Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
In the article by McDaniels et al. (2021), there was an error in Table 1.
Primer sequences in Table 1 for the dhodh amplicon should have read:
F‐GTGTTAGCGGAGCAAAACTAAAAG
R‐ATAATTGACAAACTGAAGCACCTG
