Skip to main content
Veterinary World logoLink to Veterinary World
. 2021 Aug 10;14(8):2064–2072. doi: 10.14202/vetworld.2021.2064-2072

Prevalence, antibiotic susceptibility, and presence of drug resistance genes in Aeromonas spp. isolated from freshwater fish in Kelantan and Terengganu states, Malaysia

Nik Nur Fazlina Nik Mohd Fauzi 1, Ruhil Hayati Hamdan 1,, Maizan Mohamed 1, Aziana Ismail 1, Ain Auzureen Mat Zin 1, Nora Faten Afifah Mohamad 1
PMCID: PMC8448652  PMID: 34566322

Abstract

Background and Aim:

The emergence of antibiotic-resistant bacterial pathogens has been increasingly reported, which has resulted in a decreasing ability to treat bacterial infections. Therefore, this study investigated the presence of Aeromonas spp., including its antibiotic resistance in various fish samples, Oreochromis spp., Clarias gariepinus, and Pangasius hypophthalmus, obtained from Kelantan and Terengganu, Malaysia.

Materials and Methods:

In this study, 221 fish samples, of which 108 (Oreochromis spp., n=38; C. gariepinus, n=35; and P. hypophthalmus, n=35) were from Kelantan and 113 (Oreochromis spp., n=38; C. gariepinus, n=35; and P. hypophthalmus, n=40) were from Terengganu, were caught using cast nets. Then, samples from their kidneys were cultured on a Rimler Shott agar to isolate Aeromonas spp. Polymerase chain reaction (PCR) was used to confirm this isolation using specific gene primers for species identification. Subsequently, the isolates were tested for their sensitivity to 14 antibiotics using the Kirby–Bauer method, after which the PCR was conducted again to detect resistance genes: sul1, strA-strB, aadA, blaTEM, blaSHV, tetA-tetE, and tetM.

Results:

From the results, 61 isolates were identified as being from the genus Aeromonas using PCR, of which 28 were Aeromonas jandaei, 19 were Aeromonas veronii, seven were Aeromonas hydrophila, and seven were Aeromonas sobria. Moreover, 8, 12, and 8 of A. jandaei; 4, 3, and 12 of A. veronii; 6, 0, and 1 of A. hydrophila; and 3, 3, and 1 of A. sobria were obtained from Oreochromis spp., C. gariepinus, and P. hypophthalmus, respectively. In addition, the isolates showed the highest level of resistance to ampicillin (100%), followed by streptomycin (59.0%), each kanamycin and nalidixic acid (41.0%), neomycin (36.1%), tetracycline (19.7%), sulfamethoxazole (14.8%), and oxytetracycline (13.1%). Resistance to gentamicin and ciprofloxacin both had the same percentage (9.8%), whereas isolates showed the lowest resistance to norfloxacin (8.2%) and doxycycline (1.6%). Notably, all Aeromonas isolates were susceptible to chloramphenicol and nitrofurantoin. Results also revealed that the multiple antibiotic resistances index of the isolates ranged from 0.07 to 0.64, suggesting that the farmed fish in these areas were introduced to the logged antibiotics indiscriminately and constantly during their cultivation stages. Results also revealed that the sul1 gene was detected in 19.7% of the Aeromonas isolates, whereas the tetracycline resistance genes, tetA and tetE, were detected in 27.9% and 4.9% of the isolates, respectively. However, β-lactam resistance genes, blaTEM and blaSHV, were found in 44.3% and 13.1% of Aeromonas isolates, respectively, whereas strA-strB and aadA genes were found in 3.3% and 13.1% of the isolates, respectively.

Conclusion:

This study, therefore, calls for continuous surveillance of antibiotic-resistant Aeromonas spp. in cultured freshwater fish to aid disease management and better understand their implications to public health.

Keywords: Aeromonas, antibiotic resistance genes, antibiotic susceptibility, freshwater fish

Introduction

Aquaculture plays an important role in the food supply of Malaysia. Under the Economic Transformation Program, the Malaysian government established aquaculture as one of the key thrust areas for the agro-food industry [1]. In 2014, Malaysia’s annual per capita fish intake was one of the highest in Asia at 56.5 kg, with tilapia (Oreochromis spp.) and African catfish (Clarias gariepinus) being the favored farmed fish. Interestingly, in freshwater aquaculture, the African (C. gariepinus) and Pangasius (Pangasius hypophthalmus) catfishes being produced are leading because of a higher local demand, followed by tilapia (Oreochromis spp.), which is small in terms of production and was valued at RM223,000 (USD 58,000) [1].

Despite these interesting facts, bacterial infections are the most growing contagious concern in industrial fish farms and ornamental fish [2]. Studies have shown that captive fish are susceptible to many pathogenic bacteria that can cause kidney disease, dropsy, enteric redmouth, tuberculosis, vibriosis, motile aeromonad septicemia, bacterial gill infection, mouth fungus, tail and fin rot, and columnaris [3-7]. Furthermore, one of the most emerging bacteria that cause infectious diseases in freshwater aquaculture worldwide is Aeromonas hydrophila and other aeromonads [8,9]. These Aeromonas species can also cause motile aeromonads septicemia (MAS) in fish, with clinical symptoms, such as ulceration, ascitis, scale detachment, erosion, and exophthalmia being reported [10]. Apart from A. hydrophila, many disease-related aeromonads have been identified in tilapia as well, such as Aeromonas sobria [11], Aeromonas dhakensis (A. hydrophila subspecies dhakensis) [12], and Aeromonas veronii (synonyms of Aeromonas ichthiosmia, Aeromonas culicicola, and Aeromonas allosaccharophila) [13-16]. However, the occurrence of A. hydrophila infection was significantly higher in cultured fish than in wild species, such as Nile tilapia [17].

Antimicrobials have progressively been used in animal farming for disease prevention and treatment over the past few years, including as growth promoters [18]. However, their usage is based on modern medicine; the misuse of these antibiotics has increased the risk of emerging antimicrobial resistance cases in pathogenic and nonpathogenic bacteria. This has resulted in the lower treatment potency of commonly used antimicrobials in treating diseases, such as tuberculosis, pneumonia, and gastrointestinal infections, in humans [19]. In addition, during animal farming, antimicrobial deposits have been discovered in terrestrial, freshwater, and marine habitats close to agriculture and aquaculture facilities [20,21]. Antimicrobials are also applied in the feed or directly to water in aquaculture systems. Thus, they are proposed to subsequently be disposed into the environment by run-off water, sedimentation of feces, or uneaten feed pellets that can then be eaten by local fish or invertebrates [21-25]. The unconstrained use of antimicrobials in aquaculture can therefore transmit antibiotic-resistant bacteria, which are commonly transferred through R plasmids, with fish bacteria acting as intermediates [18,20,22,26-31].

Therefore, this study investigated the presence of Aeromonas spp., including its antibiotic resistance in various fish samples, Oreochromis spp., Clarias gariepinus, and Pangasius hypophthalmus, obtained from Kelantan and Terengganu, Malaysia.

Materials and Methods

Ethical approval

The study was approved by the Institutional Animal Care and Use Committee (IACUC), Faculty of Veterinary Medicine, University Malaysia Kelantan (UMK/FPV/ACUE/PG/4/2019).

Study period and location

This study was conducted from February 2019 to December 2019. Samples were taken from three freshwater fish farms, each in state of Kelantan and Terengganu. In Kelantan, the farms located in Tumpat, Kota Bharu and Bachok. In Terengganu, two farms located in Kuala Terengganu and one farm in Hulu Terengganu. All the samples were processed in situ with an aseptic technique.

Sample collection

Here, 221 freshwater fish were collected, with 108 samples from Kelantan and 113 samples from Terengganu. Of the 108 fish samples from Kelantan, 38 were red hybrid tilapia (Oreochromis spp.), 35 were African catfish (C. gariepinus), and the remaining 35 were Pangasius catfish (P. hypophthalmus). However, of the 113 fish samples collected from Terengganu, 38 were Oreochromis spp., 35 were C. gariepinus, and 40 were P. hypophthalmus. Next, a specimen of the kidneys was collected from these fish.

Bacterial isolation and identification

The specimen was inoculated on Rimler Shott agar (RSA) (HiMedia, India) supplemented with novobiocin antibiotics and incubated at 30°C for 24 h. Next, yellow colonies on RSA were chosen and further sub-cultured on Trypticase soy agar (TSA) (Oxoid, Hampshire, UK) for purity. Subsequently, morphological and biochemical tests were used to identify all isolates, such as Gram staining, oxidase, catalase, and motility tests, after which the biochemical characteristics of Aeromonas spp. were examined using the analytical profile index 20E kit (bioMerieux, France) according to the manufacturer’s instructions. Finally, the strip was incubated at 30°C for 24 h.

Confirmation of Aeromonas spp. using polymerase chain reaction (PCR) assay

Genomic DNA was extracted using the Bacterial Genomic DNA kit (Geneaid, USA) following the manufacturer’s instructions. To determine the presence of Aeromonas spp., a PCR assay was then conducted using 16S rRNA and a specific gene [32]. Next, PCR amplification was conducted using a Mastercycler gradient (Bio-Rad, USA). A final PCR volume of 25 μL containing 12.5 μL Go Taq® Green Master Mix (Promega, USA), 1 μL of each 10 ρmol forward and reverse primers, and 2 μL DNA template were used. The conditions for thermocycling were set as follows: 94°C for 3 min, 35 cycles of 94°C for 60 s, 58°C for 60 s, 72°C for 1.5 min, and a final extension at 72°C for 3 min. Finally, amplified products were electrophoresed on 2.0% agarose gels, after which the gels were visualized and captured using GelDoc (Bio-Rad).

Determination of antibiotic susceptibility and multiple antibiotic resistance (MAR) index of selected bacteria

The isolates were tested for sensitivity to 14 antibiotics: Ampicillin (10 μg), gentamicin (10 μg), neomycin (30 μg), streptomycin (10 μg), kanamycin (30 μg), tetracycline (30 μg), oxytetracycline (30 μg), ciprofloxacin (5 μg), norfloxacin (10 μg), nalidixic acid (30 μg), chloramphenicol (30 μg), sulfamethoxazole (25 μg), doxycycline (30 μg), and nitrofurantoin (300 μg). Kirby–Bauer’s disc diffusion method was then used to assess the patterns of antibiotic sensitivity of the isolates. Inhibition zone results were subsequently interpreted as sensitive (S), intermediate (I), and resistant (R) according to the reference standard by the Clinical and Laboratory Standard Institute [33].

MAR index was calculated using the formula provided by Sarter et al. [34]:

X/(Y×Z)

Where, X=Total cases of antibiotic resistance; Y=Total number of isolates; Z=Total number of isolates

The MAR index value of equal to, or less than, 0.2 was defined as antibiotics that were seldom or never used.

Detection of associated drug resistance genes

Resistance genes were detected using PCR amplification with the different primers as described in Table-1 [35-41]. Assays were then conducted in 25 μL volume mixtures, according to the manufacturer’s protocol (Promega, USA). Next, all PCR reactions were subjected to amplification according to the cycling parameter suggested by a previous researcher (Table-1). Finally, PCR products were run on 2.0% agarose, after which the gel was visualized and captured using Gel Doc (Bio-Rad).

Table-1.

List of primers used for detection of antibiotic resistance genes.

Primer Nucleotide sequence (5’–3’) Product size (bp) References
sul1-F CTTCGATGAGACCCGGCGGC 436 [35]
sul1-R GCAAGGCGGAAACCCGCGCC
aadA-F GAGAACATAGCGTTGCCTTGGTCG 198 [36]
aadA-R GCGCGATTTTGCCGGTTA
strA-strB-F TTGAATCGAACTAATAT 1640 [37]
strA-strB-R CTAGTATGACGTCTGTCG
blaTEM-F ATGAGTATTCAACATTTCCG 867 [38]
blaTEM-R CTGACAGTTACCAATGCTTA
blaSHV-F GGTTATGCGTTATATTCGCC 867 [38]
blaSHV-R TTAGCTTTGCCAGTGCTC
tetA-F GTAATTCTGAGCACTGTCGC 956 [39,40]
tetA-R CTGCCTGGACAACATTGCTT
tetB-F CTCAGTATTCCAAGCCTTTG 535 [39,40]
tetB-R CTAAGCACTTGTCTCCTGTT
tetC-F TCTAACAATGCGCTCATCGT 588 [39,40]
tetC-R GGTTGAAGGCTCTCAAGGGC
tetD-F ATTACACTGCTGGACGCGAT 1070 [39,40]
tetD-R CTGATCAGCAGACAGATTGC
tetE-F GTGATGATGGCACTGGTCAT 1198 [39,40]
tetE-R CTCTGCTGTACATCGCTCTT
tetM-F GTTAAATAGTGTTCTTGGAG 650 [41]
tetM-R CTAAGATATGGCTCTAACAA

Results

From the results, 61 isolates obtained from freshwater fish samples were identified as genus Aeromonas using PCR. Table-2 shows that from the 61 Aeromonas spp. isolated, 22 isolates were from P. hypophthalmus, 19 from Oreochromis spp., and 20 from C. gariepinus. Furthermore, Aeromonas species isolated from freshwater fish in Kelantan were higher (43 isolates) than those from Terengganu (18 isolates).

Table-2.

Prevalence of Aeromonas spp. isolated from freshwater fish.

Host species Aeromonas spp. isolated (n) Kelantan (n, %) Terengganu (n, %)
Pangasius hypophthalmus 22 20 (90.9) 2 (9.1)
Oreochromis spp. 19 9 (47.4) 10 (52.6)
Clarias gariepinus 20 14 (70.0) 6 (30.0)
Total 61 43 (70.5) 18 (29.5)

Figure-1 shows the confirmed identification using the PCR assay of Aeromonas spp. The positive isolates for the 16S rRNA gene were then sent for sequencing. Figure-2 shows the distribution of Aeromonas species according to each state in Kelantan and Terengganu. Four types of Aeromonas species were obtained during this study, with 28 isolates of Aeromonas jandaei, 19 isolates of A. veronii, seven isolates of A. hydrophila, and seven isolates of A. sobria. Furthermore, Aeromonas jandei and A. veronii were detected in both samples from Kelantan and Terengganu, whereas A. hydrophila and A. sobria were detected only in samples from Kelantan.

Figure-1.

Figure-1

Representative of polymerase chain reaction (PCR) positives for 16S rRNA of genus Aeromonas. Lane M: 1 Kbp DNA marker (Promega, USA); Lane N: negative control; Lane P: positive control; Lanes 1-8: Positive Aeromonas with 356 bp PCR products.

Figure-2.

Figure-2

Distribution of Aeromonas species isolated from freshwater fish.

Figure-3 shows Aeromonas spp. colonies formed on TSA, which were creamy in color, round, and convex, whereas Aeromonas colonies on RSA were yellow-green in color, round, and convex. The biochemical test results from Aeromonas spp. isolates revealed Gram-negative staining, rod-shaped, motile, fermentative, oxidase-positive, catalase-positive, and indole negative characteristics.

Figure-3.

Figure-3

Aeromonas veronii on; (a) Rimler Shott agar; (b) Trypticase Soy agar.

In addition, all Aeromonas isolates displayed varying trends of resistance, where all isolates were ampicillin-resistant (100%), followed by streptomycin (59.0%), kanamycin and nalidixic acid with the same percentage (41.0%), neomycin (36.1%), tetracycline (19.7%), sulfamethoxazole (14.8%), and oxytetracycline (13.1%). Gentamicin and ciprofloxacin both had the same percentage resistance (9.8%), whereas norfloxacin (8.2%) and doxycycline (1.6%) had the lowest (Figure-4). However, all Aeromonas isolates were sensitive to chloramphenicol and nitrofurantoin.

Figure-4.

Figure-4

Antibiotic resistant of Aeromonas isolates.

Figure-5 shows the presence of antibiotic resistance genes in Aeromonas isolates. Results showed that the sul1 gene (related to sulfonamide resistance) was detected in 19.7% of the Aeromonas isolates. However, for tetracycline resistance genes, only tetA and tetE were detected in 27.9% and 4.9% of isolates, respectively. In addition, the β-lactam resistance genes, blaTEM and blaSHV, were found in 44.3% and 13.1% of Aeromonas isolates, respectively, whereas the strA-strB gene (related to streptomycin resistance) was found in 3.3% of the isolates, and the aadA gene (related to streptomycin and spectinomycin resistance) in 13.1% of the isolates. Table-3 shows the resistance phenotype and antibiotic resistance genes of all Aeromonas spp. isolates.

Figure-5.

Figure-5

The presence of antibiotic resistance genes in Aeromonas isolated from freshwater fish.

Table-3.

Resistance phenotype and presence of antibiotic resistance genes in Aeromonas spp. isolated from freshwater fish.

No. Isolates Identification Fish species Location Resistance phenotype Genes detected by PCR MAR Index
1. K1K2 A. sobria C. gariepinus Kelantan Amp-N-S-K blaTEM, blaSHV 0.29
2. K1K3 A. sobria C. gariepinus Kelantan Amp-N-S-K-Na-Sxt sul1, tetA 0.43
3. K2K11 A. jandaei C. gariepinus Kelantan Amp-S-Na-Sxt-Ot - 0.36
4. K2K12 A. sobria C. gariepinus Kelantan Amp-N-S-K-Te-Cip-Na-Ot tetA 0.57
5. K2K15 A. jandaei C. gariepinus Kelantan Amp-N-S-K-Na blaTEM 0.36
6. K2K16 A. veronii C. gariepinus Kelantan Amp-N-S-K-Na-Sxt-Ot sul1, tetE, blaTEM 0.50
7. K3K22 A. veronii C. gariepinus Kelantan Amp-Te-Na-Ot blaTEM 0.29
8. K3K24 A. jandaei C. gariepinus Kelantan Amp-N-S blaTEM 0.21
9. K3K25 A. veronii C. gariepinus Kelantan Amp-Te-Na-Sxt-Ot sul1, tetA, blaTEM 0.36
10. K3K26 A. jandaei C. gariepinus Kelantan Amp-S blaTEM 0.14
11. K3K27 A. jandaei C. gariepinus Kelantan Amp blaTEM 0.07
12. K3K28 A. jandaei C. gariepinus Kelantan Amp - 0.07
13. K3K29 A. jandaei C. gariepinus Kelantan Amp-N-S-K-Na-Ot tetA, strA-strB, blaTEM 0.43
14. K3K30 A. jandaei C. gariepinus Kelantan Amp-S-Na tetA, blaTEM 0.21
15. K1P2 A. sobria P. hypopthalmus Kelantan Amp-N-S-K-Te-Na tetA, strA-strB, aadA 0.43
16. K1P5 A. veronii P. hypopthalmus Kelantan Amp - 0.07
17. K2P1 A. hydrophila P. hypopthalmus Kelantan Amp - 0.07
18. K2P2 A. jandaei P. hypopthalmus Kelantan Amp-Te tetE 0.14
19. K2P3 A. jandaei P. hypopthalmus Kelantan Amp-Na - 0.14
20. K2P4 A. veronii P. hypopthalmus Kelantan Amp-S - 0.14
21. K2P5 A. veronii P. hypopthalmus Kelantan Amp-S-K blaTEM 0.21
22. K2P6 (a) A. veronii P. hypopthalmus Kelantan Amp - 0.07
23. K2P6 (b) A. veronii P. hypopthalmus Kelantan Amp-N-K blaTEM 0.21
24. K2P7 A. jandaei P. hypopthalmus Kelantan Amp-S - 0.14
25. K2P8 (a) A. jandaei P. hypopthalmus Kelantan Amp-S-K blaTEM 0.21
26. K2P8 (b) A. jandaei P. hypopthalmus Kelantan Amp-N-S-K-Na blaTEM, blaSHV 0.36
27. K2P10 A. veronii P. hypopthalmus Kelantan Amp-S-K - 0.21
28. K3P4 A. jandaei P. hypopthalmus Kelantan Amp-S-K - 0.21
29. K3P5 (a) A. veronii P. hypopthalmus Kelantan Amp-S-K - 0.21
30 K3P5 (b) A. veronii P. hypopthalmus Kelantan Amp-S-K blaTEM 0.21
31. K3P6 (a) A. veronii P. hypopthalmus Kelantan Amp-N-S-K blaTEM, blaSHV 0.29
32. K3P6 (b) A. veronii P. hypopthalmus Kelantan Amp-S-K - 0.21
33. K3P9 (a) A. veronii P. hypopthalmus Kelantan Amp-S-K blaTEM 0.21
34. K3P9 (b) A. veronii P. hypopthalmus Kelantan Amp-S-K - 0.21
35. K1T2 (a) A. hydrophila Oreochromis spp. Kelantan Amp-Cn-N-S-K-Cip-Nor-Na-Sxt sul1, tetA, blaTEM, blaSHV, aadA 0.64
36. K1T2 (b) A. sobria Oreochromis spp. Kelantan Amp-N-S-K-Te-Na-Sxt sul1, tetA, blaTEM 0.50
37. K2T3 (a) A. sobria Oreochromis spp. Kelantan Amp-Cn-N-S-K-Cip-Nor-Na-Sxt sul1, tetA, blaTEM, blaSHV, aadA 0.64
38. K2T3 (b) A. sobria Oreochromis spp. Kelantan Amp-N-S-Te-Na tetA, blaTEM, aadA 0.36
39. K2T6 (a) A. hydrophila Oreochromis spp. Kelantan Amp-N-S-Te-Na tetA, blaTEM, aadA 0.36
40. K2T6 (b) A. hydrophila Oreochromis spp. Kelantan Amp-Cn-N-S-K-Na-Sxt sul1, tetA, blaTEM 0.50
41. K3T8 A. hydrophila Oreochromis spp. Kelantan Amp-Cn-N-S-K-Te-Cip-Nor-Na tetA, blaTEM, blaSHV 0.64
42. K3T10 A. hydrophila Oreochromis spp. Kelantan Amp-Cn-N-S-K-Te-Cip-Nor-Na tetA, blaTEM, blaSHV, aadA 0.64
43. K3T11 A. hydrophila Oreochromis spp. Kelantan Amp-Cn-N-S-Cip-Nor-Na-Sxt sul1, tetA, blaTEM, blaSHV, aadA 0.57
44. T2K5 A. jandaei C. gariepinus Terengganu Amp-Na tetE 0.14
45. T2K4 A. jandaei C. gariepinus Terengganu Amp - 0.07
46. T3K6 A. jandaei C. gariepinus Terengganu Amp-Te-Na-Do-Ot tetA 0.36
47. T3K8 A. jandaei C. gariepinus Terengganu Amp - 0.07
48. T1T7 A. jandaei Oreochromis spp. Terengganu Amp sul1 0.07
49. T1T10 (b) A. veronii Oreochromis spp. Terengganu Amp sul1, aadA 0.07
50. T1T4 (a) A. jandaei Oreochromis spp. Terengganu Amp sul1 0.07
51. T1K6 A. veronii Oreochromis spp. Terengganu Amp-N-Te-Sxt-Ot sul1, tetA 0.36
52. T1K7 A. veronii Oreochromis spp. Terengganu Amp-S - 0.14
53. T1T6 A. jandaei Oreochromis spp. Terengganu Amp-Na-S - 0.21
54. T1T9 A. veronii Oreochromis spp. Terengganu Amp - 0.07
55. T2T1 A. jandaei Oreochromis spp. Terengganu Amp - 0.07
56. T2T3 A. jandaei Oreochromis spp. Terengganu Amp blaTEM 0.07
57. T2T5 (a) A. jandaei Oreochromis spp. Terengganu Amp - 0.07
58. T2T6 A. jandaei Oreochromis spp. Terengganu Amp-S - 0.14
59. T2T7 A. jandaei Oreochromis spp. Terengganu Amp-Na-S - 0.21
60. T1P8 A. jandaei P. hypopthalmus Terengganu Amp - 0.07
61. T2P3 A. jandaei P. hypopthalmus Terengganu Amp - 0.07

Amp=Ampicillin (10 μg), Cn=Gentamicin (10 μg), N=Neomycin (30 μg), S=Streptomycin (10 μg), K=Kanamycin (30 μg), Te=Tetracycline (30 μg), Cip=Ciprofloxacin (5 μg), Nor=Norfloxacin (10 μg), Na=Nalidixic acid (30 μg), Sxt=Sulfamethoxazole (25 μg), C=Chloramphenicol (30 μg), Do=Doxycycline (30 μg), F=Nitrofurantoin (300 μg), Ot=Oxytetracycline (30 μg). MAR=Multiple antibiotic resistance, PCR=Polymerase chain reaction, A. sobria=Aeromonas sobria, C. gariepinus=Clarias gariepinus, A. jandaei=Aeromonas jandaei, A. veronii=Aeromonas veronii,

P. hypopthalmus=Pangasiusr hypopthalmus, A. hydrophila=Aeromonas hydrophila

Discussion

H2S production is one of the features of Aeromonas spp. pathogenic piscine strains [42]. Shotts and Rimler [43] indicated that Aeromonas spp. grown on an RSA medium formed yellow colonies; however, the colonies with black centers had to be tested for oxidase production to exclude the probability of Citrobacter spp. or other species of bacteria. MAS is broad, which includes A. hydrophila and several species of Aeromonas that have been reported to be risks to freshwater fish in aquaculture [13,14,44,45]. Motile aeromonad infections are possibly the most significant bacterial infection in freshwater fish. They are also discovered regularly in the intestines and gills of freshwater fish. Therefore, in this study, bacteria of the genus Aeromonas were isolated from the kidneys of red hybrid tilapia (Oreochromis spp.), including African (C. gariepinus) and Pangasius (P. hypophthalmus) catfishes obtained from the states of Kelantan and Terengganu in Malaysia.

Furthermore, among the 61 isolates from the genus Aeromonas isolated, 28 isolates were A. jandaei, 19 were A. veronii, and seven isolates were A. hydrophila and A. sobria, respectively. These results are in agreement with those observed in earlier studies by Radu et al. [46] that found A. veronii, A. sobria, A. hydrophila, and A. caviae in the market fish samples from Selangor state in Malaysia. In India, A. hydrophila has also been isolated from fish obtained from retail shops [47]. In addition, Ashiru et al. [48] isolated A. hydrophila, A. caviae, and A. sobria in catfish (Clarias betrachus) and tilapia fish (Tilapia nilotica) obtained from the Makoko market in Nigeria. The authors reported that A. caviae was predominant in tilapia fish, whereas A. hydrophila and A. sobria were predominant in catfish. Other studies have also reported that A. jandaei is pathogenic to aquaculture fish, such as European eels (Anguilla anguilla) [49] and Pangasius catfish (P. hypophthalmus) [50]. Besides, other studies have shown that A. veronii infected high numbers of fish, such as Chinese long snout catfish (Leiocassis longirostris) [51], loach (Misgurnus anguillicaudatus) [45], Oscar (Astronotus ocellatus) [52], and tilapia (Oreochromis spp.) [13,14,44]. This bacterial genus attacks catfish, which is among the main freshwater resources, and infects all sizes of fish as well, which can lead to death and result in big losses of freshwater fish production [53].

Aeromonas genus generates single or MARs rapidly, indicating that this genus is an effective marker of antimicrobial resistance in the freshwater aquaculture system [54]. The MAR index varying from 0.07 to 0.64 with 60% (37/61) of the isolates have MAR indices of more than 0.2 (high-risk source of contamination), suggesting that the Aeromonas spp. in these farmed fish have been exposed to a high level of antibiotics during the cultivation processes, which can result in the development of antibiotic resistance among the bacteria isolates. Results from this study prove this fact, which revealed a high level of multi-drug resistance (MDR) among the isolates tested (Table-3). However, the percentage of MAR index of more than 0.2 in this study (60%) was much lower than that obtained from the study by Odeyemi and Ahmad [55] in Aeromonas spp., isolated from 53 aquatic samples in Melaka, Malaysia (100%). This result indicates that the indiscriminate use of antibiotics in West Coast Malaysia (Melaka) is higher than in East Coast Malaysia (Kelantan and Terengganu). High resistance of MDR due to Aeromonas spp. has also been reported as serious public health pathogens that cause gastroenteritis, septicemia, and skin infections in humans, which enter the human body through contaminated food and water consumption, including skin lesions [56].

In this study, all Aeromonas isolates were highly ampicillin-resistant. A previous study reported that these Aeromonas species acquired β-lactams resistance through the expression of chromosomal lactamases [57]. This finding is also proposed to be due to a high intrinsic β-lactam resistance, which is enhanced by an active efflux mechanism or cooperation through external membrane impermeability or secondary resistance mechanisms known as β-lactamases or antibiotic efflux pumps [54,57,58]. Furthermore, resistance rates to tetracycline, oxytetracycline, streptomycin, kanamycin, nalidixic acid, neomycin, sulfamethoxazole, ciprofloxacin, and gentamicin have also been recorded, which is suggested to be due to the extensive consumption of such antimicrobials in the ornamental fishery [59,60]. All isolates were also susceptible to chloramphenicol and nitrofurantoin. This observation is due to that these antibiotics were banned in Malaysia for use in treating aquatic animal diseases [61]. Several antibiotics were completely banned as well for food animals and aquaculture in Malaysia because of serious toxicity and the development of antibiotic-resistant bacterial strains, such as avoparcin, chloramphenicol, nitrofurans (i.e., nitrofurantoin, nitrofurazone, furazolidone, and furaltadone), teicoplanin, vancomycin, and norfloxacin [61,62].

Furthermore, in this study, no trends of significant antibiotic resistance specific to the fish species were observed. The current findings follow other research on MDR occurrence from aquatic habitats and seafood samples in Aeromonas spp. [63,64]. These classes of antibiotics are broadly used worldwide as well, particularly in developing countries in Asia, because of their low cost and diverse-spectrum antimicrobial activity, which increases the chances for any bacterial species to develop resistance to these antibiotics [65,66].

The presence of resistance genes was also detected in several of the isolates during this study, including those encoding resistance to ampicillin (blaTEM and blaSHV), streptomycin (aadA and strA-strB), and tetracyclines (tetA and tetE). The present findings agree with earlier studies where tetA genes were the most significant determinants of tetracycline resistance and have commonly been observed in Aeromonas spp. [39,67]. Increased resistance to β-lactam antimicrobials (penicillins and derivatives, cephalosporins, carbapenems, and monobactams) through the existence of genes that code for the formation of β-lactamase has also been reported [68]. In addition, Jones-Dias et al. [69] mentioned that in Aeromonas spp., three main β-lactamases were identified: Metallo-β-lactamase Class B, cephalosporinase Class C, and penicillinase Class D. Fosse et al. [70] have also categorized the β-lactamases into five (i*v) groups of Aeromonas species: (i) The A. hydrophila complex strains exhibiting Classes B, C, and D β-lactamases; (ii) the A. caviae strains exhibiting Classes C and D β-lactamases; (iii) the A. veronii strains identifying Classes B and D lactamases; (iv) the Allium schubertii strains recognizing Class D lactamases; and (v) the Aeromonas trota strains containing Class C β-lactamases. It is also suggested that several isolates of A. veronii biovar sobria do contain a class C cephalosporinase [58]. Therefore, because of the presence of β-lactamase genes, increased resistance to β-lactam antibiotics was reported in the Aeromonas genus [4,68,71,72].

Conclusion

This study has identified several Aeromonas spp. that are resistant to several types of antibiotics in freshwater fish from Kelantan and Terengganu states, with 60% (37/61) of the isolates having a MAR index of more than 0.2. The result suggests that aquaculture waste deposited into the aquatic ecosystems is one of the factors that enhance the incidence of aeromonad MDR in the river water. The presence of Aeromonas species in freshwater fish can thus be a major problem if the fish is not cooked properly. This drug resistance has become a major public health concern since these fish species (Oreochromis spp., C. gariepinus, and P. hypophthalmus) are important sources of aquatic proteins consumed in Malaysia. Therefore, regular surveillance for antibiotic resistance of Aeromonas spp. should be conducted among freshwater fish. Finally, more intensive studies should discover the specific existence of antibiotic resistance in Aeromonas spp., including the levels of antibiotics that affect their resistance profile.

Authors’ Contributions

NNFNMF: Designed the study and drafted the manuscript. MM, RHH, AI, AAMZ, and NFAM: Data analysis. RHH and MM: Direction and supervision of the study. All authors read and approved the final manuscript.

Acknowledgments

This study was funded by the Fundamental Research Grant Scheme (FRGS/1/2015/WAB01/UMK/03/2) under Ministry of Higher Education, Malaysia. The authors also would like to thank the Department of Fisheries, Malaysia, for providing information on fish farming sites in Kelantan and Terengganu.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.DoF (Department of Fisheries) 2015. [Retrieved on 02-06-2020]. Available from:https://www.dof.gov.my/epms/index.php/pages/view/2614 .
  • 2.Sousa H, Hinzmann M. Review:Antibacterial components of the Bivalve's immune system and the potential of freshwater bivalves as a source of new antibacterial compounds. Fish Shell. Immunol. 2020;98:971–980. doi: 10.1016/j.fsi.2019.10.062. [DOI] [PubMed] [Google Scholar]
  • 3.Aberoum A, Jooyandeh H. A review on occurrence and characterization of the Aeromonas species from marine fishes. World J. Fish Mar. Sci. 2010;2(6):519–523. [Google Scholar]
  • 4.Carvalho M.J, Martínez-Murcia A, Esteves A.C, Correia A, Saavedra M.J. Phylogenetic diversity, antibiotic resistance and virulence traits of Aeromonas spp. from untreated waters for human consumption. Int. J. Food Microbiol. 2012;159(3):230–239. doi: 10.1016/j.ijfoodmicro.2012.09.008. [DOI] [PubMed] [Google Scholar]
  • 5.Ghenghesh K.S, Ahmed S.F, El-Khalek R.A, Al-Gendy A, Klena J. Aeromonas-associated infections in developing countries. J. Infect. Dev. Ctries. 2008;2(2):81–98. [PubMed] [Google Scholar]
  • 6.Lee S.W, Wee W. Characterization of Vibrio alginolyticus isolated from white leg shrimp (Litopenaeus vannamei) with emphasis on its antibiogram and heavy metal resistance pattern. Vet. Arh. 2012;82(2):221–227. [Google Scholar]
  • 7.Abbott S.L, Cheung W.K.W, Janda J.M. The genus Aeromonas:Biochemical characteristics, atypical reactions, and phenotypic identification schemes. J. Clin. Microbiol. 2003;41(6):2348–2357. doi: 10.1128/JCM.41.6.2348-2357.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dong H.T, Techatanakitarnan C, Jindakittikul P, Thaiprayoon A, Taengphu S, Charoensapsri W, Khunrae P, Rattanarojpong T, Senapin S. Aeromonas jandaei and Aeromonas veronii caused disease and mortality in Nile tilapia, Oreochromis niloticus (L.) J. Fish Dis. 2017;40(10):1395–1403. doi: 10.1111/jfd.12617. [DOI] [PubMed] [Google Scholar]
  • 9.Hassan M.A, Noureldin E.A, Mahmoud M.A, Fita N.A. Molecular identification and epizootiology of Aeromonas veronii infection among farmed Oreochromis niloticus in Eastern Province, KSA. Egypt. J. Aquat. Res. 43(2):161–167. [Google Scholar]
  • 10.Stratev D, Odeyemi O.A. An overview of motile Aeromonas septicaemia management. Aquac. Int. 2017;25:1095–1105. [Google Scholar]
  • 11.Li Y, Cai S.H. Identification and pathogenicity of Aeromonas sobria on Tail-rot disease in Juvenile Tilapia Oreochromis niloticus. Curr. Microbiol. 2011;62(2):623–627. doi: 10.1007/s00284-010-9753-8. [DOI] [PubMed] [Google Scholar]
  • 12.Soto-Rodriguez S.A, Cabanillas-Ramos J, Alcaraz U, Gomez-Gil B, Romalde J.L. Identification and virulence of Aeromonas dhakensis, Pseudomonas mosselii and Microbacterium paraoxydans isolated from Nile tilapia, Oreochromis niloticus, cultivated in Mexico. J. Appl. Microbiol. 2013;115(3):654–662. doi: 10.1111/jam.12280. [DOI] [PubMed] [Google Scholar]
  • 13.Dong H.T, Rodkhum C, Le H.D, Sangsuriya P, Senapin S, Jitrakorn S, Jitrakorn S, Saksmerprome V, Nguyen V.V. Naturally concurrent infections of bacterial and viral pathogens in disease outbreaks in cultured Nile tilapia (Oreochromis niloticus) farms. Aquaculture. 2015;448:427–435. [Google Scholar]
  • 14.Eissa I.A.M, El-Lamei M, Sherif M, Youssef F, Zaki M.S, Bakry M. Detection of hemolysin gene and antibiogram of Aeromonas veronii biovar sobria isolated from mass mortalities in cultured Nile Tilapia in El-Sharkia governorate, Egypt,”. Life Sci. J. 2015;43(2):161–167. [Google Scholar]
  • 15.Huys G, Cnockaert M, Swings J. Aeromonas culicicola Pidiyar et al. 2002 is a later subjective synonym of Aeromonas veronii Hickman-Brenner et al. 1987. Syst. Appl. Microbiol. 2005;28(7):604–609. doi: 10.1016/j.syapm.2005.03.012. [DOI] [PubMed] [Google Scholar]
  • 16.Nhung P.H, Hata H, Ohkusu K, Noda M, Shah M.M, Goto K, Ezaki T. Use of the novel phylogenetic marker dnaJ and DNA-DNA hybridization to clarify interrelationships within the genus Aeromonas. Int. J. Syst. Evol. Microbiol. 2007;57(6):1232–1237. doi: 10.1099/ijs.0.64957-0. [DOI] [PubMed] [Google Scholar]
  • 17.Ibrahem M.D, Mostafa M.M, Arab R.M.H, Rezk M.A. United States: 2008. Prevalence of Aeromonas hydrophila Infection in Wild and Cultured Tilapia Nilotica (O. niloticus) in. 8th International Symposium on Tilapia In Aquaculture; pp. 1257–1271. [Google Scholar]
  • 18.Van Boeckel T.P, Brower C, Gilbert M, Grenfell B.T, Levin S.A, Robinson T.P, Teillant A, Laxminarayan R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. U. S. A. 2015;112(18):5649–5654. doi: 10.1073/pnas.1503141112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fair R.J, Tor Y. Antibiotics and bacterial resistance in the 21st century. Perspect. Medicin. Chem. 2014;6:25–64. doi: 10.4137/PMC.S14459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nakayama T, Hoa T.T.T, Harada K, Warisaya M, Asayama M, Hinenoya A, Lee J.W, Phu T.M, Ueda S, Sumimura Y, Hirata K, Phuong N.T, Yamamoto Y. Water metagenomic analysis reveals low bacterial diversity and the presence of antimicrobial residues and resistance genes in a river containing wastewater from backyard aquacultures in the Mekong Delta, Vietnam. Environ. Pollut. 2017;222:294–306. doi: 10.1016/j.envpol.2016.12.041. [DOI] [PubMed] [Google Scholar]
  • 21.Rico A, Van den Brink P.J. Probabilistic risk assessment of veterinary medicines applied to four major aquaculture species produced in Asia. Sci. Total Environ. 2014;468-469:630–641. doi: 10.1016/j.scitotenv.2013.08.063. [DOI] [PubMed] [Google Scholar]
  • 22.Andrieu M, Rico A, Phu T.M, Huong D.T.T, Phuong N.T, Van den Brink P.J. Ecological risk assessment of the antibiotic enrofloxacin applied to Pangasius catfish farms in the Mekong Delta, Vietnam. Chemosphere. 2015;119:407–414. doi: 10.1016/j.chemosphere.2014.06.062. [DOI] [PubMed] [Google Scholar]
  • 23.Muziasari W.I, Pitkänen L.K, Sørum H, Stedtfeld R.D, Tiedje J.M, Virta M. The resistome of farmed fish feces contributes to the enrichment of antibiotic resistance genes in sediments below baltic sea fish farms. Front. Microbiol. 2017;7:2137. doi: 10.3389/fmicb.2016.02137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rico A, Phu T.M, Satapornvanit K, Min J, Shahabuddin A.M, Henriksson P.J.G, Murray F.J, Little D.C, Dalsgaard A, Van den Brinka P.J. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species farmed in Asia. Aquaculture. 201;412-413(1):231–243. [Google Scholar]
  • 25.Buschmann A.H, Tomova A, Lopez A, Maldonado M.A, Henriquez L.A, Ivanova L, Moy F, Godfrey H.P, Cabello F.C. Salmon aquaculture and antimicrobial resistance in the marine environment. PLoS One. 2012;7(8):e42724. doi: 10.1371/journal.pone.0042724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hatosy S.M, Martiny A.C. The ocean as a global reservoir of antibiotic resistance genes. Appl. Environ. Microbiol. 2015;81(21):7593–7599. doi: 10.1128/AEM.00736-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rico A, Oliveira R, McDonough S, Matser A, Khatikarn J, Satapornvanit K. Use, fate and ecological risks of antibiotics applied in tilapia cage farming in Thailand. Environ. Pollut. 2014;191:8–16. doi: 10.1016/j.envpol.2014.04.002. [DOI] [PubMed] [Google Scholar]
  • 28.Kümmerer K. Antibiotics in the aquatic environment-a review-Part I. Chemosphere. 2009;75(4):417–434. doi: 10.1016/j.chemosphere.2008.11.086. [DOI] [PubMed] [Google Scholar]
  • 29.Baquero F, Martínez J.L, Cantón R. Antibiotics and antibiotic resistance in water environments. Curr. Opin. Biotechnol. 2008;19(3):260–265. doi: 10.1016/j.copbio.2008.05.006. [DOI] [PubMed] [Google Scholar]
  • 30.Robinson T.P, Bu D.P, Carrique-Mas J, Fevre E.M, Gilbert M, Grace D, Hay S.I, Jiwakanon J, Kakkar M, Kariuki S, Laxminarayan R, Lubroth J, Magnusson U, Thi Ngoc P, Van Boeckel T.P, Woolhouse M.E.J. Antibiotic resistance is the quintessential one health issue. Trans. R. Soc. Trop. Med. Hyg. 2016;110(7):377–380. doi: 10.1093/trstmh/trw048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Marshall B.M, Levy S.B. Food animals and antimicrobials:Impacts on human health. Clin. Microbiol. Rev. 2011;24(4):718–733. doi: 10.1128/CMR.00002-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hussain I.A, Jeyasekaran G, Shakila R.J, Raj K.T, Jeevithan E. Detection of hemolytic strains of Aeromonas hydrophila and A. sobria along with other Aeromonas spp. from fish and fishery products by multiplex PCR. J. Food Sci. Technol. 2014;51(2):401–407. doi: 10.1007/s13197-013-1190-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.CLSI . 28th ed. Wayne, PA: CLSI; 2018. Performance Standards for Antimicrobial Susceptibility Testing, CLSI Supplement M100. [Google Scholar]
  • 34.Sarter S, Kha Nguyen H.N, Hung L.T, Lazard J, Montet D. Antibiotic resistance in Gram-negative bacteria isolated from farmed catfish. Food Control. 2007;18(11):1391–1396. [Google Scholar]
  • 35.Sundström L, Rådström P, Swedberg G, Sköld O. Site-specific recombination promotes linkage between trimethoprim-and sulfonamide resistance genes. Sequence characterization of dhfrV and sulI and a recombination active locus of Tn 21. MGG Mol. Gen. Genet. 1988;213(2-3):191–201. doi: 10.1007/BF00339581. [DOI] [PubMed] [Google Scholar]
  • 36.Sunde M, Norström M. The genetic background for streptomycin resistance in Escherichia coli influences the distribution of MICs. J. Antimicrob. Chemother. 2005;56(1):87–90. doi: 10.1093/jac/dki150. [DOI] [PubMed] [Google Scholar]
  • 37.Han H.S, Koh Y.J, Hur J.S, Jung J.S. Occurrence of the strA-strB streptomycin resistance genes in Pseudomonas species isolated from kiwifruit plants. J. Microbiol. 2004;42(4):365–368. [PubMed] [Google Scholar]
  • 38.Rasheed J.K, Jay C, Metchock B, Berkowitz F, Weigel L, Crellin J. Evolution of extended-spectrum b-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia. Antimicrob. Agents Chemother. 1997;41(3):647–653. doi: 10.1128/aac.41.3.647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Schmidt A.S, Bruun M.S, Dalsgaard I, Larsen L. Incidence, distribution, and spread of tetracycline resistance determinants and integron-associated antibiotic resistance genes among motile aeromonads from a fish farming environment article a prendre comme exemple et comportant les amorces pour les in. Appl. Environ. Microbiol. 2001;67(12):5675–5682. doi: 10.1128/AEM.67.12.5675-5682.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schmidt A.S, Bruun M.S, Larsen J.L, Dalsgaard I. Characterization of class 1 integrons associated with R-plasmids in clinical Aeromonas salmonicida isolates from various geographical areas. J. Antimicrob. Chemother. 2001;47(6):735–743. doi: 10.1093/jac/47.6.735. [DOI] [PubMed] [Google Scholar]
  • 41.Aarestrup F.M, Agerso Y, Gerner-Smidt P, Madsen M, Jensen L.B. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn. Microbiol. Infect. Dis. 2000;37(2):127–137. doi: 10.1016/s0732-8893(00)00130-9. [DOI] [PubMed] [Google Scholar]
  • 42.Austin B, Austin D.A. Chichester: Ellis Horwood Ltd; 2012. Bacterial Fish Pathogens:Disease of Farmed and Wild Fish. [Google Scholar]
  • 43.Shoits E.B, Rimler R. Medium for the isolation of Aeromonas hydrophila. Appl. Microbiol. 1973;26(4):550–553. doi: 10.1128/am.26.4.550-553.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Peepim T, Dong H.T, Senapin S, Khunrae P, Rattanarojpong T. Epr3 is a conserved immunogenic protein among Aeromonas species and able to induce antibody response in Nile tilapia. Aquaculture. 2016;464(1):399–409. [Google Scholar]
  • 45.Zhu M, Wang X.R, Li J, Li G.Y, Liu Z.P, Mo Z.L. Identification and virulence properties of Aeromonas veronii bv. sobria isolates causing an ulcerative syndrome of loach Misgurnus anguillicaudatus. J. Fish Dis. 2016;39(6):777–7781. doi: 10.1111/jfd.12413. [DOI] [PubMed] [Google Scholar]
  • 46.Radu S, Ahmad N, Ling F.H, Reezal A. Prevalence and resistance to antibiotics for Aeromonas species from retail fish in Malaysia. Int. J. Food Microbiol. 2003;81(3):261–266. doi: 10.1016/s0168-1605(02)00228-3. [DOI] [PubMed] [Google Scholar]
  • 47.Kaskhedikar M, Chhabra D. Multiple drug resistance in Aeromonas hydrophila isolates of fish. Vet. World. 2010;3(2):76–77. [Google Scholar]
  • 48.Ashiru A.W, Uaboi-Egbeni P.O, Oguntowo J.E, Idika C.N. Isolation and antibiotic profile of Aeromonas species from Tilapia Fish (Tilapia nilotica) and Catfish (Clarias batrachus) Pak. J. Nutr. 2011;10(10):982–986. [Google Scholar]
  • 49.Esteve C, Biosca E, Amaro C. Virulence of Aeromonas hydrophila and some other bacteria isolated from European eels Anguilla anguilla reared in fresh water. Dis. Aquat. Organ. 1993;16:15–20. [Google Scholar]
  • 50.Kumar S.P, Shankar R.S, Pasim R.K, Sabayasaohi P, Kumar D.N. Pathogenic status, antibiogram, adhesive characteristics, heavy metal tolerance and incidence of integrons of infected fish isolated Aeromonas spp. J. Sustain. Sci. Manage. 2019;14(2):21–35. [Google Scholar]
  • 51.Cai S.H, Wu Z.H, Jian J.C, Lu Y.S, Tang J.F. Characterization of pathogenic Aeromonas veronii bv. veronii associated with ulcerative syndrome from Chinese longsnout catfish (Leiocassis longirostris günther) Braz. J. Microbiol. 2012;43(1):382–388. doi: 10.1590/S1517-838220120001000046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sreedharan K, Philip R, Singh I.S.B. Isolation and characterization of virulent Aeromonas veronii from ascitic fluid of oscar Astronotus ocellatus showing signs of infectious dropsy. Dis. Aquat. Organ. 2011;94(1):29–39. doi: 10.3354/dao02304. [DOI] [PubMed] [Google Scholar]
  • 53.Kusdarwati R, Kismiyati, Sudarno, Kurniawan H, Prayogi Y.T. Isolation and identification of Aeromonas hydrophila and Saprolegnia spp. on catfish (Clarias gariepinus) in floating cages in bozem moro Krembangan Surabaya. IOP Conf. Ser. Earth Environ. Sci. 2017;55(1):012038. [Google Scholar]
  • 54.Nguyen H.N.K, Van T.T.H, Nguyen H.T, Smooker P.M, Shimeta J, Coloe P.J. Molecular characterization of antibiotic resistance in Pseudomonas and Aeromonas isolates from catfish of the Mekong Delta, Vietnam. Vet. Microbiol. 171(3-4):397–405. doi: 10.1016/j.vetmic.2014.01.028. [DOI] [PubMed] [Google Scholar]
  • 55.Odeyemi O.A, Ahmad A. Antibiotic resistance profiling and phenotyping of Aeromonas species isolated from aquatic sources. Saudi J. Biol. Sci. 2017;24(1):65–70. doi: 10.1016/j.sjbs.2015.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Igbinosa I.H, Igumbor E.U, Aghdasi F, Tom M, Okoh A.I. Emerging Aeromonas species infections and their significance in public health. Sci. World J. 2012;2012:625023. doi: 10.1100/2012/625023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Tayler A.E, Ayala J.A, Niumsup P, Westphal K, Baker J.A, Zhang J.A, Zhang L, Walsh T.R, Wiedemann B, Bennett P.A, Avison M.B. Induction of β-lactamase production in Aeromonas hydrophila is responsive to β-lactam-mediated changes in peptidoglycan composition. Microbiology. 2010;156(8):2327–2335. doi: 10.1099/mic.0.035220-0. [DOI] [PubMed] [Google Scholar]
  • 58.Janda J.M, Abbott S.L. The genus Aeromonas:Taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 2010;23(1):35–73. doi: 10.1128/CMR.00039-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Cabello F.C, Godfrey H.P, Buschmann A.H, Dölz H.J. Aquaculture as yet another environmental gateway to the development and globalisation of antimicrobial resistance. Lancet Infect. Dis. 2016;16(7):e127–e133. doi: 10.1016/S1473-3099(16)00100-6. [DOI] [PubMed] [Google Scholar]
  • 60.Dobiasova H, Kutilova I, Piackova V, Vesely T, Cizek A, Dolejska M. Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids. Vet. Microbiol. 2014;171(3-4):413–421. doi: 10.1016/j.vetmic.2014.02.011. [DOI] [PubMed] [Google Scholar]
  • 61.National Pharmaceutical Regulatory Agency. Ministry of Health Malaysia. List of Registered Veterinary Products. 2017. [Retrieved on 22-12-2020]. Available from:http://www.npra.moh.gov.my/images/reg.info/Veterinary/2017/LIST_OF_REGISTERED_VETERINARY_PRODUCTS_2017.pdf .
  • 62.European Food Safety Authority. Scientific opinion on nitrofurans and their metabolites in food. EFSA J. 2015;13(6):4140. [Google Scholar]
  • 63.Deng Y, Wu Y, Jiang L, Tan A, Zhang R, Luo L. Multi-drug resistance mediated by class 1 integrons in Aeromonas isolated from farmed freshwater animals. Front. Microbiol. 2016;7:935. doi: 10.3389/fmicb.2016.00935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Dias C, Mota V, Martinez-Murcia A, Saavedra M.J. Antimicrobial resistance patterns of Aeromonas spp. isolated from ornamental fish. J. Aquac. Res. Dev. 2012;3(3):131. [Google Scholar]
  • 65.Luo Y, Xu L, Rysz M, Wang Y, Zhang H, Alvarez P.J.J. Occurrence and transport of tetracycline, sulfonamide, quinolone, and macrolide antibiotics in the Haihe River basin, China. Environ. Sci. Technol. 2011;45(5):1827–1833. doi: 10.1021/es104009s. [DOI] [PubMed] [Google Scholar]
  • 66.Suzuki S, Hoa P.T.P. Distribution of quinolones, sulfonamides, tetracyclines in aquatic environment and antibiotic resistance in Indochina. Front. Microbiol. 2012;3:67. doi: 10.3389/fmicb.2012.00067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Nawaz M, Khan S.A, Khan A.A, Sung K, Tran Q, Kerdahi K, Steele R. Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food Microbiol. 2010;27(3):327–331. doi: 10.1016/j.fm.2009.11.007. [DOI] [PubMed] [Google Scholar]
  • 68.Ndi O.L, Barton M.D. Incidence of class 1 integron and other antibiotic resistance determinants in Aeromonas spp. From rainbow trout farms in Australia. J. Antimicrob. Chemother. 2011;34(8):589–599. doi: 10.1111/j.1365-2761.2011.01272.x. [DOI] [PubMed] [Google Scholar]
  • 69.Jones-Dias D, Manageiro V, Ferreira E, Louro D, Caniça M. Diversity of extended-spectrum and plasmid-mediated AmpC β-lactamases in Enterobacteriaceae isolates from Portuguese health care facilities. J. Microbiol. 2014;52(6):496–503. doi: 10.1007/s12275-014-3420-x. [DOI] [PubMed] [Google Scholar]
  • 70.Fosse T, Giraud-Morin C, Madinier I. Phénotypes de résistance aux β-lactamines dans le genre Aeromonas. Pathol. Biol. 2003;51(5):290–296. doi: 10.1016/s0369-8114(03)00027-0. [DOI] [PubMed] [Google Scholar]
  • 71.Chen P.L, Lamy B, Ko W.C. Aeromonasdhakensis, an increasingly recognized human pathogen. Front. Microbiol. 2016;7:793. doi: 10.3389/fmicb.2016.00793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Vega-Sánchez V, Latif-Eugenin F, Soriano-Vargas E, Beaz-Hidalgo R, Figueras M.J, Aguilera-Arreola M.G, Castro-Escarpulli G. Re-identification of Aeromonas isolates from rainbow trout and incidence of class 1 integron and β-lactamase genes. Vet. Microbiol. 2014;172(3-4):528–533. doi: 10.1016/j.vetmic.2014.06.012. [DOI] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES