater [13,20–24] and marine [25–28] environments. Tank experiments have also demonstrated positive correlations between fish size and eDNA concentrations in bluegill [29] and fish abundance and eDNA concentrations in jack mackerel [30]. Nevertheless, other researchers reported only weak quantitative relationships between biomass and eDNA abundance [6,31–33]. Individual differences, such as metabolic rate, stress conditions, life stage, and physiological or behavioral status, have been reported to potentially influence eDNA emission rates in salamanders [34]. Furthermore, Thalinger et al. [35] observed a positive correlation between eDNA detection and fish activity in seven fish species in freshwater.

There are inconsistencies among studies and discrepancies among target species with regard to the relationship between sampling time and eDNA concentration. Nocturnal carp eDNA concentrations increased 500-fold at night when fish biomass only doubled at a feeding site [36]. In addition, eDNA concentrations of nocturnal riverine giant salamander [21,37] and tailed frog [21] did not differ between the daytime and nighttime.

Attempts have been made to use eDNA analysis to detect Japanese eel in rivers [6,38] and in the ocean [39]. For Japanese eels, there is a positive correlation between eDNA concentration and wet weight, body length [40]. The eDNA concentration increases 10–200× during spawning [39]. The degradation of eDNA also affects its detection. Water temperature has a significant positive influence on eDNA degradation in Japanese eel [41]. Individual differences in eDNA concentration have been detected among eels of the same size [40]. Eel ecophysiology and behavior markedly affect the eDNA release rate.

The Japanese eel is nocturnal. During the daytime, it hides in holes or mud in rivers or ponds [42,43]. In captivity, eels often remain in pipes during the day and leave pipes at night in search of food [44]. Light, water temperature, tidal cycles, the moon phase, and other external environmental factors influence eel ecophysiology and behavior [44]. To accurately evaluate Japanese eel biomass through eDNA analysis, it is necessary to clarify whether there is diurnal variation in the eDNA concentration of eels.

The aim of the present study was to investigate factors influencing Japanese eel eDNA concentrations. Clarifying such factors could facilitate the development of appropriate tools for the reliable estimation of the biomass of Japanese eel and other species using eDNA. To this end, we performed tank experiments focusing on two points. First, we assessed the effects of base pair sequences with probe region polymorphism on eDNA detection (Experiment 1). Second, we evaluated the influences of diel rhythm, activity, and individual differences in eDNA release rate on eDNA concentration (Experiment 2).

Materials and methods

Ethics statement

This study was conducted in accordance with the guidelines of the Regulation on Animal Experimentation of Kyoto University, Kyoto, Japan. No fish or other animals were harmed in any of the experiments performed herein. No ethical approval was required for the experimental procedure due to the common consumption of cultured eel. All 20 eels were housed for use in further research.

Experiment 1: Effects of polymorphism on eDNA detection

Fish selection, experimental tank design, and water collection

The effects of probe region base pair sequence polymorphism on eDNA detection were examined. Twenty Japanese eels (Anguilla japonica, SL = 494 ± 18 mm, W = 159 ± 10 g) were purchased from a commercial provider (Unagikobo, Daigotsusyo Ltd., Shizuoka, Japan) and transferred to the Maizuru Fisheries Research Station on May 23, 2018. The animals cultured in Miyazaki (Japan) were received there as glass eels collected by local fishermen ~6 mo before purchase. No individual had any visible injury.

Six acrylic tanks (L × W × H = 900 mm × 300 mm × 300 mm; I.D. L × I.D. W = 890 mm × 290 mm; V = 100 L) were arranged in parallel, bleached with 0.1% (w/v) sodium hypochlorite, enclosed by a blue vinyl sheet on all sides, and covered on the bottom with a black vinyl sheet. They were filled to 21 cm depth with tap water (54 L) dechlorinated by a water purifier (Standard Neo; Marfied, Kanagawa, Japan). Aeration was provided by two air stones placed at each corner of the long axis of each tank.

Three cycles of a 1-week experiment were conducted from May 25 to June 14, 2018. Operators wore nitrile gloves during sampling and all procedures. Six individual eels that were not used in an experiment were placed one by one in each tank per cycle. The room temperature was 24 ± 1°C. At 10:00 daily, 500 mL water was collected through a vinyl tube with a siphon from mid-depth of each tank and stored in a plastic bottle. The tanks were bleached with 0.1% (w/v) sodium hypochlorite and rinsed with tap water 1 d before each cycle. Before eel introduction, the DNA concentrations were determined for the tanks and found to be negative in the first cycle and positive in the second and third cycles. Nevertheless, the pre-eel DNA concentrations divided by those measured on the first day of each respective cycle were < 3.4% in the latter cycles. This foreign DNA contamination had a negligible impact on the subsequent quantitative analyses. Eighteen of the 20 eels were used in this experiment. The other two were kept in separate buckets for 1 h on June 14, 2018. Samples of the water surrounding all 20 eels were collected in 500-mL plastic bottles and used in the base pair sequence analyses. The plastic bottles were bleached with 0.1% (w/v) sodium hypochlorite and prewashed twice with sampling water before sample collection. After sampling, small volumes of purified tap water were added to the tanks at feeding and bottom cleaning. Individual eels were labeled with elastomer tags in preparation for the subsequent experiment.

Water filtration and eDNA extraction

Water filtration and eDNA extraction were performed according to the instructions in the Environmental DNA Sampling and Experiment Manual (v. 2.1) [45] with slight modification. Each 500-mL water sample was passed through an aspirator fitted with a glass fiber filter (GF/F; 0.7 μm pore size; 47-mm diameter; Whatman, Maidstone, UK). Each 500-mL distilled water sample was filtered once per sampling day and used as a blank control. After every filtration process, the filtration devices were bleached with 0.1% (w/v) sodium hypochlorite for 5 min, rinsed with tap water, and rinsed again with distilled water. The filters were wrapped in aluminum foil, placed in plastic bags, and stored at −20°C until DNA extraction. The entire process from sampling to preservation was performed within 1 h.

The eDNA extraction was conducted with a DNeasy blood & tissue kit (Qiagen, Hilden, Germany). Each filter was placed in a Salivette tube (Sarstedt, Nümbrecht, Germany) and centrifuged at 5,000 × g for 3 min. Then 420 μL of a solution comprising 20 μL Proteinase K, 200 μL Buffer AL, and 200 μL H₂O was added to the filter. The tube was incubated at 56°C for 30 min and the lysed DNA was collected by centrifugation at 5,000 × g for 3 min. Then 200 μL tris-ethylenediaminetetraacetic buffer (TE buffer) was added to the filter and the liquid was collected by centrifugation at 5,000 × g for 3 min. Then 200 μL Buffer AL and 600 μL ethanol were added to the liquid and the mixture was transferred to a spin column and centrifuged at 6,000 × g for 1 min. Subsequently, 100 μL Buffer AE was eluted into the liquid according to the manufacturer’s instructions and the mixture was preserved at −20°C. All buffers (except TE), Proteinase K, and the spin columns from the DNA extraction kit were used in the eDNA extraction in the present study.

PCR analysis

The Japanese eel eDNA concentrations were quantified by qPCR in a LightCycler 96 system (Roche Diagnostics, Mannheim, Germany) as in a previous study [41]. The DNA from each target species was amplified using species-specific primers and probe sets targeting the mitochondrial D-loop region. The forward primer (primer F) Aja–Dlp–F was 5′–TACATTTAATGGAAAACAAGCATAAGCC–3′, the reverse primer (primer R) Aja–Dlp–R was 5′–CGTTAACATTACTCTGTCAACTTACCTG–3′, and the probe Aja–Dlp–P was 5’–FAM–ACCCATAAACTGATAAATAG–MGB–3’. The amplified length was expected to be 138 bp. The species-specificities of the primer/probe sets were confirmed by Kasai et al. [41].

Each PCR reaction included 900 nM forward and reverse (F/R) primers and 125 nM TaqMan Probe, 7.5 μL TaqMan Environmental Master Mix 2.0 (Thermo Fisher Scientific, Waltham, MA, USA), 0.075 μL AmpErase uracil N-glycosylase (Thermo Fisher Scientific, Waltham, MA, USA), and 2 μL DNA sample. The total reaction volume was adjusted to 15 μL with PCR-grade water (Roche Diagnostics, Basel, Switzerland). Dilutions containing 3 × 10¹–3 × 10⁴ copies per PCR tube were prepared and used as quantification standards. The qPCR conditions were as follows: 2 min at 50°C, 10 min at 95°C, 55 cycles of 15 s at 95°C, and 60 s at 60°C. There were three replicates each of all samples and standard DNAs. Three replicate negative controls containing PCR-grade water instead of template DNA were included in all PCR plates. For all PCR runs, the calibration curves’ R² were > 0.99, and the ranges of the slope, Y-intercept, and PCR efficiency were −3.58 to −3.36, 39.55 to 40.28, and 0.90 to 0.99, respectively. None of the PCR-negative or blank controls was PCR-amplified. The amplified fragments were directly sequenced by a commercial sequencing service (No. SQ18F210091; Fasmac, Atsugi, Kanagawa, Japan). To mitigate the risk of carryover contamination, the pre-PCR and post-PCR experiments were conducted in separate rooms.

The DNA from each target individual in the first and second cycles was quantified by an intercalator method using the same species-specific primers as in the above-mentioned TaqMan method. Each PCR reaction system included 900 nM forward and reverse (F/R) primers, 7.5 μL PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), and 2 μL DNA sample. The total reaction volume, standard dilutions, and replications were similar to those in the TaqMan method above. The qPCR conditions were as follows: 2 min at 50°C, 2 min at 95°C, 55 cycles of 15 s at 95°C and 60 s at 60°C, and melting (15 s at 95°C, 60 s at 60°C, 0.20°C/s from 60°C to 95°C, and 15 s at 95°C). For all PCR runs, the calibration curves’ R² were > 0.99, and the ranges of the slope, Y-intercept, and PCR efficiency were −3.68 to −3.50, 38.38 to 39.18, and 0.87 to 0.93, respectively. None of the PCR-negative or blank controls were PCR-amplified.

Experiment 2: Diel eDNA release rate and eel activity patterns

Fish selection

Here, the effects of diel activity and individual differences on the Japanese eel eDNA release rates were examined. Four individual eels (Aja-1, Aja -2, Aja -3, Aja -4; SL 494 ± 21 mm; W 155 ± 7 g; S1 Table) were selected from the 20 used in Experiment 1 (S2 Table). Eels with similar base pair sequences between primers F and R were chosen. All had the same sequence except for Aja-2 whose 35^th base from the 5′ end of primer F was “A” rather than “C” and Aja-4 whose 48^th base from the 5′ end of primer F was “A” rather than “G” between the primer F-3′ and probe (S2 Table).

Experimental tank design and activity evaluation

Four acrylic tanks were arranged in parallel as described for Experiment 1 (Fig 1). The experimental space was enclosed by a black curtain to minimize external visual disturbances. Purified tap water was stored in a 100-L tank. The water level and volumes were 21 cm and 54 L, respectively. The water exchange rate was 225 mL/min over six cycles per day. The aeration rate was 200 mL/min. Dou et al. [46] reported that glass eels are more active at 20°C and 24°C than they are at 15°C. In the present study, the eels moved more actively at ≥ 24°C than they did at 20°C. Hence, the water temperature was maintained at 25.7 ± 0.7°C. Fluorescent light was turned on at 05:00 and the light intensity was 402–493 Lx. The light was switched off at 17:00 and the light intensity declined to 0.01–0.09 Lx. No feeding or bottom cleaning was performed during the experiment.

A video camera (SEC-TF-N060WISC; Broadwatch, Osaka, Japan) was set in each tank to record eel activity. Nocturnal behavior was recorded using the infrared function of the camera. Eel activity was scored at 1-s intervals as follows: eel motionless in the pipe, 0 points; eel moving and caudal fin out of the pipe, 1 point; at least half but less than the entire eel body out of the pipe, 2 points; entire eel body out of the pipe, 3 points. Eel activity was evaluated by calculating the sum of scores at 1 h or 3 h before each water sampling. Eel activity at 1 h and 3 h were compared to make correlations between eDNA concentration and activity.

Water collection and filtration

An eel was introduced into each tank at 08:00 on July 23, 2018. Water samples were collected at 09:00 between July 23 and July 25, 2018 (acclimatization). Eight samplings were conducted between July 26 and July 27, 2018 at 06:00, 09:00, 12:00, and 15:00 (daytime) and at 18:00, 21:00, 00:00, and 03:00 (nighttime). Water was collected in three 500-mL plastic bottles as for Experiment 1. Five hundred milliliters of water was collected from the tank in each plastic bottle before introducing an eel on July 20. These samples were used as blank controls.

Water filtration, eDNA extraction, and qPCR analysis by the TaqMan method using species-specific primers and probe sets were performed in the same manner as for Experiment 1. For all PCR runs, the calibration curves’ R² were > 0.99. The ranges of the slope, Y-intercept, and PCR efficiency were −3.60 to −3.31, 39.12 to 40.34, and 0.90 to 1.00, respectively (S3 Table). None of the PCR-negative or blank controls was PCR-amplified.

Data analysis

All statistical analyses were performed in R v. 3.6.3 [47]. The diurnal and nocturnal eDNA concentration and activity were compared with a two-tailed, paired Student’s t-test. Normality was tested by Shapiro’s test, and then the homoscedasticity was verified by var-test for t-test and Bartlett’s test for multiple comparisons (S4 Table). During acclimatization, the daily variation in eDNA concentration at 09:00 between July 23 and 26, 2018 were analyzed by one-way ANOVA with Tukey’s HSD multiple comparisons test. During acclimatization, the individual variations in eDNA concentration at 09:00 between July 24 and 26, 2018 were analyzed by the Kruskal-Wallis and Dunn-Bonferroni multiple comparisons tests. Diurnal and nocturnal eDNA concentration and activity over time and among individuals were evaluated by one-way ANOVA and Tukey’s HSD multiple comparisons test. Coefficients of variation among individuals, samplings, and PCR replicates were determined and compared by the Kruskal-Wallis and Dunn-Bonferroni multiple comparisons tests. Correlations between eDNA concentration and activity for each individual were estimated by linear regression (95% confidence and prediction limits) using the “lm” package in R v. 3.6.3.

Results

Experiment 1: Effects of polymorphism on eDNA detection

One out of 20 bases in the probe region was different in two of 20 individuals tested (S4 Table). Variant-1 (first cycle on May 25–31, 2018; Fig 2A) presented with a genetic mismatch in the middle of the probe region. Variant-2 (second cycle on June 1–7, 2018; Fig 2B) had a mismatch at the third base from the 3′ end of the probe region (Table 1). In terms of the eDNA variation within an individual experiment in 1 week, the variant eDNA concentrations were consistently low or undetected. In contrast, other individuals fluctuated between high and low eDNA concentrations (Fig 2A–2C). The fluorescence endpoints of the qPCR amplification curves decreased in the order of control, Variant-2, Variant-1 on the first day, Variant-1 on the second or later day, and negative control (Fig 2D; Ct = 23.58 ± 0.07, 25.28 ± 0.04, 27.32 ± 0.23, and non-detectable (ND), respectively). Variant-1 had a positive eDNA concentration only immediately after it was introduced to the tank. Thereafter, its eDNA concentration was negative (Fig 2A).

Table 1. Probe region sequences.

Sample	Sequence of probe region^*
Non variant	`ACCCATAAACTGATAAATAG`
Variant-1	`ACCCATAAATTGATAAATAG`
Variant-2	`ACCCATAAACTGATAAACAG`

Open in a new tab

*Red: Base in polymorphism.

By the intercalator method, the variant eDNA concentration was detected and was consistently as high as in the other individuals (Fig 2E and 2F). The fluorescence endpoints of the qPCR amplification curves were similar among the control, Variant-2, Variant-1 on the first day, and Variant-1 on the second or later day, and extremely low in the negative control (Fig 2G; Ct = 20.81 ± 0.16, 21.58 ± 0.07, 22.25 ± 0.07, 20.35 ± 0.20, and ND, respectively). The melting temperature (Tm) was 74.08 ± 0.46°C (S5 Table).

Experiment 2: Diel eDNA release rate and eel activity patterns

During acclimatization, the eDNA concentration was significantly higher on the first day after fish introduction than it was by day four for all individuals except Aja-1 (df = 3, Aja-1: p = 0.99, Aja-2: p = 0.02, Aja-3: p < 0.01, Aja-4: p < 0.01; Table 2). There was no significant difference between the second and fourth days for any individual (df = 3, Aja-1: p = 0.98, Aja-2: p = 0.06, Aja-3: p = 0.99, Aja-4: p = 0.57; Table 2). Inter-individual variation in the eDNA concentration was significantly higher for Aja-4 than it was for Aja-1 and Aja-3 between the second and fourth days of acclimatization (df = 3, p < 0.01; Table 2). The eDNA concentration was significantly higher in Aja-4 than it was in the others (df = 3, F = 8.86, p < 0.02; Fig 3). The activity level of Aja-3 was significantly higher than those of Aja-2 and Aja-4 (df = 3, F = 3.72, p = 0.02; Fig 3).

Table 2. Variation in eDNA concentration (eDNA conc.) during acclimatization.

Sample No.*²	eDNA conc. (10⁴ copies/L)*¹
Sample No.*²	Date	23-Jul	24-Jul	25-Jul	26-Jul
Aja-1^B		25.0 ±3.4^b	17.3 ±0.9^b	98.0 ±30.1^a	22.1 ±2.8^b
Aja-2^AB		62.3 ±11.9^a	55.3 ±6.8^ab	50.9 ±10.3^ab	33.1 ±5.7^b
Aja-3^B		79.7 ±12.7^a	35.9 ±2.6^b	21.4 ±3.9^b	37.6 ±3.4^b
Aja-4^A		669.7 ±22.7^a	178.7 ±41.2^b	71.5 ±14.9^c	215.1 ±45.3^b

Open in a new tab

*¹Average ± SD. Values within same row having different superscript letters are significantly different (df = 3, Aja-1: F = 19.2, p < 0.01, Aja-2: F = 5.76, p = 0.02, Aja-3: F = 38.7, p < 0.01, Aja-4: F = 187.3, p < 0.01, one-way ANOVA with Tukey’s HSD multiple comparisons test).

*²Values within the same column having different superscript capital letters are significantly different (df = 3, p < 0.01; Kruskal-Wallis and Dunn-Bonferroni multiple comparisons tests).

Fig 3 — (A) Aja-1, (B) Aja-2, (C) Aja-3, (D) Aja-4. There were significant differences in eDNA concentration (df = 3, p = 0.03) and activity (df = 3, p < 0.01) between daytime and nighttime (two-tailed, paired Student’s t-test). There were significant differences in eDNA concentration among times of day (df = 7, p < 0.05, one-way ANOVA with Tukey‘s HSD multiple comparisons test). Error bars indicate standard deviations.

Observation of the diel changes during the main experiment indicated that the eDNA concentration (df = 3, p = 0.03) and activity (df = 3, p < 0.01) during the nighttime (18:00, 21:00, 00:00, and 03:00) were significantly higher than those during the daytime (06:00, 09:00, 12:00, and 15:00; Fig 3). The activity at 21:00 was significantly higher than that at 12:00 (df = 7, F = 2.83, p = 0.03; Fig 3). The eDNA concentration was minimal during the daytime, peaked around sunset, and decreased significantly by nighttime (df = 7, Aja-1: F = 16.2, p < 0.05, Aja-2: F = 122.6, p < 0.04, Aja-3: F = 74.8, p < 0.02, Aja-4: F = 35.4, p < 0.03; Fig 3). Peak eDNA occurred between 15:00 and 21:00 and varied among individuals (Fig 3).

The timing at which the eels actively moved outside the pipes (activity score = 3) also differed among individuals between 15:00 and 21:00 (around sunset) and at 03:00 (predawn) and 6:00 (dawn) (Fig 3). Both the eDNA concentration and activity increased in Aja-4 at 09:00 (Fig 3D). The standard deviation for the eDNA concentration at 15:00 was very large for Aja-1 (Fig 3A).

There were inter-individual differences in the correlation between eDNA concentration and activity 1 h before water sampling. These correlations were very weakly positive for Aja-1 and Aja-2 and positive for Aja-3 and Aja-4 (R² = 0.072, 0.023, 0.30, and 0.56, respectively; Fig 4). The correlation for the activity data 1 h before water sampling was considerably higher than that at 3 h before water sampling in Aja-2, Aja-3, and Aja-4 (R² = 0.12, 0.008, 0.13, and 0.43 in Aja-1, Aja-2, Aja-3, and Aja-4, respectively; S1 Fig).

Fig 4 — (A) Aja-1, (B) Aja-2, (C) Aja-3, (D) Aja-4. Dotted lines indicate 95% confidence limits. Dashed lines indicate 95% prediction limits.

The coefficient of variation among the individual eDNA concentrations was significantly larger than those for the sampling and PCR measurement replications (df = 2, p < 0.01; Fig 5). Therefore, the fluctuations in eDNA concentration shown in Table 2 and Fig 3 were derived mainly from individual variations.

Fig 5 — The CV significantly differed (df = 2, p < 0.01, Kruskal-Wallis and Dunn-Bonferroni multiple comparisons tests).

Discussion

Genetic polymorphism may hinder eDNA studies

The environmental DNA of a target species is specifically detectable when there are a sufficient number of interspecific base pair mismatches [48]. Intraspecific mutations and polymorphisms affect eDNA detection by qPCR analysis using species-specific primers/probes [17,18]. It is reported that eDNA detection is more influenced by base pair mismatches in the primer region than in the probe region [18]. Mismatches in the probe region nonetheless affect the estimation of eDNA concentration [49]. The DNA amplicon is certainly amplified in the subsequent steps once the templates are annealed by the primers, because the sequences of DNA amplicons completely match the sequences in the priming sites of the primers. However, mismatches of sequences between probe sets and templates are not eliminated in the subsequent amplification steps. Therefore, the negative effects of polymorphs in probe regions on DNA amplification are potentially considerable.

Individual rearing of Japanese eel in Experiment 1 confirmed that base sequence polymorphism in the probe region substantially modulate the eDNA concentration. The endpoint fluorescence levels of the qPCR-amplified curves were lower than those of the others (Fig 2D). The eDNA concentrations of the variants were consistently estimated to be lower than those of the others (Fig 2A and 2B). Earlier studies reported flattened PCR amplification curves [17,48]. The eDNA concentration of the eel with a genetic mismatch in the middle of the probe region (Variant-1) was lower than that of the eel with a mismatch in the side of the probe region (Variant-2) (Fig 2A and 2B). In the former case, the eDNA concentration was low but positive immediately after the eel was introduced to the tank (Fig 2A). From the second day onward, however, its eDNA concentration was negative (Fig 2A). We have no reasonable explanation for this phenomenon, which is a subject to be addressed in future research.

In general, a probe is hybridized to complementary DNA during qPCR annealing [49,50], and then is degraded and separated by the 5′-to-3′ exonuclease activity of DNA polymerase during target-specific DNA amplification. This reaction is responsible for fluorescence emission [49,51]. The melting temperature (Tm, °C) decreases and the probe hybridization weakens in response to base pair mismatches [49]. In particular, the use of MGB accentuates the difference in Tm due to single nucleotide polymorphisms (SNPs), and the probe is less likely to anneal to the target region. We propose that the fluorescence decreases and the eDNA concentration is underestimated when probe hybridization is interrupted by a base pair mismatch in the probe region. Probe hybridization would decrease when the mismatch occurs in the middle of the probe region. A similar polymorphism was detected in the probe region, and weak fluorescence was observed in mitochondrial cytochrome b of jack mackerel (Takahashi et al., unpublished data).

Using the intercalator method with SYBR Green in our study, eDNA concentrations and the endpoint fluorescence levels of the variants were consistently as high, and their Ct values were as low as those in the non-variant individuals (Fig 2E–2G). These results confirmed that the total amount of DNA extracted from the filters in Variant-1 and -2 was equivalent to that of the other individuals, and inhibitors were absent from these samples.

Some researchers have used Japanese eel primers/probe sets targeting mitochondrial 16S ribosomal RNA (rRNA) (153 bp [6], 107 bp [39], and 154 bp [40]). Here, we used primers/probe sets targeting 138 bp of the mitochondrial D-loop region. These primers/probe sets have also been used in Kasai et al. [7], where a nationwide eel distribution survey in Japan was conducted. Kasai et al. [41] carefully checked the specificity in the set of primers used in the present study, as follows. The A. japonica sequence was compared with those of 14 congeneric subspecies in order to confirm specific amplification. The primer/probe sequences were consistent with the target species consensus sequence based on 857 individuals of A. japonica samples. In this manner, base pair mismatches caused by intraspecific genetic variation were minimized. However, a base sequence mismatch in the probe region was detected in two of the 20 individual eels. Individual tank experiments in our study using these primers/probe sets revealed that polymorphism in the probe region influenced eDNA detection considerably. It is necessary to design primers/probe sets selecting regions with relatively low intraspecific polymorphism, which would facilitate the precise measurement of eDNA concentrations in each individual.

D-loop regions have higher rates of polymorphism than other mitochondrial regions. Nevertheless, other mitochondrial regions can also be polymorphed. The risk of overestimation following PCR amplification of non-native con-generic species’ DNA is increased by the selection of regions that generally have lower mutation rates than the D-loop region, whereas the risk of underestimation caused by the primer/probe mismatch could be reduced. Therefore, it is a trade-off between overestimation and underestimation where to select a target region when applying eDNA technologies to ecological research.

The target species biomass could be underestimated in marine and riverine DNA surveys when the variant is mixed at the survey point. We have no data concerning the ratio of variants in the natural eel population. From the results of our study, 10% of the total population were variants, which is unlikely to bias the presence–absence data when each habitat hosts a large enough number of individuals. When eDNA concentrations are applied to estimate biomass, such a polymorphism is likely to lead to underestimation. If some habitats host only a few individuals, then such a polymorphism might lead to false negatives. Therefore, we recommend that the sequence of the target species inhabiting the survey area should be verified in advance depending on the purpose of the eDNA study.

Inter-individual difference and daily rhythm of activity affect eDNA emission

The concentration of eDNA often fluctuates soon after the introduction of fish in a tank. For instance, it took 3 days in the case of bluegill sunfish (Lepomis macrochirus) [29] and 6 days in the case of common carp (Cyprinus carpio) [20] until eDNA concentrations stabilized in the still water of the tanks. In the present experiment, although eDNA concentrations on the fourth day were significantly lower than those on the first day in three individuals, the difference was non-significant between the second and fourth days in all individuals. Therefore, eDNA concentrations seem to have stabilized from the second day onward, perhaps due to the running water system used in this study. This was advantageous for comparing inter-individual, as well as diel, differences in eDNA concentrations.

The coefficients of variation in the individual eDNA concentration measurements were significantly larger than those for the sampling and PCR replications (Fig 5). The fluctuations in eDNA concentration might be the result of individual variations in the eDNA release rate. Positive correlations have been reported between fish size and eDNA concentration [29,30,40]. As all individuals of this study were equivalent in size, the variation would be caused by factors other than biomass differences.

Here, we focused on the diurnal activity patterns as putative factors affecting the eDNA concentrations. Japanese eels are nocturnal [42,43]. Glass eels often remain in pipes during the daytime and emerge immediately after the light source is switched off [44]. We used elvers whose diurnal rhythm was assumed to be the same as that of glass eels. Their nighttime activity was significantly greater than their daytime activity (Fig 3). All individuals were more active at 21:00 than they were at 12:00. Thus, the Japanese eels were active at sunset and non-active at noon.

Carp eDNA concentration increased at night in accordance with their nocturnal activity [36]. In contrast, the eDNA concentrations of salamanders and frogs did not markedly differ between daytime and nighttime [21,37]. Ghosal et al. [36] suggested that a nocturnal increase in eDNA concentration could be explained by increases in carp biomass and activity as the fish gather in feeding areas at night. We focused on the nighttime increase in Japanese eel activity and detected changes in eDNA concentration by examining individual eels of the same size. The nocturnal eDNA concentrations were higher than the diurnal ones. Therefore, the observed variations in eDNA concentration coincided with the nocturnal activity of this species.

A positive correlation between eDNA concentration and fish activity has been reported in seven freshwater fishes [35]. In the present study, eDNA concentration and activity were also positively correlated. The activity 1 h before water sampling was more strongly correlated with the eDNA concentration than the activity 3 h before water sampling (Figs 4 and S1 Fig). Moreover, the correlation between eDNA concentration and activity varied among individuals. We propose that the factors affecting eDNA concentration include activity and individual differences in basal metabolism. In the metabolic process, the eels seem to release substantial amounts of eDNA.

Japanese eels move actively at dawn and dusk [44]. In the present study, individual differences in active time were observed. Aja-1 moved actively at dawn (06:00) and dusk (18:00) whereas Aja-2 moved less actively at these times. Relative differences in individual activity were also detected between midnight (00:00) and predawn (03:00) (Fig 3). The activity and eDNA concentration at 09:00 were higher for Aja-4 than they were for the other eels (Fig 3). Throughout the day, the eDNA concentration was the lowest in the daytime, highest at dusk, and gradually decreased thereafter. Peak eDNA concentrations varied among individuals between 15:00 and 21:00. During this time interval, the eels actively moved outside the pipes. The high eel activity at that time coincided with the maximum eDNA concentration, suggesting that a large amount of mucus and other substances containing their DNA was shed from their body.

The activity level of Aja-3 was significantly higher than those of Aja-2 and Aja-4. In contrast, the eDNA concentration of Aja-4 was significantly higher than those of Aja-1 and Aja-3 during acclimatization between the second and fourth days and those of all other eels during the main experiment. Hence, eDNA release is not always higher in more active individuals. Possible eDNA sources include urine, mucus, saliva, carcasses, and feces [11,12]. Furthermore, the aquatic eDNA state may be free, cellular, or particle-bound [13]. In lakes, eDNA concentrations may be higher near the bottom than the surface [23]. The same is true for seawater [52]. Consequently, eDNA distribution may be irregular. DNA patches in the water may also affect the eDNA concentration. Patchy aquatic eDNA distribution might account for the large standard deviation of the eDNA concentration in Aja-1 at 15:00 (Fig 3A).

Conclusions and perspectives

We demonstrated that a base pair mismatch in the probe region may lead to the underestimation of eDNA detection in Japanese eel. The problem of genetic polymorphism, as we have shown, is likely to occur in the eDNA of other species. The present study also showed that the Japanese eel diel rhythm and activity affect their eDNA emissions. There was a positive correlation between eDNA concentration and eel activity and both were relatively higher in the nighttime. Therefore, water collection at sunset maximizes riverine eel detection in eDNA-based distribution surveys. Moreover, eDNA release rates differ among individual eels. These findings may well contribute to improve the accuracy and precision of estimating eel abundance and distribution using eDNA. This should be an important step to protect and rebuild the depleted stock of this species. However, the sample size used in the present study was limited; hence, extending the survey scale is preferable before confidently upscaling eDNA technology in the field. The effect of mismatch in priming sites of primers is also worth evaluating to improve the efficiency of eDNA detection in field surveys. The internal and external environments of target species also influence the variation in eDNA concentration. To improve the accuracy of biomass estimation, further investigation is required to identify the other factors affecting eDNA concentration and the interactions that may occur among those factors.

Supporting information

S1 Fig. Correlation between eDNA concentration and activity score 3 h before water sampling.

(TIF)

Click here for additional data file.^{(329.3KB, tif)}

S1 Table. Length and weight of samples.

(XLSX)

Click here for additional data file.^{(14.8KB, xlsx)}

S2 Table. Sequence results for 20 Anguilla japonica samples.

(XLSX)

Click here for additional data file.^{(11.5KB, xlsx)}

S3 Table. Parameters of standard curves for qPCR measurements on each sampling date.

(XLSX)

Click here for additional data file.^{(11.4KB, xlsx)}

S4 Table. P-values of Shapiro’s test, var-test, and Bartlett’s t-test.

(XLSX)

Click here for additional data file.^{(13.3KB, xlsx)}

S5 Table. Melting temperatures (Tm) of standard and each samples.

(XLSX)

Click here for additional data file.^{(11.3KB, xlsx)}

S6 Table

(a) Data of eDNA concentration (eDNA conc.), (b) amplification curves, and (c) parameters of the standard curve for each qPCR measurement shown in Figs 1 and 2. (a), (d) Data of eDNA concentration (eDNA conc.), (b), (e) amplification curves, and (c), (f) parameters of the standard curve for each qPCR measurement shown in Fig 2.

(XLSX)

Click here for additional data file.^{(72.1KB, xlsx)}

S7 Table. eDNA concentrations in Table 2, Figs 3–5 and S1 Fig.

(XLSX)

Click here for additional data file.^{(31.6KB, xlsx)}

S8 Table. Activity score used in Figs 3 and 4 and S1 Fig.

(XLSX)

Click here for additional data file.^{(149KB, xlsx)}

Acknowledgments

The authors thank Mr. Tatsuki Toya of Kyoto University for his assistance with the measurement of eel body length and wet weight. The authors also thank the students and staff of Maizuru Fisheries Research Station of Kyoto University for their assistance with our experiments. We would also like to thank Dr. Hideyuki Doi (University of Hyogo) and two anonymous reviewers for their constructive comments that helped us to substantially improve the quality of the manuscript.

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This work was supported by the CREST program of the Japan Science and Technology Agency (Grant No. JPMJCR13A2), JSPS KAKENHI (Grant No. 17H01412), and JSPS KAKENHI (Grant No. 19H05641). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Tsukamoto K, Aoyama J, Miller MJ. Present status of the Japanese eel: resources and recent research. In: Casselman J, Cairns D, editors. Eels at the edge. Bethesda, Maryland; 2009. pp. 21–35. [Google Scholar]
2.Jacoby D, Gollock M [Internet]. [cited 2020 Mar 6]. Anguilla japonica. The IUCN Red List of Threatened Species 2014: e.T166184A1117791. 10.2305/IUCN.UK.2014-1.RLTS.T166184A1117791.en. [DOI]
3.Tsukamoto K. Oceanic biology: Spawning of eels near a seamount. Nature. 2006;439: 929. doi: 10.1038/439929a [DOI] [PubMed] [Google Scholar]
4.Kimura S, Tsukamoto K, Sugimoto T. A model for the larval migration of the Japanese eel-roles of the trade winds and salinity front. Mar Biol. 1994;119: 185–190. [Google Scholar]
5.Tsukamoto K, Nakai I, Tesch WV. Do all freshwater eels migrate? Nature. 1998;396: 635–636. [Google Scholar]
6.Itakura H, Wakiya R, Yamamoto S, Kaifu K, Sato T, Minamoto T. Environmental DNA analysis reveals the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale. Aquat Conserv Mar Freshw Ecosyst. 2019;29: 361–373. [Google Scholar]
7.Kasai A, Yamazaki A, Ahn H, Yamanaka H, Kameyama S, Masuda R, et al. Distribution of Japanese eel Anguilla japonica revealed by environmental DNA. Front Ecol Evol. 2021;9: 621461. [Google Scholar]
8.Ficetola GF, Miaud C, Pompanon F, Taberlet P. Species detection using environmental DNA from water samples. Biol Lett. 2008;4: 423–425. doi: 10.1098/rsbl.2008.0118 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Bohmann K, Evans A, Gilbert MTP, Carvalho GR, Creer S, Knapp M, et al. Environmental DNA for wildlife biology and biodiversity monitoring. Trends Ecol Evol. 2014;29: 358–367. doi: 10.1016/j.tree.2014.04.003 [DOI] [PubMed] [Google Scholar]
10.Kelly RP, Port JA, Yamahara KM, Martone RG, Lowell N, Thomsen PF, et al. Harnessing DNA to improve environmental management. Science. 2014;344: 1455–1456. doi: 10.1126/science.1251156 [DOI] [PubMed] [Google Scholar]
11.Rees HC, Maddison BC, Middleditch DJ, Patmore JRM, Gough KC. The detection of aquatic animal species using environmental DNA–a review of eDNA as a survey tool in ecology. J Appl Ecol. 2014;51: 1450–1459. [Google Scholar]
12.Barnes MA, Turner CR. The ecology of environmental DNA and implications for conservation genetics. Conserv Genet. 2016;17: 1–17. [Google Scholar]
13.Thomsen PF, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MTP, et al. Monitoring endangered freshwater biodiversity using environmental DNA. Mol Ecol. 2012;21: 2565–2573. doi: 10.1111/j.1365-294X.2011.05418.x [DOI] [PubMed] [Google Scholar]
14.Bergman PS, Schumer G, Blankenship S, Campbell E. Detection of adult green sturgeon using environmental DNA analysis. PLoS One. 2016;11: e0153500. doi: 10.1371/journal.pone.0153500 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Eichmiller JJ, Bajer PG, Sorensen PW. The relationship between the distribution of common carp and their environmental DNA in a small lake. PLoS One. 2014;9: e112611. doi: 10.1371/journal.pone.0112611 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Bylemans J, Furlan EM, Hardy CM, McGuffie P, Lintermans M, Gleeson DM. An environmental DNA-based method for monitoring spawning activity: a case study, using the endangered Macquarie perch (Macquaria australasica). Methods Ecol Evol. 2017;8: 646–655. [Google Scholar]
17.Yao Y, Nellaker C, Karlsson H. Evaluation of minor groove binding probe Taqman probe PCR assays: Influence of mismatches and template complexity on quantification. Mol Cell Probes. 2006;20: 311–316. doi: 10.1016/j.mcp.2006.03.003 [DOI] [PubMed] [Google Scholar]
18.Wilcox TM., McKelvey KS, Young MK, Jane SF, Lowe WH, Whiteley AR, et al. Robust detection of rare species using environmental DNA: the importance of primer specificity. PLoS One. 2013;8: e59520. doi: 10.1371/journal.pone.0059520 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Yoshitake K, Yoshinaga T, Tanaka C, Mizusawa N, Reza MS, Tsujimoto A, et al. HaCeD-Seq: a novel method for reliable and easy estimation about the fish population using haplotype count from eDNA. Mar Biotechnol. 2019; 21: 813–820. doi: 10.1007/s10126-019-09926-6 [DOI] [PubMed] [Google Scholar]
20.Takahara T, Minamoto T, Yamanaka H, Doi H, Kawabata Z. Estimation of fish biomass using environmental DNA. PLoS One. 2012;7: e35868. doi: 10.1371/journal.pone.0035868 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Pilliod DS, Goldberg CS, Arkle RS, Waits LP. Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Can J Fish Aquat Sci. 2013;70: 1123–1130. [Google Scholar]
22.Doi H, Inui R, Akamatsu Y, Kanno K, Yamanaka H, Takahara T, et al. Environmental DNA analysis for estimating the abundance and biomass of stream fish. Freshw Biol. 2017;62: 30–39. [Google Scholar]
23.Klobucar SL, Rodgers TW, Budy P. At the forefront: evidence of the applicability of using environmental DNA to quantify the abundance of fish populations in natural lentic waters with additional sampling considerations. Can J Fish Aquat Sci. 2017;74: 2030–2034. [Google Scholar]
24.Yates MC, Glaser DM, Post JR, Cristescu ME, Fraser DJ, Derry AM. The relationship between eDNA particle concentration and organism abundance in nature is strengthened by allometric scaling. Mol Ecol. 2020;00: 1–15. doi: 10.1111/mec.15543 [DOI] [PubMed] [Google Scholar]
25.Thomsen PF, Møller PR, Sigsgaard EE, Knudsen SW, Jørgensen OA, Willerslev E. Environmental DNA from seawater samples correlate with trawl catches of subarctic, deepwater fishes. PLoS One. 2016;11: e0165252. doi: 10.1371/journal.pone.0165252 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Yamamoto S, Minami K, Fukaya K, Takahashi K, Sawada H, Murakami H, et al. Environmental DNA as a ‘snapshot’ of fish distribution: A case study of Japanese jack mackerel in Maizuru Bay, Sea of Japan. PLoS One. 2016;11: e0149786. doi: 10.1371/journal.pone.0149786 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Uchii K, Doi H, Yamanaka H, Minamoto T. Distinct seasonal migration patterns of Japanese native and non-native genotypes of common carp estimated by environmental DNA. Ecol Evol. 2017;7: 8515–8522. doi: 10.1002/ece3.3346 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Takahashi S, Sakata MK, Minamoto T, Masuda R. Comparing the efficiency of open and enclosed filtration systems in environmental DNA quantification for fish and jellyfish. PLoS ONE. 2020;15: e0231718. doi: 10.1371/journal.pone.0231718 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Maruyama A, Nakamura K, Yamanaka H, Kondoh M, Minamoto T. The release rate of environmental DNA from juvenile and adult fish. PLoS One. 2014;9: e114639. doi: 10.1371/journal.pone.0114639 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Horiuchi T, Masuda R, Murakami H, Yamamoto S, Minamoto T. Biomass-dependent emission of environmental DNA in jack mackerel Trachurus japonicus juveniles. J Fish Biol. 2019;95: 979–981. doi: 10.1111/jfb.14095 [DOI] [PubMed] [Google Scholar]
31.Kelly RP, Port JA, Yamahara KM, Crowder LB. Using environmental DNA to census marine fishes in a large mesocosm. PLoS One. 2014;9: e86175. doi: 10.1371/journal.pone.0086175 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Roussel J-M, Paillisson J-M, Trèguier A, Petit E. The downside of eDNA as a survey tool in water bodies. J Appl Ecol. 2015;52: 823–826. [Google Scholar]
33.Spear SF, Groves JD, Williams LA, Waits LP. Using environmental DNA methods to improve detectability in a hellbender (Cryptobranchus alleganiensis) monitoring program. Biol Conserv. 2015;183: 38–45. [Google Scholar]
34.Pilliod DS, Goldberg CS, Arkle RS, Waits LP. Factors influencing detection of eDNA from a stream-dwelling amphibian. Mol Ecol Resour. 2014;14: 109–116. doi: 10.1111/1755-0998.12159 [DOI] [PubMed] [Google Scholar]
35.Thalinger B, Rieder A, Teuffenbach A, Pütz Y, Schwerte T, Wanzenböck J, et al. The effect of activity, energy use, and species identity on environmental DNA shedding of freshwater fish. Front Ecol Evol. 2021;9: 623718. [Google Scholar]
36.Ghosal R, Eichmiller JJ, Witthuhn BA, Sorensen PW. Attracting Common Carp to a bait site with food reveals strong positive relationships between fish density, feeding activity, environmental DNA, and sex pheromone release that could be used in invasive fish management. Ecol Evol. 2018;8: 6714–6727. doi: 10.1002/ece3.4169 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Takahashi MK, Meyer MJ, Mcphee C, Gaston JR, Venesky MD, Case BF. Seasonal and diel signature of eastern hellbender environmental DNA. J Wildl Manage. 2018;82: 217–225. [Google Scholar]
38.Takeuchi A, Iijima T, Kakuzen W, Watanabe S, Yamada Y, Okamura A, et al. Release of eDNA by different life history stages and during spawning activities of laboratory-reared Japanese eels for interpretation of oceanic survey data. Sci Rep. 2019;9: 6074. doi: 10.1038/s41598-019-42641-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Takeuchi A, Watanabe S, Yamamoto S, Miller MJ, Fukuba T, Miwa T. First use of oceanic environmental DNA to study the spawning ecology of the Japanese eel Anguilla japonica. Mar Ecol Prog Ser. 2019;609: 187–196. [Google Scholar]
40.Takeuchi A, Sado T, Gotoh RO, Watanabe S, Tsukamoto K, Miya M. New PCR primers for metabarcoding environmental DNA from freshwater eels, genus Anguilla. Sci Rep. 2019;9: 7977. doi: 10.1038/s41598-019-44402-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Kasai A, Takada S, Yamazaki A, Masuda R, Yamanaka H. The effect of temperature on degradation of environmental DNA of Japanese eel. Fish Sci. 2020;86: 465–471. [Google Scholar]
42.Tesch FW. The eel biology and management of anguillid eels. Blackwell Science, London; 2003. [Google Scholar]
43.Aoyama J, Shinoda A, Sasai S, Miller MJ, Tsukamoto K. First observations of the burrows of Anguilla japonica. J Fish Biol. 2005;67: 1534–1543. [Google Scholar]
44.Dou S, Tsukamoto K. Observations on the nocturnal activity and feeding behavior of Anguilla japonica glass eels under laboratory conditions. Environ Biol Fishes. 2003;67: 389–395. [Google Scholar]
45.The eDNA Society. Environmental DNA Sampling and Experiment Manual. Version 2.1. Otsu, Japan; 2019.
46.Dou S, Miller MJ, Tsukamoto K. Growth, pigmentation and activity of juvenile Japanese eels in relation to temperature and fish size. J Fish Biol. 2003;63: 152–165. [Google Scholar]
47.R Development Core Team: R Statistical Software. Version 3.6.3 [software]. A language and environment for statistical computing. Vienna, Austria. R Foundation for Statistical Computing. 2020.
48.Herrero B, Madrinan M, Vietes JM, Espineira M. Authentication of Atlantic cod (Gadus morhua) using real time PCR. J Agric Food Chem. 2010;58: 4794–4799. doi: 10.1021/jf904018h [DOI] [PubMed] [Google Scholar]
49.Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, et al. 3–Minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucl Acids Res. 2000;28: 655–661. doi: 10.1093/nar/28.2.655 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Ruijter JM, Lorenz P, Tuomi JM, Hecker M, van den Hoff MJB. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency. Microchimica Acta. 2014;181: 1689–1696. doi: 10.1007/s00604-013-1155-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Arya M, Shergill IS, Williamson M, Gommersall L, Arya N, Patel HRH. Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn. 2005;5: 209–219. doi: 10.1586/14737159.5.2.209 [DOI] [PubMed] [Google Scholar]
52.Minamoto T, Fukuda M, Katsuhara KR, Fujiwara A, Hidaka S, Yamamoto S, et al. Environmental DNA reflects spatial and temporal jellyfish distribution. PLoS One. 2017;12: e0173073. doi: 10.1371/journal.pone.0173073 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0255576.r001

Decision Letter 0

Hideyuki Doi

26 Jan 2021

PONE-D-20-38269

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

PLOS ONE

Dear Dr. Takahashi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 12 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

We look forward to receiving your revised manuscript.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments:

I got the recommendations and comments from two expert reviewers on the field. The both reviewer agree that the manuscript is interesting but the both reviewers raised serious concern to the markers in this study and some other concerns. I totally share their comments. Therefore, I regrettably inform you that I should reject the manuscript in current form, but with substantial revisions according to the reviewers comments, especially the marker issue with adding further experiment results, I can invite you to submit a revised version of the manuscript.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1.) Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.) In your Methods section, please include a comment about the state of the animals following this research. Were they euthanized or housed for use in further research? If any animals were sacrificed by the authors, please include the method of euthanasia and describe any efforts that were undertaken to reduce animal suffering.

3.) Thank you for including your ethics statement: "This study was conducted in accordance with the guidelines of the Regulation on Animal Experimentation of Kyoto University, Kyoto, Japan. No fish or other animals were harmed in any of the experiments performed herein.".

Please amend your current ethics statement to confirm that your named ethics committee specifically approved this study.

For additional information about PLOS ONE submissions requirements for ethics oversight of animal work, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-animal-research

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I have reviewed the manuscript “Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel” by Sayaka Takahashi et al. This study found the mismatch on the priming region of the species-specific probe for Japanese eel caused to under-estimate of eDNA concentration. Besides, it was suggested that the diel activity rhythm affect eDNA concentration. These findings offer an important message for future eDNA studies. However, I have several serious concerns about the experimental design and manuscript in its present form. I like the data the authors present, but it falls short of a stand-alone paper about the effect of probe mismatch for detection and the diurnal activity on eDNA concentration. Much more experimental work and careful discussion are required for this to exist as a stand-alone paper.

L67-69: I am very confused because I understood that the purpose of this study was to examine whether the mismatches of the specie-specific probe leads to a decrease in detection (L98-99).

L59-60, 70-73: There are duplications of text content between paragraphs.

L88-93: To clarify the significance of this study, it is necessary to explain what problems may occur if there is diurnal variation in eDNA concentration of Japanese eel. We agree that there are contradictions in results among previous studies, but you should not discuss based on studies using some taxa with very different ecological characteristics.

L75, 100: What is "individual differences"? (ex. size, figure, sex, physiological state, nutrition condition etc.) In this study, only the difference in activity was considered.

L155-162: The amounts of extraction reagents written in the manuscript are different from those written in the Environmental DNA Sampling and Experiment Manual (v. 2.1). Is the first centrifugation a newly added step? Also, how was the filtrate from the first centrifugation processed (discarded or kept) ?

L170-176: The D-loop region has a higher mutation rate, so intraspecific genetic diversity is more likely to accumulate. Even though other species-specific primers which were designed in other regions with lower mutation rate than D-loop have been published, why did you not use them?

L174: The Japanese eel-specific probe used in this study had MGB fluorescent dye. The use of MGB accentuates the difference in Tm due to SNPs, so the probe is less likely to anneal to target region when there is a mismatch in the priming site. Please add discussions about the possibility that the MGB emphasized the effect of probe mismatches on DNA detection in this study.

L226-230: I don't think the method of scoring the activity used in this study is appropriate. How was the score for each activity determined? Why didn't you use the amount of movement distance per unit of time or the number of respirations or fin movements? I think the current scoring system underestimates the amount of action to get out from a pipe and forage for food.

L359-361: I am very confused because there is a lack of explanation about Figure 2D. Why only five amplification curves are shown in figure 2D? Also, why are the collection dates of the samples different? (Not standardized to a specific day, ex. the first day, of each experiment cycle)

L365-368: From the second day, the eDNA concentrations of all eels without probe mismatch increased significantly. Considering this result, it is natural to assume that the eels with mismatch also likely released more eDNA on the second day than the first day. Please add a discussion about the reason why no DNA was detected after the second day, even though there may have been more eDNA.

L383-386: To design a more robust species-specific primers/probe, all obtained sequences should be used and compared to select SNP-free regions. Consensus sequences are not simply calculated based on the number and frequency of mutations. In addition, it is important that the selection of the target region. There is more mutation in the mitochondrial D-loop region because it has a higher mutation rate than other regions. The selection of cytb, 16S and 12S etc. decrease the risk of unexpected mismatch between primer/probe sequence and the target region.

L386-388: Japanese eels spawn near the Mariana Islands, and juveniles are randomly carried by ocean currents to the coast of Japan. Therefore, it is not surprising that 20 individuals purchased from the same aquaculture provider have different haplotypes.

L428: I couldn't understand what this sentence was referring to. Please add a more detail explanation.

L438-439: Why is it limited to mucus? I am very confused.

L453-454: I think that the Japanese eel "ecophysiology" was not examined. In addition, it is difficult to say that it revealed the effect of "behavior" on DNA concentration because this study only evaluated whether the eels were out of the pipe and/or moved their caudal fins.

Fig.4: Please use same Y-axis range among graphs.

Table S1: Which primers were used for Sanger sequencing of each individual? If the DNA amplicon was sequenced using the same primers as qPCR, you will not be able to find mismatches in the priming sites of the primers. Additionally, what does the ( ) on the reverse primer site indicate?

・This study does not explore the effect of probe mismatch for detection enough. While probe mismatches are likely to inhibit the detection of the target sequence (I agree with this), if the authors are serious about making a contribution to this issue, they should have examined the impact of sequence mismatches on detection rate using a known concentration DNAs.

・In experiment 1, authors cannot exclude the possibility that the eel with the sequence mutations released less eDNA than other eels. To investigate this possibility, it is highly recommended to quantify DNA concentrations by both of TaqMan and intercalater methods (ex. SYBR Green) to clearly show that sequence mismatch of TaqMan probe is inhibiting detection. Although the authors emphasize the high species-specificity of the primers/probe (in methods and discussion), it is not so important in this study because only eels were kept in tank.</major>

Reviewer #2: Manuscript PONE-D-20-38269

This manuscript asses the effect of intraspecific polymorphism as well as diel activity rhythm on eDNA detection/quantification in Japanese eels (Anguilla japonica). In a set of experimental tanks, the authors found that the presence of DNA polymorphisms located within the probe region of some individuals (2 eels), tends to underestimate the quantification of eDNA when qPCR method is employed. Moreover, a correlation between eDNA concentration and eel activity was found, being higher at nighttime.

The manuscript is well written and the methodology is mostly clear, although further editing and additional information is necessary. I found this paper interesting and I think that has the potential to increase our knowledge about eDNA detection and quantification. However, I found several issues that should be addressed before the acceptance of the manuscript.

- In my opinion, the choice of marker was poorly justified. It is well known that Dloop is one of the most polymorphic region within the mitochondrial DNA. Do the authors expect to have such an impact in the case of other, less variable, markers. On top of that, it will be important to report the level of polymorphism (at the probe region) on natural populations of eels. Thus, this will allow the reader to identify the magnitude of the bias when screening natural populations.

- Related with the previous point, I was surprised that the authors didn´t test additionally the use of degenerated probes in order to surpass the underestimation of eDNA (or the lack of detection).

- I was wondering if the total amount of DNA extracted from the filters was independently quantified using other methods (e.g. Qubit). This would allow to discard that underestimated samples (e.g. “Mutants”) didn´t have less amount of total DNA than the others.

- I was also wondering if inhibitor´s test were performed, particularly for those samples were no detection was possible. It is expected that Negative samples spiked-in with positive controls should amplified in the absence of inhibitors.

- I think is more correct to use “polymorphism” instead of “mutation” all over the text. The “mutants” that are reported here, seem to be common polymorphisms in natural populations.

- Despite the fact the authors performed 3 replicates per sample for eDNA quantification/detection, I was wondering why they use only 1 biological replicate. Each time, only one water sample was taken. The authors should discuss this point and it will be important to know if the level of variation within tank at each time-point was significant.

Minor comments:

L28: intraspecific

L41: polymorphic sites at the probe region

L97: to identify factors

L117: Miyazaki (Japan)

L125: from May 25, to June 14, 2018

L126: unused?

L205: In my opinion, Table 1 could be shown as supplementary table.

L235: 23, and July

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Sep 16;16(9):e0255576. doi: 10.1371/journal.pone.0255576.r002

Author response to Decision Letter 0

13 Apr 2021

April 13, 2021

PhD. Hideyuki Doi,

Academic Editor,

PLOS ONE

Dear Editor:

I, along with my co-authors, would like to re-submit the attached manuscript entitled newly “Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel” as a research article. (‘Response to Reviewers’, ‘Revised Manuscript with Track Changes’, ‘Manuscript’ figures 5; table 2; Supporting Information 9). The paper was co-authored by Shingo Takada, Hiroki Yamanaka, Reiji Masuda, Akihide Kasai.

The manuscript has been carefully rechecked and appropriate changes have been made according to the reviewer’s suggestion. The responses to their comments have been prepared and are attached herewith.

We thank you and the reviewers for your thoughtful suggestions and insights, which have enriched the manuscript and produced a more balanced and better account of the research. We hope that the revised manuscript is now suitable for publication in your journal.

We are not allowed to deposit our laboratory protocols in protocols.io, and the protocols were fully described in our manuscript.

I look forward to your reply.

Sincerely,

Sayaka Takahashi

Oita Junior College of Horticulture

Chiyomachi, Oita, 870-8658, Japan

Phone: +81-97-535-0201, Fax: +81-97-540-6509, e-mail: takahashi@oitatandai.ac.jp

Date: Jan 26 2021 07:23PM

To: "Sayaka Takahashi" tsayaka@life.shimane-u.ac.jp

From: "PLOS ONE" plosone@plos.org

Subject: PLOS ONE Decision: Revision required [PONE-D-20-38269]

PONE-D-20-38269

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

PLOS ONE

Dear Dr. Takahashi,

Please include the following items when submitting your revised manuscript:

・ A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

・ A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

・ An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments:

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1.) Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Our reply: we revised file names, according to the PLOS ONE style templates.

Our reply: We housed eels for use in further research. We added “All 20 eels were housed for use in further research” in the Materials section (L 118-119).

Please amend your current ethics statement to confirm that your named ethics committee specifically approved this study.

Our reply: In this study, no fish or other animals were harmed in any of the experiments performed herein, and we did not need ethical approval as long as we conduct a tank experiment in accordance with the guidelines of the Regulation on Animal Experimentation of Kyoto University. We have added “No ethical approval was required for the experimental procedure due to the common consumption of cultured eel” in the Materials section (L 117-118).

For additional information about PLOS ONE submissions requirements for ethics oversight of animal work, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-animal-research

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: No

Reviewer #2: Yes

5. Review Comments to the Author

(Response)

Thank you for your interest in the contents and for your constructive comments. All comments provided have been very valuable in improving our manuscript. We extensively revised our manuscript, especially we added more experiment and careful discussion. In addition, we revised “mutation” as “polymorphism” in the text. We have used polymorphism as a term to represent the phenomenon of having a base pair mismatch in a primers/probe region and (genetic) variant as to represent an individual having such a base pair mismatch.

#R1-1: L67-69: I am very confused because I understood that the purpose of this study was to examine whether the mismatches of the specie-specific probe leads to a decrease in detection (L98-99).

Our reply: In quantitative PCR (qPCR) analysis, base pair mismatches between target species and probes are reported to reduce detection of DNA in human [26] or primers in fish [27]. Wilcox et al. [27] showed that eDNA detection of fish was decreased by base pair mismatches in primer regions rather than that in probe regions. These studies are different from our study in target species (human or fish) and findings (discussed in Discussion section: L 407-411). To avoid any confusion, we revised these sentences as “In quantitative PCR (qPCR) analysis using species-specific primers/probes, mutations and polymorphisms will affect the eDNA detection rate. Base pair mismatches between target species and probes have been reported to reduce the detection of DNA in humans [26] or primers in fish [27]” (L 69-74).

#R1-2: L59-60, 70-73: There are duplications of text content between paragraphs.

Our reply: We thank the reviewer for identifying this duplicative impression. Actually, the former represents those in the field and the latter in tank experiments. We made sentences to be more explicit in the revised manuscript (L 61-63 and L 75-78, respectively).

#R1-3: L88-93: To clarify the significance of this study, it is necessary to explain what problems may occur if there is diurnal variation in eDNA concentration of Japanese eel. We agree that there are contradictions in results among previous studies, but you should not discuss based on studies using some taxa with very different ecological characteristics.

Our reply: As per the reviewer’s suggestion, we added “To accurately evaluate Japanese eel biomass through eDNA analysis, it is necessary to clarify whether there is diurnal variation in the eDNA concentration of eels” at the end of this paragraph (L 100-102). We are focusing on “nocturnal/diurnal habits” beyond taxa with different ecological characteristics.

#R1-4: L75, 100: What is "individual differences"? (ex. size, figure, sex, physiological state, nutrition condition etc.) In this study, only the difference in activity was considered.

Our reply: We thank the reviewer for pointing it out. We added “and the suspected factors are listed as metabolic rate, stress, life stage, and physiological or behavioral state [34]” at the end of this sentence (L 81-83). We revised the reference of [13] as a new reference [34] (it was a careless mistake). We described “individual differences” as “individual differences in eDNA release rate on eDNA concentration” in the latter sentence (L 110).

#R1-5: L155-162: The amounts of extraction reagents written in the manuscript are different from those written in the Environmental DNA Sampling and Experiment Manual (v. 2.1). Is the first centrifugation a newly added step? Also, how was the filtrate from the first centrifugation processed (discarded or kept) ?

Our reply: As the reviewer pointing it out, the amounts of extraction reagents written in the manuscript are sometimes different from those written in the Manual. Therefore, we added “with a slight modification” at the end of this sentence (L 159-160). All modifications that we made have been written in the revised manuscript. The first centrifugation is a newly added step. The first centrifugation (removing extra water from filters, which had absorbed water during the preservation at -20 °C) is needed to lyse DNA effectively in the following process. The filtrate from the first centrifugation was kept in the lower part of a Salivette tube.

#R1-6: L170-176: The D-loop region has a higher mutation rate, so intraspecific genetic diversity is more likely to accumulate. Even though other species-specific primers which were designed in other regions with lower mutation rate than D-loop have been published, why did you not use them?

Our reply: As the reviewer pointing it out, the D-loop region is known to have a higher polymorphic rate than other mitochondrial regions. However, the other mitochondrial regions can also be polymorphed. Actually, we detected similar polymorphisms in the probe region targeting mitochondrial cytochrome b of jack mackerel (L 436-439). We took polymorphism as a subject to be generally careful about, irrespective of mitochondrial regions. In this study, we used the same primers/probe sets as Kasai et al [36] who surveyed nationwide eel distribution in Japan. The specificity has been carefully checked based on 857 individuals of A. japonica tissue samples, as well as all other congeneric species which could potentially be detected due to food consumption or release into rivers (L 456-458). Other species-specific primers, which were designed in other regions with lower polymorphic rate than D-loop, have been published (e.g., 16S: Watanabe et al (2004), or Cytb: Takahara et al (2020) L&O methods). However, these primer sets have not been validated in the original studies for their specificity against all of the non-target closely related species in the same genus listed in our main manuscript using genomic DNA samples. Therefore, we used the one used in Kasai et al [36].

#R1-7: L174: The Japanese eel-specific probe used in this study had MGB fluorescent dye. The use of MGB accentuates the difference in Tm due to SNPs, so the probe is less likely to anneal to target region when there is a mismatch in the priming site. Please add discussions about the possibility that the MGB emphasized the effect of probe mismatches on DNA detection in this study.

Our reply: As per the reviewer suggestion, we added discussions about the possibility that the MGB emphasized the effect of probe mismatches on DNA detection (L 430-432); “In particular, the use of MGB accentuates the difference in Tm due to single nucleotide polymorphisms (SNPs), and the probe is less likely to anneal to the target region when there is a mismatch in the priming site”. We have conducted an additional quantification of eDNA samples by intercalator method (SYBR Green) (L 207-221), and added the results (L 326-331) and the discussion (L 430-432, 440-445).

#R1-8: L226-230: I don't think the method of scoring the activity used in this study is appropriate. How was the score for each activity determined? Why didn't you use the amount of movement distance per unit of time or the number of respirations or fin movements? I think the current scoring system underestimates the amount of action to get out from a pipe and forage for food.

Our reply: The amount of movement distance per unit of time, the number of respirations or fin movements were not used because 1) we needed to set a pipe to reduce the stress of each eel at the tank experiment, and respirations and fin movements were not possible to be counted when it was in a pipe; 2) eels moved only occasionally, and thus movement distance per hour would be very low; and 3) we found that the activity amount of an eel in a pipe was lower than that of the eel moving caudal fin out of the pipe or that of the body being out of the pipe. Therefore, we determined the score for each activity in ascending order for convenience sake (L 255-259).

#R1-9: L359-361: I am very confused because there is a lack of explanation about Figure 2D. Why only five amplification curves are shown in figure 2D? Also, why are the collection dates of the samples different? (Not standardized to a specific day, ex. the first day, of each experiment cycle)

Our reply: We obtained too many amplification curves to be shown in a figure, so we selected representative values of them (Fig 2-1D). We standardized the collection dates of the samples to the first day after acclimatization (May 27 and June 3) in order to avoid the influence of contaminations (L 143-148), except for May 25, when eDNA concentration of Polymorphism-1 was positive (Fig 2-1A, 2-1B).

#R1-10: L365-368: From the second day, the eDNA concentrations of all eels without probe mismatch increased significantly. Considering this result, it is natural to assume that the eels with mismatch also likely released more eDNA on the second day than the first day. Please add a discussion about the reason why no DNA was detected after the second day, even though there may have been more eDNA.

Our reply: We agree with the reviewer. The result by an intercalator method with SYBR Green also showed that Variant-1 released more eDNA on the second day than the first day (Fig 2-2A). We do not know the cause of this and added a sentence (L 423-424); “We have no reasonable explanation for this phenomenon, which is a subject to be solved in future research”.

#R1-11: L383-386: To design a more robust species-specific primers/probe, all obtained sequences should be used and compared to select SNP-free regions. Consensus sequences are not simply calculated based on the number and frequency of mutations. In addition, it is important that the selection of the target region. There is more mutation in the mitochondrial D-loop region because it has a higher mutation rate than other regions. The selection of cytb, 16S and 12S etc. decrease the risk of unexpected mismatch between primer/probe sequence and the target region.

Our reply: As explained in the reply above, the D-loop region is known to have a higher polymorphic rate than other mitochondrial regions. However, other mitochondrial regions still have intraspecific variation. From the observation that we detected similar polymorphisms in the probe region using mitochondrial cytochrome b of jack mackerel (L 436-439, [17]), we focused on the risk of an unexpected mismatch from primer/probe sequence template as a subject to be generally careful about, irrespective of mitochondrial regions. In this study, we carefully checked the intraspecific variation of the primers/probe sets, as described above (#R1-6). We showed this result for the purpose of contributing to design a more robust species-specific assay.

#R1-12: L386-388: Japanese eels spawn near the Mariana Islands, and juveniles are randomly carried by ocean currents to the coast of Japan. Therefore, it is not surprising that 20 individuals purchased from the same aquaculture provider have different haplotypes.

Our reply: We thought that haplotypes of the eels obtained from a single provider who purchased juveniles and cultivated in one time would be more similar than those obtained from several providers who cultivated at various timing. Nevertheless, the above is speculative and so we delated “simultaneously obtained from the same aquaculture provider” (L 460-461).

#R1-13: L428: I couldn't understand what this sentence was referring to. Please add a more detail explanation.

Our reply: To avoid any confusion, we revised “In the latter process” as “In the metabolic process” (L 522).

#R1-14: L438-439: Why is it limited to mucus? I am very confused.

Our reply: To avoid any confusion, we have added “and other substances” after “mucus” (L 533).

#R1-15: L453-454: I think that the Japanese eel "ecophysiology" was not examined. In addition, it is difficult to say that it revealed the effect of "behavior" on DNA concentration because this study only evaluated whether the eels were out of the pipe and/or moved their caudal fins.

Our reply: To avoid any confusion, we revised “ecophysiology and behavior” as “diel rhythm and activity” (L 550-551).

#R1-16: Fig.4: Please use same Y-axis range among graphs.

Our reply: As per the reviewer's suggestion, we revised Y-axis range in Fig 4 (and S1 Fig).

#R1-17: Table S1: Which primers were used for Sanger sequencing of each individual? If the DNA amplicon was sequenced using the same primers as qPCR, you will not be able to find mismatches in the priming sites of the primers. Additionally, what does the ( ) on the reverse primer site indicate?

Our reply: We thank the reviewer for this constructive comment. We used the same primers as qPCR for Sanger sequencing. Around the end of primer R-3', base peaks overlapped and another base was occasionally judged, which was shown as “()”. Such phenomenon is generally found around the end of primer R-3'. On the other hand, presenting primer base sequences would not make much sense as the reviewer pointed out. Therefore, they were deleted from the previous S1 Table to be the new S2 Table.

#R1-18: ・This study does not explore the effect of probe mismatch for detection enough. While probe mismatches are likely to inhibit the detection of the target sequence (I agree with this), if the authors are serious about making a contribution to this issue, they should have examined the impact of sequence mismatches on detection rate using a known concentration DNAs.

Our reply: We agree with this comment by the reviewer. However, the suggested experiment would not be possible, because we have no tissue samples of the eels left. We have eDNA samples from eel tank water which we have analized the sequence, though the eDNA concentration isn’t high enough to prepare a series of DNA samples with different concentrations. We think it is important to show the effect of sequence mismatches in the probe annealing region in this first report, though we have indirectly confirmed the effect of probe mismatching by conducting eDNA quantification by SYBR Green method that doesn’t emply the probe as above. Even though we didn’t directry assess the effect of the mismatches using degenerated probes we recognize the importance of this study which elucidates this phenomenon in an individual tank experiment for the first time.

#R1-19: ・In experiment 1, authors cannot exclude the possibility that the eel with the sequence mutations released less eDNA than other eels. To investigate this possibility, it is highly recommended to quantify DNA concentrations by both of TaqMan and intercalater methods (ex. SYBR Green) to clearly show that sequence mismatch of TaqMan probe is inhibiting detection. Although the authors emphasize the high species-specificity of the primers/probe (in methods and discussion), it is not so important in this study because only eels were kept in tank.

Our reply: This DNA region is a non-coding region, so it is unlikely that the eel with the sequence mismatch released less eDNA than other eels. The difference among individuals was naturally large and we observed this in the other species than eels (ex. jack mackerel and striped knifejaw: Oplegnathus fasciatus), although we do not know if these species had base mismatches in the D-loop region or not. We performed an additional experiment to quantify DNA concentrations by an intercalator method with SYBR Green (L 207-221). As a result, concentrations of the polymorphic DNAs were demonstrated to be as high as the others, implying that the sequence mismatch of the TaqMan probe is inhibiting eDNA detection (L 326-331; Fig 2-2).

Reviewer #2: Manuscript PONE-D-20-38269

(Response)

#R2-1: - In my opinion, the choice of marker was poorly justified. It is well known that Dloop is one of the most polymorphic region within the mitochondrial DNA. Do the authors expect to have such an impact in the case of other, less variable, markers. On top of that, it will be important to report the level of polymorphism (at the probe region) on natural populations of eels. Thus, this will allow the reader to identify the magnitude of the bias when screening natural populations.

Our reply: As the reviewer pointed out, the D-loop region is known to have a higher polymorphic rate than other mitochondrial regions. However, other regions can also be polymorphed. Indeed, we detected similar polymorphisms in the probe region targeting mitochondrial cytochrome b in jack mackerel (L 436-439). We took up the polymorphism as a subject to be careful about, irrespective of the mitochondrial regions. In this study, we used the same primers/probe sets as Kasai et al [36], who conducted a nationwide eel distribution survey in Japan using these primers. They checked the specificity of the primers based on 857 individuals of A. japonica tissue samples (> 93% base pair sequence matching with the probe region sequence [36]) and all the congeneric species that would be potentially detected in rivers due to food consumption or release of introduced individuals (L 456-458). We have no data concerning the level of polymorphism in natural populations. As we detected two variants out of 20 purchased individuals and juveniles should have been well randomized from the spawning site, the level might be around 10 %. This would be negligible when eDNA is applied to presence/absent evaluation when the population is abundant, whereas inducing slight underestimation in the quantification. When the population is small, it can also be a cause of false negative data even in presence/absence surveys. These inferences have been included in the revised Discussion of the manuscript (L 463-471).

#R2-2: - Related with the previous point, I was surprised that the authors didn´t test additionally the use of degenerated probes in order to surpass the underestimation of eDNA (or the lack of detection).

Our reply: Instead of testing the use of degenerated probes, we did an additional experiment to quantify DNA concentrations by an intercalator method with SYBR Green (L 207-221). The concentration of the polymorphic DNAs was confirmed to be as high as the others (L 326-327; Fig 2-1, 2-2). This result clearly showed that a probe base mismatch was the cause of the underestimation of eDNA (or the lack of detection).

#R2-3: - I was wondering if the total amount of DNA extracted from the filters was independently quantified using other methods (e.g. Qubit). This would allow to discard that underestimated samples (e.g. “Mutants”) didn´t have less amount of total DNA than the others.

Our reply: As mentioned above (#R2-2), the concentration of the polymorphic DNAs was equivalent to the others according to the intercalator method with SYBR Green (L 326-327; Fig 2-1, 2-2). We added “These results confirmed that the total amount of DNA extracted from the filters in Variant-1 and -2 was equivalent to that of the other individuals” in the Discussion section (L 442-445).

#R2-4: - I was also wondering if inhibitor´s test were performed, particularly for those samples were no detection was possible. It is expected that Negative samples spiked-in with positive controls should amplified in the absence of inhibitors.

Our reply: As mentioned above (#R2-2), the concentration of the polymorphic DNAs was equivalent to the others in the intercalator method with SYBR Green (L 326-327; Fig 2-1, 2-2). This result excludes the possibility of containing inhibitors. We added “ These results confirmed that the total amount of DNA extracted from the filters in Variant-1 and -2 was equivalent to that of the other individuals, and inhibitors were absent from these samples” in the Discussion section (L 442-445).

#R2-5: - I think is more correct to use “polymorphism” instead of “mutation” all over the text. The “mutants” that are reported here, seem to be common polymorphisms in natural populations.

Our reply: We thank the reviewer for giving us an opportunity to reconsider this term. As the reviewer pointed out, mutation may not be the ideal term in this manuscript. In the revised manuscript, we have used polymorphism as a term to represent the phenomenon of having a base pair mismatch in a primers/probe region and (genetic) variant to represent an individual having such a base pair mismatch.

#R2-6: - Despite the fact the authors performed 3 replicates per sample for eDNA quantification/detection, I was wondering why they use only 1 biological replicate. Each time, only one water sample was taken. The authors should discuss this point and it will be important to know if the level of variation within tank at each time-point was significant.

Our reply: We collected three 500-mL plastic bottles of water per sampling in Experiment 2, and discussed; “The coefficients of variation in the individual eDNA concentration measurements were significantly larger than those for the sampling and PCR replications (Fig 5). The fluctuations in eDNA concentration might be the result of individual variations in the eDNA release rate” (L 494-497). Here, the most important result is; “eDNA concentrations were constantly low in polymorphic samples by TaqMan method, though eDNA concentrations increased in polymorphic samples by an intercalator method with SYBR Green.”

Minor comments:

L28: intraspecific (� L 29)

L41: polymorphic sites at the probe region (� L 42-43)

L97: to identify factors (� L 106)

L117: Miyazaki (Japan) (� L 129)

L125: from May 25, to June 14, 2018 (� L 137-138)

L126: unused? (� L 139)

L205: In my opinion, Table 1 could be shown as supplementary table. (� L 234-235)

L235: 23, and July (� L 264-265)

Our reply: Thank you for pointing them out. As per your suggestion, we revised them, and “unused eels” as “individuals of eels that had not experienced an experiment” (L 139), and Table 1 as S1 Table (L 234-235).

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

In compliance with data protection regulations, you may request that we remove your personal registration details at any time. (Remove my information/details). Please contact the publication office if you have any questions.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(46.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0255576.r003

Decision Letter 1

Hideyuki Doi

17 May 2021

PONE-D-20-38269R1

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

PLOS ONE

Dear Dr. Takahashi,

==============================

I got the recommendations and comments from a previous reviewers. The reviewer agree that the manuscript is improved but suggested that more experimental work and careful discussion are necessary for examining the effect of mismatch between probe and target sequence on detection efficiency and provided other major/minor comments. I totally share these comments. Therefore, I can invite you to submit a revised version of the manuscript that addresses the points raised by the reviewer.

==============================

Please submit your revised manuscript by Jul 01 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: I have re-reviewed the manuscript “Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel” by Sayaka Takahashi et al. The revised manuscript addresses some of the major concerns; however, several more experimental work and careful discussion are necessary for examining the effect of mismatch between probe and target sequence on detection efficiency. I offer a few major and minor suggestions for improvement below.

・The current title and text may cause the reader to misunderstand. This study suggested that mismatches between probes and target sequences, not genetic diversity, affect the efficiency of eDNA detection. In fact, SNP at a site other than the priming sites of primers and probes do not affect the estimation of eDNA concentration by qPCR.

・In the responses to the reviewer, the authors used the same primers with qPCR for the Sanger sequencing to check the presence of SNPs. Again, “if the DNA amplicon was sequenced using the same primers as qPCR, you will not be able to find mismatches in the priming sites of the primers” because the priming site of the primers is replaced by the primer sequence. I think, this study did not examine whether there was a sequence mismatch in the primer positions (not probe). According to Kasai et al (2020), the priming sites of the primers sometimes have SNP. Thus, in my opinion, without confirming that there is no mismatch in the priming sites of the primers, the results in this study cannot properly understand and discussed.

・The overall impression is redundant because the point of the argument in each paragraph is not clear, and similar content is written several times.

L55-56: Itakura et al. (2019) demonstrated that eDNA analysis allows us to reveal the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale.

L73-75: Is this true? I think, the relationship between eDNA concentration and biomass and/or the number of individuals is a major topic that has been examined by a great number of studies, and some of which have reported a strong relationship.

L79: “The eDNA concentration increases 10–200× during spawning [35].” → "[25]" ?

L90: Ghosal et al. (2018) reported that the carp eDNA concentration increased 500× at night when the fish biomass only doubled. However, this experiment was carried out under special experimental conditions. Thus, descriptions with generality should be avoided.

L157, 169: “-20 °C” → “−20 °C”

L182: “Each PCR reaction system included” → “Each PCR reaction included”

L190: “There were three replicates per sample” → There were three replicates per sample “and standard DNAs”?

L198: “each target species” → each target individual ?

L174-176, L423-426: I still have a question as to why we did not use other species-specific primers and probe sets designed in other regions. Again, the specificity is not so important in this study because tank water was used in all experiments.

In the responses to the reviewers, the authors accepted that D-loop is more likely to accumulate intraspecific genetic diversity than other regions. The other mitochondrial regions can also be polymorphed, but the "mutation rate" vary widely among regions. I agree that the presence of polymorphisms is an issue to be generally careful. However, in the eDNA study, the risk of underestimation caused by the primer/probe mismatch can be reduced by selecting regions that generally have lower mutation rates than D-loop.

In my opinion, in this manuscript, the authors should include the discussion about the selection of the target region to reduce the risk of mismatches and the reason why the primer-probe set designed in the D-loop was used in this study.

L394-396: The eDNA concentration was different among samples. Thus, the comparison of Ct values here is meaningless.

・In my opinion, in all tables and Figures, eDNA concentration should be shown per volume of filtered water (500 mL) or per PCR template (2 µL).

・Please check the following points: (1) Are coloured letters allowed in PLOS One? (2) Are the legends inserted in the correct place in the manuscript?

Table1: Please add the Tm of the probes that are expected in each situation (Non variant, Vatiant-1, and Variant-2).

Fig2-1(D): What does the Y-axis indicate?

Fig2-1 and 2: To compare the eDNA concentration for each sample quantified by TaqMan (Fig. 2-1) and SYBR (Fig. 2-2), I recommend using sample-specific marks.

Fig.2-1(A), 2(A): The red and orange dots are difficult to distinguish, so I recommend changing the colour.

S2 table: “between 5'-primer F and probe” → “between 3'-primer F and probe” ?

“between probe and primer R-3'” → “between probe and primer R-5'” ?

“*Green: base different from sample 0525_A-1.” → What does 0525 mean?</discussion></materials></introduction>

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

PLoS One. 2021 Sep 16;16(9):e0255576. doi: 10.1371/journal.pone.0255576.r004

Author response to Decision Letter 1

9 Jul 2021

July 9, 2021

PhD. Hideyuki Doi,

Academic Editor,

PLOS ONE

Dear Editor:

The manuscript has been carefully rechecked and appropriate changes have been made according to the reviewer’s suggestion. The responses to the comments have been prepared and are attached herewith.

We thank you and the reviewer for your thoughtful suggestions and insights, which have enriched the manuscript. We hope that the revised manuscript is now suitable for publication in your journal.

We are not allowed to deposit our laboratory protocols in protocols.io, and the protocols were fully described in our manuscript.

I look forward to your reply.

Sincerely,

Sayaka Takahashi

Oita Junior College of Horticulture

Chiyomachi, Oita, 870-8658, Japan

Phone: +81-97-535-0201, Fax: +81-97-540-6509, e-mail: takahashi.sayaka.k35@kyoto-u.jp

PONE-D-20-38269R1

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

PLOS ONE

Dear Dr. Takahashi,

==============================

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: (No Response)

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

6. Review Comments to the Author

Our reply: We thank the reviewer for the constructive comments, which have substantially improve the readability of the manuscript.

(Response)

We thank the reviewer for identifying the potential misunderstanding. The present result, i.e. less detection of eDNA in variants, indeed reflects the mismatches between probes and taget species as the reviewer suggested. However, essential finding of the study is that genetic variability would affect eDNA detection in the field even in a carefully designed set of primers and probe. We consider that there is a trade-off between speficity to target species and the risk of including variability in the probe region. This has been emphasized in the Discussion (Line 506–519) and we hope that our intention would be conveyed better in the revised manuscript.

(Response)

Although the presence of SNPs affects DNA amplification, the DNA amplicon is certainly amplified in the following steps once the templates are annealed by the primers, because the sequence of DNA amplicon completely matches the sequence in the priming sites of the primers. On the other hand, mismatches of sequences between probe and templates are not eliminated in the following amplification steps. Therefore, we consider that the negative effect of polymorphs in probe region on DNA amplification should be substantial.

As per the reviewer pointed out, we could not discuss whether there was a sequence mismatch of the primer region in our study without samples. We cannot show the information that completely wipes out the concern of the reviewer. However, eDNA amplification in Variants by SYBR Green method was mach more larger than that by TaqMan method. DNAs of Vatiant-1 and Variant-2 were amplified to the same amount as Non variants’ by using the same primers with qPCR in additional experiment by SYBR Green method. Therefore, the mismatches in the priming sites of the primers are not likely to have affected eDNA detection.

Nevertheless, we agree that it is also important to consider such a possibility, and thus it has been mentioned as a key consideration in the revised Conclusions and perspectives section (Line 608-611).

・The overall impression is redundant because the point of the argument in each paragraph is not clear, and similar content is written several times.

(Response)

We thank the reviewer for pointing out redundancy in the manuscript. We made efforts to streamline the text particularly in the Introduction section.

L55-56: Itakura et al. (2019) demonstrated that eDNA analysis allows us to reveal the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale.

(Response)

We are aware of the study of Itakura et al. (2019) as referred in the next paragraph of the former manuscript. Although their study surveying in more than 100 sites is impressive, the study not necesarily covered nation wide river basins. Besides, the topic in this first paragraph is the distribution of Japanese eel in general without a focus on eDNA. To avoid confusion we revised from “distribution” to “spatiotemporal distributions” and from “in rivers“ to “in various river sites“ in this sentence (Line 56-57).

(Response)

Yes. It is true. Some researchers have reported a strong relationship between eDNA concentration and biomass and/or the number of individuals. However, other researchers, including Itakura et al. (2019), have reported only weak positive relationship between them (Line 82-83). Considering that non-significant results would be published less, we can say that the relationship between eDNA concentration and fish abundance is yet to be established.

L79: “The eDNA concentration increases 10–200× during spawning [35].” → "[25]" ?

(Response)

We thank the reviewer for pointing out this flaw. We revised the citation (Line 107).

(Response)

We agree with the reviewer to the point that Ghosal et al (2018) described a special case. Therefore, for clarity, we revised “The carp eDNA concentration increased 500× at night when the fish biomass only doubled [40]” as “Nocturnal carp eDNA concentrations increased 500-fold at night when fish biomass only doubled at a feeding site [36]” (Line 95-96).

L157, 169: “-20 °C” → “−20 °C”

(Response)

We revised them according to the suggestion (Lines 210).

L182: “Each PCR reaction system included” → “Each PCR reaction included”

(Response)

As per the reviewer’s suggestion, we revised “Each PCR reaction system included” as “Each PCR reaction included” (Line 236).

L190: “There were three replicates per sample” → There were three replicates per sample “and standard DNAs”?

(Response)

As per the reviewer’s suggestion, we added “and standard DNAs” after “There were three replicates each of all samples” (Lines 243-244).

L198: “each target species” → each target individual ?

(Response)

As per the reviewer’s suggestion, we revised “each target species” as “each target individual” (Line 252).

(Response)

We thank the reviewer for this constructive comments. We added the discussion about the selection of the target region (D-loop) in the discussion section (Line 512-519).

This primers/probe set has been also used in Kasai et al. (2020) and Kasai. et al (2021), who conducted a nationwide eel distribution survey in Japan. Individual tank experiment of our study using this primers/probe sets revealed that polymorphism in the probe region strongly affected eDNA detection. We carefully checked the specificity in the set of primers, then we used this set in our study. It is necessary to design primers/probe set selecting lower intraspecific polymorphic regions, when eDNA concentration of each individuals must be precisely measured.

This point has been emphasized in the revised manuscript.

L394-396: The eDNA concentration was different among samples. Thus, the comparison of Ct values here is meaningless.

(Response)

As per the reviewer’s suggestion, we delated the sentence describing Ct values (Line 465-466).

・In my opinion, in all tables and Figures, eDNA concentration should be shown per volume of filtered water (500 mL) or per PCR template (2 µL).

(Response)

We consider this suggestion of the reviewer very carefully. As an independent experiment it is indeed sensible to express eDNA concentration per filtered water (500 mL) or PCR template (2 µL). Meanwhile it seems to be common to express eDNA concentraiton in copies / L (Maruyama et al. 2014; Klobucar et al. 2017; Horiuchi et al. 2019; Yates et al. 2020 etc). Furthermore, the present study is strongly related to Kasai et al. (2021) in which the same primers-probe set was used to detected eel eDNA in natural waters of 50–600 mL per site then it was converted to be copies / L. Therefore we would like to be consistent to this expression.

・Please check the following points: (1) Are coloured letters allowed in PLOS One? (2) Are the legends inserted in the correct place in the manuscript?

(Response)

We thank the reviewer for pointing them out. (1) We revised coloured letters (Line 356, 361-363, 377-379, 404). (2) Submission Guidelines of PLOS ONE says “The (figure) caption may also include a legend as needed”, a newline before the legend was added in the figure caption example, and “Place legends, footnotes, and other text below the table”. It also says “You may also include a legend in your caption, but it is not required”. Therefore, we added newlines before the legends in the figures, and delated legends from tables and figures in the Supporting Information section (Line 808-848).

Table1: Please add the Tm of the probes that are expected in each situation (Non variant, Vatiant-1, and Variant-2).

(Response)

As we use MGB (minor groove binder) probe, it is not possible to calculate the expected Tm including the effect of mismatch nucleotides between the variants and the probe sequence due to the non-disclosure of calculation mechanism (the patent is held by ThermoFisher).

Fig2-1(D): What does the Y-axis indicate?

(Response)

We thank the reviewer for pointing out this flaw. Y-axis had been hiding behind. We brought it to the front.

Fig2-1 and 2: To compare the eDNA concentration for each sample quantified by TaqMan (Fig. 2-1) and SYBR (Fig. 2-2), I recommend using sample-specific marks.

(Response)

As per the reviewer’s suggestion, we revised the figures to have sample-specific marks; square: A-1; diamond: B-1; triangle: C-1; cross: A-2; bar: B-2; circle: C-2. Figure captions have also been revised accordingly (Fig2-1 and Fig2-2).

Fig.2-1(A), 2(A): The red and orange dots are difficult to distinguish, so I recommend changing the colour.

(Response)

As per the reviewer’s suggestion, we revised the colour of orange as green in Fig.2-1(A), Fig.2-2(A).

S2 table: “between 5'-primer F and probe” → “between 3'-primer F and probe” ?

“between probe and primer R-3'” → “between probe and primer R-5'” ?

“*Green: base different from sample 0525_A-1.” → What does 0525 mean?

(Response)

We revised “between 5'-primer F and probe” as “between primer F-3' and probe”, and “between probe and primer R-3'” as ”between probe and 3'-primer R”. “0525” means sampling day.

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(37.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0255576.r005

Decision Letter 2

Hideyuki Doi

21 Jul 2021

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

PONE-D-20-38269R2

Dear Dr. Takahashi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

I carefully checked the revised manuscript as well as the response letter. I agree the revisions according to the reviewers’ comments and now can recommend to publish the paper in this journal.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0255576.r006

Acceptance letter

Hideyuki Doi

8 Sep 2021

PONE-D-20-38269R2

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

Dear Dr. Takahashi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Hideyuki Doi

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Correlation between eDNA concentration and activity score 3 h before water sampling.

(TIF)

Click here for additional data file.^{(329.3KB, tif)}

S1 Table. Length and weight of samples.

(XLSX)

Click here for additional data file.^{(14.8KB, xlsx)}

S2 Table. Sequence results for 20 Anguilla japonica samples.

(XLSX)

Click here for additional data file.^{(11.5KB, xlsx)}

S3 Table. Parameters of standard curves for qPCR measurements on each sampling date.

(XLSX)

Click here for additional data file.^{(11.4KB, xlsx)}

S4 Table. P-values of Shapiro’s test, var-test, and Bartlett’s t-test.

(XLSX)

Click here for additional data file.^{(13.3KB, xlsx)}

S5 Table. Melting temperatures (Tm) of standard and each samples.

(XLSX)

Click here for additional data file.^{(11.3KB, xlsx)}

S6 Table

(XLSX)

Click here for additional data file.^{(72.1KB, xlsx)}

S7 Table. eDNA concentrations in Table 2, Figs 3–5 and S1 Fig.

(XLSX)

Click here for additional data file.^{(31.6KB, xlsx)}

S8 Table. Activity score used in Figs 3 and 4 and S1 Fig.

(XLSX)

Click here for additional data file.^{(149KB, xlsx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(46.6KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(37.9KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0255576.ref001] 1.Tsukamoto K, Aoyama J, Miller MJ. Present status of the Japanese eel: resources and recent research. In: Casselman J, Cairns D, editors. Eels at the edge. Bethesda, Maryland; 2009. pp. 21–35. [Google Scholar]

[pone.0255576.ref002] 2.Jacoby D, Gollock M [Internet]. [cited 2020 Mar 6]. Anguilla japonica. The IUCN Red List of Threatened Species 2014: e.T166184A1117791. 10.2305/IUCN.UK.2014-1.RLTS.T166184A1117791.en. [DOI]

[pone.0255576.ref003] 3.Tsukamoto K. Oceanic biology: Spawning of eels near a seamount. Nature. 2006;439: 929. doi: 10.1038/439929a [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref004] 4.Kimura S, Tsukamoto K, Sugimoto T. A model for the larval migration of the Japanese eel-roles of the trade winds and salinity front. Mar Biol. 1994;119: 185–190. [Google Scholar]

[pone.0255576.ref005] 5.Tsukamoto K, Nakai I, Tesch WV. Do all freshwater eels migrate? Nature. 1998;396: 635–636. [Google Scholar]

[pone.0255576.ref006] 6.Itakura H, Wakiya R, Yamamoto S, Kaifu K, Sato T, Minamoto T. Environmental DNA analysis reveals the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale. Aquat Conserv Mar Freshw Ecosyst. 2019;29: 361–373. [Google Scholar]

[pone.0255576.ref007] 7.Kasai A, Yamazaki A, Ahn H, Yamanaka H, Kameyama S, Masuda R, et al. Distribution of Japanese eel Anguilla japonica revealed by environmental DNA. Front Ecol Evol. 2021;9: 621461. [Google Scholar]

[pone.0255576.ref008] 8.Ficetola GF, Miaud C, Pompanon F, Taberlet P. Species detection using environmental DNA from water samples. Biol Lett. 2008;4: 423–425. doi: 10.1098/rsbl.2008.0118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref009] 9.Bohmann K, Evans A, Gilbert MTP, Carvalho GR, Creer S, Knapp M, et al. Environmental DNA for wildlife biology and biodiversity monitoring. Trends Ecol Evol. 2014;29: 358–367. doi: 10.1016/j.tree.2014.04.003 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref010] 10.Kelly RP, Port JA, Yamahara KM, Martone RG, Lowell N, Thomsen PF, et al. Harnessing DNA to improve environmental management. Science. 2014;344: 1455–1456. doi: 10.1126/science.1251156 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref011] 11.Rees HC, Maddison BC, Middleditch DJ, Patmore JRM, Gough KC. The detection of aquatic animal species using environmental DNA–a review of eDNA as a survey tool in ecology. J Appl Ecol. 2014;51: 1450–1459. [Google Scholar]

[pone.0255576.ref012] 12.Barnes MA, Turner CR. The ecology of environmental DNA and implications for conservation genetics. Conserv Genet. 2016;17: 1–17. [Google Scholar]

[pone.0255576.ref013] 13.Thomsen PF, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MTP, et al. Monitoring endangered freshwater biodiversity using environmental DNA. Mol Ecol. 2012;21: 2565–2573. doi: 10.1111/j.1365-294X.2011.05418.x [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref014] 14.Bergman PS, Schumer G, Blankenship S, Campbell E. Detection of adult green sturgeon using environmental DNA analysis. PLoS One. 2016;11: e0153500. doi: 10.1371/journal.pone.0153500 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref015] 15.Eichmiller JJ, Bajer PG, Sorensen PW. The relationship between the distribution of common carp and their environmental DNA in a small lake. PLoS One. 2014;9: e112611. doi: 10.1371/journal.pone.0112611 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref016] 16.Bylemans J, Furlan EM, Hardy CM, McGuffie P, Lintermans M, Gleeson DM. An environmental DNA-based method for monitoring spawning activity: a case study, using the endangered Macquarie perch (Macquaria australasica). Methods Ecol Evol. 2017;8: 646–655. [Google Scholar]

[pone.0255576.ref017] 17.Yao Y, Nellaker C, Karlsson H. Evaluation of minor groove binding probe Taqman probe PCR assays: Influence of mismatches and template complexity on quantification. Mol Cell Probes. 2006;20: 311–316. doi: 10.1016/j.mcp.2006.03.003 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref018] 18.Wilcox TM., McKelvey KS, Young MK, Jane SF, Lowe WH, Whiteley AR, et al. Robust detection of rare species using environmental DNA: the importance of primer specificity. PLoS One. 2013;8: e59520. doi: 10.1371/journal.pone.0059520 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref019] 19.Yoshitake K, Yoshinaga T, Tanaka C, Mizusawa N, Reza MS, Tsujimoto A, et al. HaCeD-Seq: a novel method for reliable and easy estimation about the fish population using haplotype count from eDNA. Mar Biotechnol. 2019; 21: 813–820. doi: 10.1007/s10126-019-09926-6 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref020] 20.Takahara T, Minamoto T, Yamanaka H, Doi H, Kawabata Z. Estimation of fish biomass using environmental DNA. PLoS One. 2012;7: e35868. doi: 10.1371/journal.pone.0035868 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref021] 21.Pilliod DS, Goldberg CS, Arkle RS, Waits LP. Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Can J Fish Aquat Sci. 2013;70: 1123–1130. [Google Scholar]

[pone.0255576.ref022] 22.Doi H, Inui R, Akamatsu Y, Kanno K, Yamanaka H, Takahara T, et al. Environmental DNA analysis for estimating the abundance and biomass of stream fish. Freshw Biol. 2017;62: 30–39. [Google Scholar]

[pone.0255576.ref023] 23.Klobucar SL, Rodgers TW, Budy P. At the forefront: evidence of the applicability of using environmental DNA to quantify the abundance of fish populations in natural lentic waters with additional sampling considerations. Can J Fish Aquat Sci. 2017;74: 2030–2034. [Google Scholar]

[pone.0255576.ref024] 24.Yates MC, Glaser DM, Post JR, Cristescu ME, Fraser DJ, Derry AM. The relationship between eDNA particle concentration and organism abundance in nature is strengthened by allometric scaling. Mol Ecol. 2020;00: 1–15. doi: 10.1111/mec.15543 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref025] 25.Thomsen PF, Møller PR, Sigsgaard EE, Knudsen SW, Jørgensen OA, Willerslev E. Environmental DNA from seawater samples correlate with trawl catches of subarctic, deepwater fishes. PLoS One. 2016;11: e0165252. doi: 10.1371/journal.pone.0165252 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref026] 26.Yamamoto S, Minami K, Fukaya K, Takahashi K, Sawada H, Murakami H, et al. Environmental DNA as a ‘snapshot’ of fish distribution: A case study of Japanese jack mackerel in Maizuru Bay, Sea of Japan. PLoS One. 2016;11: e0149786. doi: 10.1371/journal.pone.0149786 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref027] 27.Uchii K, Doi H, Yamanaka H, Minamoto T. Distinct seasonal migration patterns of Japanese native and non-native genotypes of common carp estimated by environmental DNA. Ecol Evol. 2017;7: 8515–8522. doi: 10.1002/ece3.3346 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref028] 28.Takahashi S, Sakata MK, Minamoto T, Masuda R. Comparing the efficiency of open and enclosed filtration systems in environmental DNA quantification for fish and jellyfish. PLoS ONE. 2020;15: e0231718. doi: 10.1371/journal.pone.0231718 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref029] 29.Maruyama A, Nakamura K, Yamanaka H, Kondoh M, Minamoto T. The release rate of environmental DNA from juvenile and adult fish. PLoS One. 2014;9: e114639. doi: 10.1371/journal.pone.0114639 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref030] 30.Horiuchi T, Masuda R, Murakami H, Yamamoto S, Minamoto T. Biomass-dependent emission of environmental DNA in jack mackerel Trachurus japonicus juveniles. J Fish Biol. 2019;95: 979–981. doi: 10.1111/jfb.14095 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref031] 31.Kelly RP, Port JA, Yamahara KM, Crowder LB. Using environmental DNA to census marine fishes in a large mesocosm. PLoS One. 2014;9: e86175. doi: 10.1371/journal.pone.0086175 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref032] 32.Roussel J-M, Paillisson J-M, Trèguier A, Petit E. The downside of eDNA as a survey tool in water bodies. J Appl Ecol. 2015;52: 823–826. [Google Scholar]

[pone.0255576.ref033] 33.Spear SF, Groves JD, Williams LA, Waits LP. Using environmental DNA methods to improve detectability in a hellbender (Cryptobranchus alleganiensis) monitoring program. Biol Conserv. 2015;183: 38–45. [Google Scholar]

[pone.0255576.ref034] 34.Pilliod DS, Goldberg CS, Arkle RS, Waits LP. Factors influencing detection of eDNA from a stream-dwelling amphibian. Mol Ecol Resour. 2014;14: 109–116. doi: 10.1111/1755-0998.12159 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref035] 35.Thalinger B, Rieder A, Teuffenbach A, Pütz Y, Schwerte T, Wanzenböck J, et al. The effect of activity, energy use, and species identity on environmental DNA shedding of freshwater fish. Front Ecol Evol. 2021;9: 623718. [Google Scholar]

[pone.0255576.ref036] 36.Ghosal R, Eichmiller JJ, Witthuhn BA, Sorensen PW. Attracting Common Carp to a bait site with food reveals strong positive relationships between fish density, feeding activity, environmental DNA, and sex pheromone release that could be used in invasive fish management. Ecol Evol. 2018;8: 6714–6727. doi: 10.1002/ece3.4169 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref037] 37.Takahashi MK, Meyer MJ, Mcphee C, Gaston JR, Venesky MD, Case BF. Seasonal and diel signature of eastern hellbender environmental DNA. J Wildl Manage. 2018;82: 217–225. [Google Scholar]

[pone.0255576.ref038] 38.Takeuchi A, Iijima T, Kakuzen W, Watanabe S, Yamada Y, Okamura A, et al. Release of eDNA by different life history stages and during spawning activities of laboratory-reared Japanese eels for interpretation of oceanic survey data. Sci Rep. 2019;9: 6074. doi: 10.1038/s41598-019-42641-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref039] 39.Takeuchi A, Watanabe S, Yamamoto S, Miller MJ, Fukuba T, Miwa T. First use of oceanic environmental DNA to study the spawning ecology of the Japanese eel Anguilla japonica. Mar Ecol Prog Ser. 2019;609: 187–196. [Google Scholar]

[pone.0255576.ref040] 40.Takeuchi A, Sado T, Gotoh RO, Watanabe S, Tsukamoto K, Miya M. New PCR primers for metabarcoding environmental DNA from freshwater eels, genus Anguilla. Sci Rep. 2019;9: 7977. doi: 10.1038/s41598-019-44402-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref041] 41.Kasai A, Takada S, Yamazaki A, Masuda R, Yamanaka H. The effect of temperature on degradation of environmental DNA of Japanese eel. Fish Sci. 2020;86: 465–471. [Google Scholar]

[pone.0255576.ref042] 42.Tesch FW. The eel biology and management of anguillid eels. Blackwell Science, London; 2003. [Google Scholar]

[pone.0255576.ref043] 43.Aoyama J, Shinoda A, Sasai S, Miller MJ, Tsukamoto K. First observations of the burrows of Anguilla japonica. J Fish Biol. 2005;67: 1534–1543. [Google Scholar]

[pone.0255576.ref044] 44.Dou S, Tsukamoto K. Observations on the nocturnal activity and feeding behavior of Anguilla japonica glass eels under laboratory conditions. Environ Biol Fishes. 2003;67: 389–395. [Google Scholar]

[pone.0255576.ref045] 45.The eDNA Society. Environmental DNA Sampling and Experiment Manual. Version 2.1. Otsu, Japan; 2019.

[pone.0255576.ref046] 46.Dou S, Miller MJ, Tsukamoto K. Growth, pigmentation and activity of juvenile Japanese eels in relation to temperature and fish size. J Fish Biol. 2003;63: 152–165. [Google Scholar]

[pone.0255576.ref047] 47.R Development Core Team: R Statistical Software. Version 3.6.3 [software]. A language and environment for statistical computing. Vienna, Austria. R Foundation for Statistical Computing. 2020.

[pone.0255576.ref048] 48.Herrero B, Madrinan M, Vietes JM, Espineira M. Authentication of Atlantic cod (Gadus morhua) using real time PCR. J Agric Food Chem. 2010;58: 4794–4799. doi: 10.1021/jf904018h [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref049] 49.Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, et al. 3–Minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucl Acids Res. 2000;28: 655–661. doi: 10.1093/nar/28.2.655 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref050] 50.Ruijter JM, Lorenz P, Tuomi JM, Hecker M, van den Hoff MJB. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency. Microchimica Acta. 2014;181: 1689–1696. doi: 10.1007/s00604-013-1155-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0255576.ref051] 51.Arya M, Shergill IS, Williamson M, Gommersall L, Arya N, Patel HRH. Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn. 2005;5: 209–219. doi: 10.1586/14737159.5.2.209 [DOI] [PubMed] [Google Scholar]

[pone.0255576.ref052] 52.Minamoto T, Fukuda M, Katsuhara KR, Fujiwara A, Hidaka S, Yamamoto S, et al. Environmental DNA reflects spatial and temporal jellyfish distribution. PLoS One. 2017;12: e0173073. doi: 10.1371/journal.pone.0173073 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Intraspecific genetic variability and diurnal activity affect environmental DNA detection in Japanese eel

Sayaka Takahashi

Shingo Takada

Hiroki Yamanaka

Reiji Masuda

Akihide Kasai

Roles

Abstract

Introduction

Materials and methods

Ethics statement

Experiment 1: Effects of polymorphism on eDNA detection

Fish selection, experimental tank design, and water collection

Water filtration and eDNA extraction

PCR analysis

Experiment 2: Diel eDNA release rate and eel activity patterns

Fish selection

Experimental tank design and activity evaluation

Fig 1. (A) Schematic drawing of the experimental tank system and (B) time schedule.

Water collection and filtration

Data analysis

Results

Experiment 1: Effects of polymorphism on eDNA detection

Fig 2.

Table 1. Probe region sequences.

Experiment 2: Diel eDNA release rate and eel activity patterns

Table 2. Variation in eDNA concentration (eDNA conc.) during acclimatization.

Fig 3. Diel changes in eDNA concentration (eDNA conc.) (circles; left axis) and activity (columns, blue: 1, yellow: 2, red: 3; right axis) in Japanese eels.

Fig 4. Correlation between eDNA concentration (eDNA conc.) and activity score 1 h before water sampling.

Fig 5. Coefficients of variation (CV) in individual, sampling, and PCR measurement replications.

Discussion

Genetic polymorphism may hinder eDNA studies

Inter-individual difference and daily rhythm of activity affect eDNA emission

Conclusions and perspectives

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Hideyuki Doi

Roles

Author response to Decision Letter 0

Decision Letter 1

Hideyuki Doi

Roles

Author response to Decision Letter 1

Decision Letter 2

Hideyuki Doi

Roles

Acceptance letter

Hideyuki Doi

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases