Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 1999 Mar;37(3):575–580. doi: 10.1128/jcm.37.3.575-580.1999

Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

Karin D E Everett 1,*, Linda J Hornung 1, Arthur A Andersen 1
PMCID: PMC84475  PMID: 9986815

Abstract

Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation.


The order Chlamydiales has been recently shown to include four families of obligately intracellular bacteria that infect vertebrates or amoebae, the Chlamydiaceae, Parachlamydiaceae, Simkaniaceae, and Waddliaceae (8, 23). Members of these families are explicitly identified by DNA sequence analysis; a new study indicates that the Chlamydiales may be comprised of even more lineages (19). The oldest family in this order is the Chlamydiaceae, which was proposed in 1957 (21). The Chlamydiaceae are antigenically and genetically diverse, belonging to two genera and nine species (8). Inclusions formed in host cells by these bacteria are recognized, but not necessarily distinguished from one another, by microscopy and staining methods. At one time, all chlamydiae were thought to be recognized by immunohistochemical staining or serological techniques that were believed to be Chlamydiaceae specific. Occasionally, however, specimens that could not be confirmed by techniques positively specific for the Chlamydiaceae were cultured or isolated (4, 6, 9, 26). The Chlamydiaceae are all identified by monoclonal antibodies (MAbs) that recognize the lipopolysaccharide epitope αKdo-(2→8)-αKdo-(2→4)-αKdo (Kdo is 3-deoxy-d-manno-octulosonic acid) (3, 5, 13, 18). These MAbs have been used to detect new groups in the Chlamydiaceae (22) and to identify Chlamydiaceae in novel hosts (10, 12, 26). MAb staining may be done directly on smears or may require days or even weeks for laboratory culture of chlamydiae in host cell monolayers.

PCR and other DNA-based tests for chlamydiae have tended to be specific for groups within the Chlamydiaceae. Tests targeting the ompA gene have shown some promise as tools for identification of all Chlamydiaceae (16, 25, 27). However, the DNA sequence of ompA is highly variable, and it has been difficult to find segments conserved in all species that could be targeted by a single set of primers to amplify a short, characteristic PCR product. The rRNA operon contains many segments that are conserved among all the Chlamydiaceae, but this locus has been used only for identifying specific species, strains, or groups of strains. Efforts to detect and identify chlamydiae are important because chlamydiae not only cause disease but also interact synergistically with viruses or with other bacteria, increasing the virulence of these organisms (20, 28). In humans, livestock, and birds, chlamydiae cause reproductive, respiratory, cardiovascular, gastrointestinal, central nervous system, and systemic disease, as well as conjunctivitis and arthritis (2, 3, 7, 11, 15, 17).

In this report, ribosomal DNA (rDNA) sequences from over 60 Chlamydiaceae strains and ompA sequences from 48 Chlamydiaceae strains, many of the sequences extending 300 or more bases past the ompA stop codon, were used to design two PCR tests for specific and rapid detection of all species belonging to the Chlamydiaceae. A third PCR test that recognized the Chlamydiaceae as well as members of newer families in the Chlamydiales was developed. These tests facilitate the identification of strains belonging to these families.

MATERIALS AND METHODS

Template DNA sources and preparation.

Sources of the chlamydial strains used for these tests have been described previously (5, 7, 14). Chlamydial template DNA was prepared by reducing alkaline lysis. The first step in reducing alkaline lysis was to pellet chlamydiae and/or chlamydia-infected cells by centrifugation (10,000 × g). The pellet was resuspended in 30 mM Tris (pH 9.0)–10 mM EDTA (pH 9.0)–50 mM dithiothreitol and incubated for 1 h at 37°C. An equal volume of 1% Nonidet P-40 was then added to each sample, as was DNase-free RNase (Boehringer Mannheim Biochemicals, Indianapolis, Ind.; 2.5 μg for a 200-μl mixture). Some samples (of strains R27 and GPICT) were divided into two aliquots after the addition of Nonidet P-40, and one aliquot of each was not treated with RNase so that control studies in the presence of RNA could be done. All aliquots were incubated for 1 h at 37°C and then extracted with phenol-chloroform and chloroform (24). DNA from Chlamydophila psittaci 6BCT was also prepared by CsCl gradient centrifugation for a series of dilution controls (24). DNA from lysates of Waddlia chondrophila WSU 86-1044T and Simkania negevensis ZT were provided by Fred Rurangirwa and Maureen Friedman, respectively.

Nonchlamydial template DNA was prepared by several means. Lysis under alkaline reducing conditions as described above was used to prepare DNA from mycoplasmas provided by Janet Saupe (National Veterinary Services Laboratory, USDA (Animal and Plant Health Inspection Service, Ames, Iowa) and from Vero cells, which were the host cells in which chlamydiae were grown. CsCl-prepared DNA from Campylobacter, Arcobacter, Listeria, Erysipelothrix, and Helicobacter species was provided by Irene V. Wesley and Sharon Franklin (National Animal Disease Center, USDA (Agricultural Research Service, Ames, Iowa). Salmonella DNA from isolated colonies was prepared by boiling in Tris-EDTA and provided by Alan Baetz (National Animal Disease Center). DNAs from lysates of Verrucomicrobium spinosum and Legionella pneumophila were provided by Peter Janssen (University of Melbourne, Melbourne, Australia) and Paul S. Hoffman (Dalhousie University, Halifax, Nova Scotia, Canada), respectively. Pasturella, Bordetella, Salmonella, Staphylococcus, Streptococcus, and Escherichia coli field isolates from swine were provided by Douglas G. Rogers (University of Nebraska, Lincoln).

Test setup and controls.

All DNA templates were tested by using three different sets of PCR primers. Identical template arrays were set up on multiwell PCR plates, and each 50-μl PCR mixture for chlamydiae included 0.25 μg of template (determined spectrophotometrically). The concentrations of other templates ranged from 0.25 to 2.0 μg/reaction mixture. Chlamydial templates included RNase-treated preparations, several preparations that contained RNA and DNA, and the RNA-DNA preparations to which RNase was added along with the PCR reagents just before amplification. Six controls without template were included on every plate.

Sensitivity.

Each plate containing an array of templates also included a series of 10-fold dilutions of Chlamydophila psittaci 6BCT template DNA to assess the sensitivity of each assay. CsCl-purified 6BCT DNA was quantitated spectrophotometrically and had an A260/A280 ratio of 1.90. Electrophoresis of this DNA on a 1% agarose gel showed that most of the DNA was >12 kbp in length. PCR of all templates on each plate was performed at one time.

Test sensitivity was also determined for specific quantities of inclusion-forming units (IFU) by using Renografin-purified infectious elementary bodies (EBs) of C. psittaci NJ1. A dilution series of EBs was prepared on ice, and approximately 2,000 Vero cells were added to each aliquot to provide a carrier for the small numbers of EBs. The aliquots were then immediately centrifuged to provide an EB-cell pellet from which DNA was prepared for PCR. Microtiter plates containing monolayers of Vero cells were also infected with the serially diluted NJ1 EBs. IFU were scored in duplicate at 20 and 42 h by microimmunofluorescence using MAb NJ1/D3 (1).

Primers and PCR conditions.

The PCR primers used in these tests are summarized in Table 1 and illustrated in Fig. 1. Because the control template DNAs were obtained from many laboratories, RNase was included in the amplification reaction mixtures to ensure that RNA did not interfere with control template amplification. RNase, per se, did not interfere with PCR amplification. To test whether chlamydial RNA affected amplification, some aliquots of R27 and GPICT template DNA were also prepared without RNase. To test whether template integrity affected amplification, specific aliquots of GPICT template that had been damaged with DNase so that no template of >12 kbp could be detected were prepared.

TABLE 1.

Oligonucleotide primers

Test Name Primer
1 IGF 5′ GACTAGGTTGGGCAAG 3′
IGR 5′ AGCTCTTA(T/G/A)(C/T)AACTTGGTCTGTA 3′
1260 5′ CGCTTAATC(A/G)A(T/C)GAAAGAGCTGCTCA 3′
TGLY 5′ GGCTACAGCTCTACCATTGA 3′
2 TQF 5′ GAAAAGAACCCTTGTTAAGGGAG 3′
Probe FAM-CAAAAGGCACGCCGTCAAC-TAMRA
TQR 5′ CTTAACTCCCTGGCTCATCATG 3′
3 U23Fa 5′ GATGCCTTGGCATTGATAGGCGATGAAGGA 3′
23SIGR 5′ TGGCTCATCATGCAAAAGGCA 3′
a

The T in boldface type in this primer’s sequence is a mismatch to Chlamydiaceae sequences but enhances the PCR amplification of Parachlamydiaceae. 

FIG. 1.

FIG. 1

Map of primer loci. 1, test 1 multiplex primers; 2, test 2 TaqMan primers and probe; 3, test 3 primers.

For test 1, primer IGF exactly matched the 16S/23S intergenic spacer of all known Chlamydiaceae; primer IGR spanned the start site of the 23S rRNA gene of all known Chlamydiaceae, with a deliberate 2-base mismatch in the center. Primer 1260 recognized all known ompA genes starting 48 bases before the stop codon; primer TGLY complemented a tRNAGly located approximately 270 bp downstream of the ompA stop codon in all known Chlamydiaceae. These primers were used for PCR amplification of template DNA in a GeneAmp PCR System 9600 thermocycler with Taq DNA polymerase (Boehringer Mannheim). Reactions were prepared on ice in a 1× PCR mix containing Mg2+ (1.5 mM; Boehringer Mannheim), with or without added MgCl2 (Mg2+ final concentration, 4.0 mM) and with or without 1 μl of RNase (0.5 μg) in each 50-μl reaction mix. Cycling conditions for PCR were 40 cycles of 30 s at 94°C, 15 s at 55°C, and 30 s at 72°C, followed by incubation for 5 min at 72°C. Electrophoresis of 5 μl of each 50-μl reaction mix separated the multiplex PCR products in a VisiGel separation matrix (Stratagene, La Jolla, Calif.). The DNA was visualized with ethidium bromide, which was included in the gel.

The primer set in test 2 (Table 1) was designed for use with the TaqMan sequence detection system (Perkin-Elmer, Foster City, Calif.) to target the 23S rRNA gene. This primer set included primers TQF and TQR, which were specific for all known Chlamydiaceae, and a fluorescent-labeled probe which annealed between primers TQF and TQR. Reaction mixtures were prepared at room temperature with 2.5 mM MgCl2, 400 μM dUTP, 200 μM each dATP, dCTP, and dGTP, 1× TaqMan buffer A, 0.25 μl (1.25 U) of AmpliTaq Gold DNA polymerase (Perkin-Elmer; AmpErase UNG was not included), 0.15 μM each primer, 0.1 μM probe, and 1 μl of RNase in each 50-μl reaction mixture. The reaction mixtures were incubated for 10 min at 94°C and then immediately subjected to 40 cycles of 15 s at 95°C and 1 min at 59°C. After cycling, the reaction mixtures were held at 4°C for less than 1 h prior to fluorometric TaqMan reading. The mixtures were frozen for storage.

The primers in test 3 were U23F, which matched the sequence just after the start of the 23S rRNA gene, and 23SIGR, which complemented the sequence approximately 600 bases downstream (Table 1) (8). These primers have been shown to PCR amplify the 23S rRNA signature sequence, which has been designated for use in distinguishing species belonging to the Chlamydiaceae and to other families in Chlamydiales (8). A BLAST search of the GenBank database with these primers suggested that they might also amplify other bacterial templates. These primers had high melting temperatures to ensure that they would anneal without regard for a few mismatches. Reaction mixtures were prepared on ice with Taq DNA polymerase, as in test 1, and with 1 μl of RNase in each 50-μl reaction volume. Cycling conditions for PCR were 35 cycles of 30 s at 94°C, 15 s at 61°C, and 30 s at 72°C, followed by incubation for 5 min at 72°C. Electrophoresis of 5 μl of each positive 50-μl reaction mixture provided a single 600-bp PCR product that could be visualized with ethidium bromide in the VisiGel separation matrix.

Sequence analysis and primer synthesis.

Oligonucleotide primers for tests 1 and 3 were prepared by the Iowa State University DNA Sequencing and Synthesis Facility, Ames. Test 2 primers and probe were prepared by Perkin-Elmer. The sequences upon which these tests were based are available from GenBank.

RESULTS

Test 1: specific detection of the Chlamydiaceae.

Multiplex PCR amplified a 320-bp ompA/tRNAGly PCR product and a 240-bp rRNA intergenic spacer product from each of the nine species in Chlamydiaceae (Fig. 2). The sizes were consistent with sizes expected from sequence data, with the exact sizes varying in accordance with known sequence differences. Using test 1, PCR products were not amplified from any of a wide variety of other bacterial DNAs (Table 2). DNA templates from the species most closely related to the Chlamydiaceae, i.e., S. negevensis and W. chondrophila, did not amplify. Assayed dilutions of C. psittaci NJ1 IFU showed that when 4 mM Mg2+ was included in the PCR buffer, as few as 170 IFU could be detected (Table 3). Amplification of a dilution series of CsCl-purified C. psittaci 6BCT template DNA indicated that the test could detect as little as 0.7 pg of 6BCT template DNA (500 target chromosomes) (Fig. 2; Table 4). When the concentration of Mg2+ was reduced from 4 to 1.5 mM, the sensitivity was reduced by 4 logs. When heavily fragmented DNA template was used or when RNA was present, the sensitivity was reduced by 2 to 4 logs.

FIG. 2.

FIG. 2

Test 1 multiplex detection of the Chlamydiaceae. (A) PCR amplification of the Chlamydiaceae and several other bacterial strains, in 1.5 mM Mg2+; (B) multiplex PCR amplification of 10-fold dilutions of the 6BCT template, in 4.0 mM Mg2+.

TABLE 2.

PCR test summary

Straina Results forb:
ATCC no. Test 1 Test 2 Test 3
Arcobacter cryaerophilus 43158 − − ++
Arcobacter skirrowi CCUG 10374 − − ++
Campylobacter coli 33559 − − ++
Campylobacter coli NADC 3521 − − ++
Campylobacter curvus 35224 − − ++
Campylobacter jejuni 33560 − − +
Campylobacter lari 43675 − − ++
Campylobacter upsaliensis NADC 2744 − ++
Campylobacter ureolyticus 33387 − − +
Campylobacter rectus 33238 − − +
Chlamydia muridarum MoPnT VR-123 +++ +++ +++
Chlamydia suis R22 +++ +++ +++
Chlamydia trachomatis D/UW-3/CX VR-885 +++ +++ +++
Chlamydophila abortus EBA +++ +++ +++
Chlamydophila caviae GPICT VR-813 +++ +++ +++
Chlamydophila felis FP BakerT VR-120 +++ +++ +++
Chlamydophila pecorum IPA VR-629 +++ +++ +++
Chlamydophila pneumoniae TW-183T VR-2282 +++ +++ +++
Chlamydophila psittaci 6BCT VR-125 +++ +++ +++
Helicobacter fennelliae NADC 2745 − − ++
Helicobacter pylori NADC 3226 − − +
Listeria monocytogenes NADC 2045 − − +
Simkania negevensis ZT VR-1471 − − +++
Waddlia chondrophila WSU 86-1044T VR-1470 − − +++
a

Strains that were positive in at least one test are shown. Strains that were not detected by any of the three PCR tests include the following: Acholeplasma laidlawii field strain (FS), Arcobacter butzleri ATCC 49616, Bordetella bronchiseptica FS 1 and 2, Campylobacter gracilis ATCC 33236, Campylobacter hyointestinalis ATCC 35217, Erysipelothrix strains NADC 3174 and NADC 3177, Escherichia coli FS 1 and 2, Helicobacter cinaedi NADC 2743, Helicobacter mustelae NADC 3169, Legionella pneumophila SVir, Listeria grayii NADC 2129, Listeria innocua NADC 2086, Mycoplasma arginini NVSL 96-159, Mycoplasma bovigenitalium NVSL 96-192, Mycoplasma bovirhinis NVSL 97-005, Mycoplasma bovis NVSL 97-002, Mycoplasma californicum FS, Mycoplasma gallinaceum NVSL 97-044, Mycoplasma mycoides NVSL 97-087, Mycoplasma ovipneumoniae FS, Mycoplasma pullorum NVSL 96-188, Pasturella multocida FS 1 and 2, Salmonella cholerasuis FS 1, Salmonella dublin FS 1 and 2, Salmonella FS 1 and 2, Staphylococcus epidermidis FS 1 and 2, Streptococcus suis FS, Verrucomicrobium spinosum DSM 4136T, Vero cells ATCC CCL 81. 

b

−, negative; +, positive; ++, strongly positive; +++, intensely positive. 

TABLE 3.

Results of PCR using a dilution series of C. psittaci NJ1 IFU and several MgCl2 concentrationsa

C. psittaci IFU and/or Vero cells used in PCR Results forb:
Test 1c Test 1d Test 2e Test 3c Test 3d
1.7 × 106 only + + ++ + +
1.7 × 106 + cells + ++ ++ + ++
1.7 × 104 + cells − + ++ + +
1.7 × 102 + cells − w ++ − w
1.7 + cells − − + − −
Cells only − − − − −
a

An aliquot of each EB dilution was centrifuged to provide a pellet of EBs for DNA preparation and PCR. Approximately 2,000 Vero cells (cells) were added to each aliquot before centrifugation, to provide a carrier for the small numbers of EBs. 

b

+, detectable PCR product; w, weakly detectable product; −, no detectable product. 

c

In 1.5 mM Mg2+. 

d

In 4.0 mM Mg2+. 

e

In 2.5 mM Mg2+. 

TABLE 4.

Results of PCR using a series of C. psittaci 6BCT template dilutionsa

Amt of template Equivalent no. of genomes Results forb:
Test 1c Test 2d Test 3c
70 ng 5 × 107 +++ ++ +++
7 ng 5 × 106 +++ ++ +++
0.7 ng 5 × 105 +++ ++ +++
70 pg 5 × 104 ++ ++ +++
7 pg 5 × 103 + ++ +++
0.7 pg 500 w + +
70 fg  50 − + −
7 fg   5 − − −
a

In strain 6BCT, each genome contains one target locus. 

b

+, detectable PCR product; w, weakly detectable product; −, no detectable product. 

c

In 4.0 mM Mg2+. 

d

In 2.5 mM Mg2+. 

Test 2: specific detection of the Chlamydiaceae.

The primers and fluorescent probe designed for specific PCR detection of the Chlamydiaceae in the TaqMan 7200 sequence detection system were strongly positive for all nine species in the Chlamydiaceae (Fig. 3; Table 2). The primers generated only negative scores with DNA from S. negevensis and W. chondrophila, which are closely related to the Chlamydiaceae; negative scores were generated with all other bacterial templates examined (Table 2). The sensitivity of plus/minus computer scoring of the test was set by the level of background fluorescence produced in six no-template controls (Fig. 3). A detailed examination of the raw fluorescence spectra showed that chlamydial fluorescence intensity appeared as a broad plateau at 10,000 U (Fig. 3C). When chlamydial template was serially diluted to less than 50 target molecules (Table 4), the intensity of fluorescence at 515 nm was reduced to background levels (Fig. 3B and C). After PCR, the raw spectra from some nonchlamydial templates were of intermediate fluorescence intensity (not reaching the 10,000-nm plateau and not background). Qualitatively, these intermediate spectra could not be distinguished from the raw spectra produced by using extremely dilute chlamydial template. The DNA concentrations of these nonchlamydial DNA templates were high (0.25 to 2.0 μg/reaction mixture), relative to the concentration of chlamydial template that was sufficiently dilute to generate a comparable signal (<70 fg/reaction mixture). To characterize the intermediate nonchlamydial signals, template DNAs from the nonchlamydial bacteria that had produced the highest signals were diluted 10-fold and retested (data not shown). The levels of fluorescence from these diluted templates were at background levels, indicating that nonchlamydial template could not produce a strongly positive fluorescent signal plateau.

FIG. 3.

FIG. 3

Test 2, TaqMan results and output, showing automated +/− scoring and fluorescence intensity at 515 nm for each sample. Each experiment had its own set of no-template controls for automated calculation of background fluorescence. (A) Column 1, rows 1 to 6, no-template controls; column 1, rows 7 and 8, and column 2, rows 1 to 7, nine species of the Chlamydiaceae (Table 2). All other columns and rows used template DNA from the strains with negative PCR results shown in Table 2, including those listed in footnote a. (B) Column 1, rows 1 to 6, no-template controls; column 1, rows 7 and 8, and column 2, rows 1 to 8, 10-fold dilutions of 6BCT template DNA. (C) Raw spectra corresponding to the 6BCT dilutions shown in panel B, column 2. Left panel, template only; right panel, the six no-template controls and one of the template samples.

By using the TaqMan test, as few as 1.7 IFU of C. psittaci NJ1 EBs could be detected (Table 3). In the 6BCT template dilution series, the sequence detection system scored a positive fluorescent signal when as little as 70 fg of C. psittaci 6BCT template was used for PCR (50 targets) (Table 4). Fluorescence intensity decreased as the template concentration was reduced until the raw spectral fluorescence was equivalent to the background fluorescence (Fig. 3). The sensitivity of the TaqMan assay decreased by at least 4 logs when samples were prepared by boiling rather than by the reducing alkaline lysis method. Sensitivity was not diminished, however, when damaged template was used or when RNA was present in the sample.

Test 3: detection of the Chlamydiales.

PCR of a wide variety of template DNAs using the 23S rRNA signature sequence primers resulted in PCR amplicons from all Chlamydiaceae, from S. negevensis and W. chondrophila, and from several nonchlamydial species (Fig. 4; Table 2). All of these PCR products were approximately the same size, based on gel electrophoresis. A number of the PCR products were subjected to direct sequence analysis using the amplification primers. These gave 23S rRNA sequences as expected from both chlamydial and nonchlamydial templates. Assayed dilutions of C. psittaci NJ1 EBs showed that as few as 170 IFU could be detected when 4 mM Mg2+ was used in the PCR mixture (Table 3). Amplification of a dilution series of 6BCT template DNA indicated that the test could detect as little as 0.7 pg of C. psittaci 6BCT template DNA (500 targets) (Table 4). When damaged template DNA was used, the sensitivity was reduced by 2 to 4 logs. When the concentration of Mg2+ was reduced from 4 to 1.5 mM, the sensitivity was reduced by another 1 log. When RNA was present, the amount of PCR product generated was further reduced.

FIG. 4.

FIG. 4

Test 3 PCR results for chlamydiae and several bacterial strains.

DISCUSSION

This study has characterized three different PCR tests that can be used for the identification of chlamydiae. The TaqMan and multiplex tests were specific for members of the family Chlamydiaceae, and they targeted the rRNA operon and/or the ompA gene. These tests are so specific for the Chlamydiaceae that they may be useful for the screening of field specimens. The third test targeted 23S rDNA segments that were conserved among all families belonging to the order Chlamydiales, including the Chlamydiaceae. This test also recognized some nonchlamydial bacterial templates and therefore is recommended primarily for characterizing isolates. Test 3 is extremely important because a specific way to identify new chlamydial families has not previously existed. All three tests were designed to generate short PCR products so that amplification and electrophoresis time would be minimized, enzyme and amplification conditions would not be limiting, and poor template integrity would not prevent detection.

Test 2, the TaqMan test, was more sensitive than test 1 and test 3 by approximately 2 logs. This test required no pipetting or handling of PCR products following the initial setup of the PCR mix. The TaqMan test amplified a 132-bp PCR product, in comparison to the 320- and 240-bp multiplex products and the 600-bp test 3 product. The TaqMan test could detect as few as two target molecules in a 50-μl reaction mixture, as determined by assay of a dilution series of C. psittaci NJ1 IFU. This plus/minus assay required 100 min of PCR and 10 min of automated reading for 90 samples and six controls.

Test 1, the multiplex gel detection test, was also specific for the Chlamydiaceae. The limit of detection for this test was 200 to 500 target molecules. Primer set 1260-TGLY targeted the 3′ end of the ompA gene, and primer set IGF-IGR targeted the intergenic spacer of the rRNA operon. Having two PCR products provides confirmation of the identity of positive specimens yet also helps to ensure that mutations in as-yet-undiscovered chlamydiae will not entirely prevent detection by this test. The TGLY primer, complementing sequence just downstream of ompA, was an exact match to all known Chlamydiaceae strains. Primer IGF, located within the rRNA intergenic spacer, was also an exact match to all known strains. Primers 1260 and IGR each had two or more bases that did not match all chlamydial template sequences. Primer 1260 mismatches were overcome by making this primer extra long, whereas the 2-base mismatch in primer IGR was designed to ensure a mismatch with every chlamydial template. IGR mismatches enhanced the specificity of the primer, because close to its natural annealing termperature, this primer would be readily dissociated from template if there were additional mismatches. Annealing by this primer could even be made more tenuous with a low Mg2+ concentration. Figure 2 illustrates this effect: the 6BCT ribosomal PCR product was poorly amplified in 1.5 mM Mg2+ (Fig. 2A) but well amplified in 4 mM Mg2+ (Fig. 2B). This discrimination helps to ensure the specificity of the ribosomal primers for the Chlamydiaceae.

Test 3 used a primer set that amplified domain I of the 23S rRNA. This segment is a signature sequence for chlamydial species, genera, and families (8). The test identified chlamydia-like isolates that were not recognized by the tests that were specific for the Chlamydiaceae. Identification was done by directly sequencing the 600-bp PCR product with the U23F and 23SIGR amplification primers (8) and then using this sequence in a BLAST search of the GenBank database. The primer set amplified as few as 500 targets. It was used to PCR amplify and sequence the 23S rRNA gene of S. negevensis and W. chrondrophila, species which belong to two new families in the Chlamydiales.

Currently, because of the difficulties involved in chlamydial detection and identification, our understanding of the Chlamydiales has been primarily limited to strains found in hosts of economic importance. The PCR tests described in this report make it possible to recognize all of these chlamydiae and new strains, as well, with good sensitivity. Furthermore, the PCR products generated in these analyses (including the TaqMan products) can be directly sequenced to identify the species or strain, if desired. The availability of these assays facilitates the study of the epidemiology of chlamydiae and may also improve diagnostic capability. By using these tests, biodiversity studies can be reasonably and affordably undertaken, with the assurance that the outcome will be consistent with our current understanding of chlamydial phylogeny.

ACKNOWLEDGMENTS

We thank Alan Baetz, Harlan D. Caldwell, Lee Ann Campbell, Pam M. Dilbeck, Sharon Franklin, Maureen Friedman, Peter Janssen, Paul S. Hoffman, Douglas G. Rogers, Fred Rurangirwa, and Irene V. Wesley for providing DNA or strains used in this study.

ADDENDUM IN PROOF

The new family, genus, and species names for bacteria in the order Chlamydiales that are used in this work will become valid upon the publication of references 8 and 23.

REFERENCES

  • 1.Andersen A A, Van Deusen R A. Production and partial characterization of monoclonal antibodies to four Chlamydia psittaci isolates. Infect Immun. 1988;56:2075–2079. doi: 10.1128/iai.56.8.2075-2079.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Balin B J, Gérard H C, Arking E J, Appelt D M, Branigan P J, Abrams J T, Whittum-Hudson J A, Hudson A P. Identification and localization of chlamydia pneumoniae in the Alzheimer’s brain. Med Microbiol Immunol. 1998;187:23–42. doi: 10.1007/s004300050071. [DOI] [PubMed] [Google Scholar]
  • 3.Birtles R J, Rowbotham T J, Storey C, Marrie T J, Raoult D. Chlamydia-like obligate parasite of free-living amoebae. Lancet. 1997;349:925–926. doi: 10.1016/s0140-6736(05)62701-8. [DOI] [PubMed] [Google Scholar]
  • 4.Bocklisch V H, Ludwig C, Lange S. Chlamydien als Abortursache beim Pferd. Berl Muench Tieraerztl Wochenschr. 1990;104:119–124. [PubMed] [Google Scholar]
  • 5.Dilbeck P M, Evermann J F, Crawford T B, Ward A C S, Leathers C W, Holland C J, Mebus C A, Logan L L, Rurangirwa F R, McGuire T C. Isolation of a previously undescribed rickettsia from an aborted bovine fetus. J Clin Microbiol. 1990;28:814–816. doi: 10.1128/jcm.28.4.814-816.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dilbeck P M, Evermann J F, Kraft S, Tyler S. Equine chlamydial infections: comparative diagnostic aspects with bovine and ovine chlamydiosis. In: Vorheis M W, editor. Proceedings of the 28th Annual Meeting of the American Association of Veterinary Laboratory Diagnosticians. Milwaukee, Wis: American Association of Veterinary Laboratory Diagnosticians; 1985. p. 285. [Google Scholar]
  • 7.Everett K D E, Andersen A A. The ribosomal intergenic spacer and domain I of the 23S rRNA gene are phylogenetic markers for Chlamydia spp. Int J Syst Bacteriol. 1997;47:461–473. doi: 10.1099/00207713-47-2-461. [DOI] [PubMed] [Google Scholar]
  • 8.Everett, K. D. E., R. M. Bush, and A. A. Andersen. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae including a new genus and five new species, and standards for the identification of organisms. Int. J. Syst. Bacteriol., in press. [DOI] [PubMed]
  • 9.Forster J-L, Wittenbrink M M, Häni H-J, Corboz L, Pospischil A. Absence of Chlamydia as an aetiological factor in aborting mares. Vet Rec. 1997;141:424. doi: 10.1136/vr.141.16.424. [DOI] [PubMed] [Google Scholar]
  • 10.Groff J M, LaPatra S E, Munn R J, Anderson M L, Osburn B I. Epitheliocystis infection in cultured white sturgeon (Acipenser transmontanus): antigenic and ultrastructural similarities of the causative agent to the chlamydiae. J Vet Diagn Invest. 1996;8:172–180. doi: 10.1177/104063879600800206. [DOI] [PubMed] [Google Scholar]
  • 11.Herring A J. Typing Chlamydia psittaci—a review of methods and recent findings. Br Vet J. 1993;149:455–475. doi: 10.1016/S0007-1935(05)80111-3. [DOI] [PubMed] [Google Scholar]
  • 12.Huchzermeyer F W. Public health risks of ostrich and crocodile meat. Rev Sci Technol. 1997;16:599–604. doi: 10.20506/rst.16.2.1051. [DOI] [PubMed] [Google Scholar]
  • 13.Kahane, S., K. D. E. Everett, N. Kimmel, and M. G. Friedman. Simkania negevensis, strain ZT: growth, antigenic and genome characteristics. Int. J. Syst. Bacteriol., in press. [DOI] [PubMed]
  • 14.Kahane S, Gonen R, Sayada C, Elion J, Friedman M G. Description and partial characterization of a new chlamydia-like microorganism. FEMS Microbiol Lett. 1993;109:329–334. doi: 10.1016/0378-1097(93)90041-y. [DOI] [PubMed] [Google Scholar]
  • 15.Kahane S, Greenberg D, Friedman M G, Haikin H, Dagan R. High prevalence of S. negevensis, a novel chlamydia-like bacterium, in infants with acute bronchiolitis. J Infect Dis. 1998;177:1425–1427. doi: 10.1086/517830. [DOI] [PubMed] [Google Scholar]
  • 16.Kaltenböck B, Schmeer N, Schneider R. Evidence for numerous omp1 alleles of porcine Chlamydia trachomatis and novel chlamydial species obtained by PCR. J Clin Microbiol. 1997;35:1835–1841. doi: 10.1128/jcm.35.7.1835-1841.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lieberman D, Kahane S, Lieberman D, Friedman M G. Pneumonia with serological evidence of acute infection with the chlamydia-like microorganism “Z.”. Am J Respir Crit Care Med. 1997;156:578–582. doi: 10.1164/ajrccm.156.2.9608081. [DOI] [PubMed] [Google Scholar]
  • 18.Löbau S, Mamat U, Brabetz W, Brade H. Molecular cloning, sequence analysis, and functional characterization of the lipopolysaccharide biosynthetic gene kdtA encoding 3-deoxy-alpha-d-manno-octulosonic acid transferase of Chlamydia pneumoniae strain TW-183. Mol Microbiol. 1995;18:391–399. doi: 10.1111/j.1365-2958.1995.mmi_18030391.x. [DOI] [PubMed] [Google Scholar]
  • 19.Meijer A, Ossewaarde J M. Broad range Chlamydia PCR detects previously unrecognized Chlamydia sequences: a new genus in the family Chlamydiaceae? In: Stephens R S, Byrne G I, Christiansen G, Clarke I N, Grayston J T, Rank R G, Ridgway G L, Saikku P, Schachter J, Stamm W E, editors. Chlamydial infections: proceedings of the Ninth International Symposium on Human Chlamydial Infection. International Chlamydia Symposium. Calif: San Francisco; 1998. pp. 523–526. [Google Scholar]
  • 20.Pospischil A, Wood R D. Intestinal Chlamydia in pigs. Vet Pathol. 1987;24:568–570. doi: 10.1177/030098588702400617. [DOI] [PubMed] [Google Scholar]
  • 21.Rake G W. Family II. Chlamydiaceae Rake, Fam. Nov. In: Breed R S, Murray E G D, Smith N R, editors. Bergey’s manual of systematic bacteriology. 7th ed. Baltimore, Md: The Williams & Wilkins Co.; 1957. pp. 957–968. [Google Scholar]
  • 22.Rogers D G, Andersen A A, Hogg A, Nielsen D L, Huebert M A. Conjunctivitis and keratoconjunctivitis associated with chlamydiae in swine. J Am Vet Med Assoc. 1993;203:1321–1323. [PubMed] [Google Scholar]
  • 23.Rurangirwa, F. R., P. M. Dilbeck, T. B. Crawford, T. C. McGuire, and T. F. McElwain. 16S DNA sequence of WSU 86-1044 microorganism from an aborted bovine fetus reveals it is a member of the order Chlamydiales: proposal of Waddliaceae fam. nov., Waddlia chondrophila, gen. nov., sp. nov. Int. J. Syst. Bacteriol., in press. [DOI] [PubMed]
  • 24.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Press; 1989. [Google Scholar]
  • 25.Sayada C, Denamur E, Orfila J, Catalan F, Elion J. Rapid genotyping of the Chlamydia trachomatis major outer membrane protein by the polymerase chain reaction. FEMS Microbiol Lett. 1991;83:73–78. doi: 10.1016/0378-1097(91)90447-i. [DOI] [PubMed] [Google Scholar]
  • 26.Vanrompay D, Ducatelle R, Haesebrouck F. Diagnosis of avian chlamydiosis: specificity of the modified Giménez staining on smears and comparison of the sensitivity of isolation in eggs and three different cell cultures. J Vet Med B. 1992;39:105–112. doi: 10.1111/j.1439-0450.1992.tb01144.x. [DOI] [PubMed] [Google Scholar]
  • 27.Yoshida H, Kishi Y, Shiga S, Hagiwara T. Differentiation of Chlamydia species by combined use of polymerase chain reaction and restriction endonuclease analysis. Microbiol Immunol. 1998;42:411–414. doi: 10.1111/j.1348-0421.1998.tb02303.x. [DOI] [PubMed] [Google Scholar]
  • 28.Zahn I, Szeredi L, Schiller I, Straumann-Kunz U, Bürgi E, Guscetti F, Heinen E, Corboz L, Sydler T, Pospischil A. Immunohistochemical determination of Chlamydia psittaci/pecorum and C. trachomatis in the piglet gut. J Vet Med B. 1995;42:226–276. [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES