Long-term in-vitro glucocorticoid treatment induces glucocorticoid resistance in canine mast cell tumors

Abstract

Although glucocorticoid administration has produced impressive results in treating canine mast cell tumors (MCTs), in some cases, glucocorticoids fail to reduce the tumor volume, leading to tumor relapse even after treatment. To date, mechanisms involved in glucocorticoid resistance in canine MCTs remain poorly defined. The objective of this study was to establish glucocorticoid-resistant canine MCT cell lines derived from glucocorticoid-sensitive cell lines after prolonged treatment with dexamethasone (Dex). Real-time polymerase chain reaction (RT-PCR) revealed that elevation of glucocorticoid receptor (GR)-regulated gene expression was suppressed in Dex-resistant cell lines after Dex stimulation compared with parent Dex-sensitive cell lines. This indicated that GR-regulated transcription was suppressed in Dex-resistant cell lines. Insufficient expression of GRs was not detected in Dex-resistant cell lines. Possible inhibitors of GR-regulated transcription were increased in mRNA expression in Dex-resistant cell lines. In addition, it was determined that mRNA expression of drug efflux pumps and anti-apoptosis factors was higher in Dex-resistant cell lines. In conclusion, glucocorticoid-resistant canine MCT cell lines have been established that are derived from glucocorticoid-sensitive cell lines. These cell lines suggest that multiple mechanisms contribute to glucocorticoid resistance in canine MCT cells. The mechanisms of glucocorticoid resistance after long-term treatment can be further investigated using these cell lines and a novel therapeutic strategy for glucocorticoid-resistant canine MCT cells can be developed.

Introduction

Although glucocorticoids have anti-proliferative effects on hematologic malignancies, some patients exhibit resistance to glucocorticoid treatment (1). It is also suggested that long-term treatment with glucocorticoids leads to glucocorticoid resistance in malignant cells (1,2). The biological actions of glucocorticoids are mediated by the glucocorticoid receptor (GR), which acts as a ligand-activated transcription factor. After binding with a glucocorticoid, GR translocates into the nucleus and regulates the target genes.

The molecular mechanisms of glucocorticoid resistance are grouped into upstream and downstream mechanisms (3). Upstream mechanisms include insufficient ligands, insufficient expression of GR, loss-of-function mutations in GR, and insufficient GR-regulated transcription. Downstream mechanisms include defects in components of the GR pathway and crosstalk from other signaling pathways.

Upstream mechanisms have gained considerable attention for decades. Important inducers of insufficient ligands are drug efflux pumps, including multidrug resistance protein 1 (MDR1), multidrug resistance-associated proteins (MRPs), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) (4). Although overexpression of MDR1 is believed to be responsible for glucocorticoid resistance in vitro, its role in this form of glucocorticoid resistance in patients is unclear (5,6). Numerous studies have reported insufficient expression and loss-of-function mutations in GR (3). Our previous studies also indicate that reduced expression of GR contributes to glucocorticoid resistance in canine neoplastic lymphocytes and mast cells (7,8).

In investigations of insufficient GR-regulated transcription, research on chaperone proteins has attracted considerable attention. In the absence of glucocorticoids, cytoplasmic GR forms a heterocomplex with chaperone proteins, which includes heat-shock protein (HSP90) maintaining the GR in an inactive state (9). Some studies indicate that acute lymphoblastic leukemia (ALL) cells express higher HSP90 than normal blood cells (10,11). Furthermore, 2 ALL cell lines with glucocorticoid resistance exhibit abnormal HSP90 protein and show a concomitant decrease in HSP70 expression (12). B-cell lymphoma (Bcl)-2 associated athanogene (BAG) family molecular chaperone regulator 1 (BAG-1), which is a negative regulator of HSP70, was reported to inhibit DNA binding and subsequent transcriptional activation of glucocorticoid receptors (GRs) (13,14).

In the downstream mechanisms, Bcl family proteins have been investigated. Some of these proteins, which include Bcl-2, Bcl-xL, and Mcl-1, are recognized as anti-apoptotic proteins (15). In particular, the myeloid cell leukemia sequence (Mcl)-1 was reported to be a predominant feature of gene expression signature of glucocorticoid resistance in human childhood ALL (16).

Many investigations have demonstrated that glucocorticoids suppress the proliferation and survival of mast cells (17,18). Although approximately 50 to 70% of canine mast cell tumors (MCTs) respond to neoadjuvant therapy with glucocorticoids, some patients strongly resist oral administration of glucocorticoids (7,19–22). In addition, it is widely known that glucocorticoid resistance develops due to the administration of glucocorticoids (19,22). A recent study reported that expression of the phospho-signal transducer and activator of transcription (STAT)3 was decreased after glucocorticoid treatment in canine MCT cells using pair tissue samples (22), although the molecular mechanisms involved in this resistance remain unclear. In addition, investigations on the detailed molecular mechanisms involved in glucocorticoid treatment-induced resistance have been limited by the lack of a set of glucocorticoid-sensitive and glucocorticoid-resistant cells, both of which should be derived from the same canine MCT tissue or cell line.

The objective of this study was to establish glucocorticoid-resistant canine MCT cell lines after long-term treatment with a glucocorticoid. Furthermore, the mechanisms involved in the development of glucocorticoid resistance were analyzed by comparing the established glucocorticoid-resistant cell line and the parental glucocorticoid-sensitive cell line. To the best of our knowledge, this is the first study on the establishment of glucocorticoid-resistant canine MCT cell lines using long-term treatment with glucocorticoids.

Materials and methods

Cell culture

This study used BR cells and MPT-3 cells as canine mast cell tumor (MCT) cells. BR cells and MPT-3 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Fujifilm Wako Chemicals, Tokyo, Japan) and RPMI1640 (Fujifilm Wako Chemicals), respectively. The culture media were supplied with 10% fetal bovine serum (Biosera, Nuaille, France), 100 U/mL penicillin, and 100 μg/mL streptomycin.

For the establishment of dexamethasone (Dex)-resistant (DeR) cell lines, canine MCT cells were cultured with 1 nM of Dex (Fujifilm Wako Chemicals). After 3 passages, the concentration of Dex was increased to 10 nM. Subsequently, the concentration of Dex was gradually increased after every 3 passages. BR cells and MPT-1 cells that can proliferate continuously at 1000 nM of Dex were considered as the Dex-resistant cell lines and as BR/DeR and MPT-3/DeR, respectively. BR/DeR cells and MPT-3/DeR cells were cultured and passaged more than 40 times using a culture medium containing 1000 nM of Dex.

Cell proliferation assay

For the cell proliferation assay, 4 × 10⁴ cells in 100 μL medium per well were plated in 96-well plates in the presence of various concentrations of Dex. A 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) assay using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) was conducted after 48-hour incubation according to the manufacturer’s instructions. After adding 10 μL WST-8 to the well, the plates were incubated for 1 h. Absorption at 450 nm (A450) was measured using a microplate reader (SH-1300; Corona Electric, Ibaraki, Japan). Each condition was assayed in triplicate. The inhibitory rate was calculated as follows:

$$\text{Inhibitory\hspace{0.17em}rate\hspace{0.17em}}(\%)=[1-(\text{OD}450\hspace{0.17em}\text{at\hspace{0.17em}medium\hspace{0.17em}alone}/\text{OD}450\hspace{0.17em}\text{at\hspace{0.17em}each\hspace{0.17em}concentration\hspace{0.17em}of\hspace{0.17em}reagents})\times 100].$$

In addition, the cell number was determined using a trypan blue dye exclusion test every 24 h after plating.

Real-time polymerase chain reaction

To determine the level of GR-regulated transcription, glucocorticoid-induced leucine zipper (GILZ) and FK506 binding protein (FKBP)5 were detected using real-time polymerase chain reaction (RT-PCR) (23). The cells were cultured and passaged in a Dex-free culture medium for at least 7 d. Total RNA was extracted from cells after a 6-hour incubation either with or without 1000 nM of Dex using a NucleoSpin Plus Kit (Takara Bio, Shiga, Japan). For detection of the other genes, RNA was extracted from cells growing in the culture medium at the logarithmic growth phase. The extracted RNA was then reverse-transcribed into cDNA using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio). Real-time PCR was conducted with TB Green Premix Ex Taq II (Takara Bio) in the presence of 0.2 μM each of the forward and reverse primers for the target genes (Table I). Polymerase chain reaction (PCR) amplification comprised pre-denaturation (95°C, 10 s), 40 cycles of denaturation (95°C, 10 s), annealing, and extension (60°C, 30 s). Fluorescence intensity was measured in real time during extension steps using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, Massachusetts, USA). All mRNA expression levels were normalized to the reference gene [glyceraldehyde3-phosphate dehydrogenase (GAPDH)].

Table I.

Primers used in study.

Gene	Forward primer (5′–3′)	Reverse primer (3′–5′)
GR	CCGACTTACAGAGGCTTCAGG	TCACTTTTGATGAAACAGAAG
FKBP5	GGAGAAGACCATGACATTCCA	AGCTCAGCATTAGGCTCGAT
MDR1	ACTCGGGAGCAGAAGTTTGA	AATGAGACCCCGAAGATGTG
MRP1	CACGTCGACCTGCTACAGAA	CCGTGTCCAGCTCCTTAGAG
MRP2	GAGCTGGCTCACCTCAAAAC	GTAGCTGCCTCTGCCCTATG
MRP3	AGGATGGACCTGATGACAGA	AACTTGGGAATCAGGAGACC
MRP4	GTGGCAGTGTCGTTGTATGG	TCTTTGGATGCTGACGACTG
MRP5	TGTCTACATCCAGGCTGCTG	TGTGGTGTTCCCACTTCCT
LRP	ACAAGACCCGTGTGGTTAGC	AGAGGGACAACACGGTGAAC
BCRP	GAGCTCCTTGTGGTTGAGAA	AGGTGATGGTCATGAGGAGA
BAG1	TGGAATCCAACAGGGTTTTC	GAATGCCTGAACCCTTTTCA
HSP90a	CTTGACCGATCCCAGTAAGC	TATTGATCAGGTCGGCCTTC
HSP90b	AGAAAGAATGCTTCGCCTCA	TCATCGTCCTGCTCTGTGTC
Bcl-2	CTCCTGGCTGTCTCTGAAGG	GTGGCAGGCCTACTGACTTC
Bcl-xL	GCCTTTTTCTCCTTGGGTGG	CTCTCGGCTGCTGCATTGTT
Mcl-1	TGTGGCCAAACACTTGAAGA	GTCAAACAAAGAGGCTGGGA
GAPDH	AACATCATCCCTGCTTCCAC	GACCACCTGGTCCTCAGTGT

Western blot analysis

For the detection of glucocorticoid receptor (GR) protein, cells were lysed with RIPA Buffer (Nacalai Tesque, Tokyo, Japan). After centrifugation, supernatants were mixed with the same volume of sample buffer (20% glycerol, 10% 2-mercaptoethanol, 4% sodium dodecyl sulphate, 100 mM Tris-HCl, pH 6.8), and boiled for 5 min. Samples were applied to SDS-PAGE with the use of 12.5% gels (Bio-Rad Laboratories, Hercules, California, USA). Separated proteins were transferred onto Immobilon-P membranes (Millipore, Bedford, Massachusetts, USA). Blocking of the membranes was done with Blocking One (Nacalai Tesque, Kyoto, Japan). The membrane was incubated with a rabbit anti-GR antibody (Santa Cruz Biotechnology, Lake Placid, New York, USA) or rabbit anti-β-actin (Proteintech, Rosemont, Illinois, USA), followed by Horseradish Peroxidase (HRP)-conjugated antibody (Proteintech). Positive reactions were visualized with EzWestLumi Plus (Atto, Tokyo, Japan).

Sequencing reaction and analysis

The canine glucocorticoid receptor (GR) gene was amplified with specific primers as follows: forward (5′– ATGGACTCCAAG GAATCATTAAG–3′) and reverse (5′– TCACTTTTGATGAAACAG AAG–3′). Polymerase chain reaction (PCR) was conducted using KOD-Plus-Ver. 2 (Toyobo, Osaka, Japan) according to the instructions. The PCR products with primers for forward 315–335, 669–719, 1147–1166, 1583–1593, 1961–1981, and reverse 328–347 (parallel with base numbers of canine GR gene: NCBI reference number; XM_535225.2) were submitted to the Genewiz commercial sequencing facility (South Plainfield, New Jersey, USA) for Sanger sequencing.

Statistical analysis

Analysis of variance (ANOVA) was conducted, followed by a Tukey test with the use of EZR, a statistical analysis software with R version 3.5.2 (24). A P-value < 0.05 was considered statistically significant.

Results

Suppressive effects of Dex on cell proliferation in Dex-sensitive and Dex-resistant canine MCT cells

Dex significantly suppressed the proliferative activity of Dex-sensitive canine MCT cells, parental BR cells, and MPT-3 cells, in a dose-dependent manner (Figure 1 A,B). In contrast, Dex showed no effects on the proliferative activity of Dex-resistant canine MCT cells, BR/DeR cells, and MPT-3/DeR cells (Figure 1 A,B). The inhibitory rate of Dex increased in a dose-dependent manner in BR cells and MPT-3 cells, but not in BR/DeR cells and MPT-3/DeR cells (Figure 1 C,D). Furthermore, Dex significantly inhibited the increase of cell number in BR and MPT-3 cells in a dose-dependent manner but showed no effects on BR/DeR and MPT-3/DeR cells (Figure 2).

Figure 1.

The effect of Dex on cell proliferation. Proliferative activity was evaluated using a WST-8 assay (A, B). An inhibitory effect on the proliferative activity was observed (C, D). Data represent mean ± standard error (SE) of 3 individual experiments.

* P < 0.05 versus 0 nM of Dex.

Figure 2.

The effect of Dex on the cell number. The cell number was evaluated with a trypan blue exclusion test. Data represent mean ± SE of 3 individual experiments.

* P < 0.05 versus medium alone.

GR-regulated transcription

GR-regulated transcription in Dex-sensitive and Dex-resistant canine MCT cells was examined. Dex treatment significantly increased the expression of GR-regulated genes, namely GILZ and FKBP5 in BR and MPT-3 cells (Figure 3 A,B). The fold change in the expression level was greater in BR cells than in MPT-3 cells. In contrast, the increase in the expression of GR-regulated genes after Dex treatment was significantly suppressed in BR/ DeR and MPT-3/ DeR cells compared with the parent Dex-sensitive cells (Figure 3 A,B). There was no significant difference in the expression of GR-regulated genes before and after Dex treatment in MPT-3/ DeR cells, whereas a significant increase was observed in BR/DeR cells (Figure 3 A,B).

Figure 3.

Increase in the expression of GR-regulated transcription. Real-time PCR was conducted to detect the expression levels of GILZ (A) and FKBP5 (B). RNA was extracted from cells after a 6-hour incubation with or without 1000 nM Dex. Relative expression levels of the genes were normalized to a value of GAPDH and calculated by 2^−ΔΔCT. Values were standardized to the medium alone. The data are presented as means ± SE of 3 individual experiments.

NS — Not significant. * P < 0.05.

The expression level and gene sequence of GR

The results from real-time PCR showed that the mRNA expression of glucocorticoid receptor (GR) in BR/DeR cells and MPT-3/ DeR cells was equivalent to that in parental BR cells and MPT-3 cells (Figure 4 A,B). There was no significant difference in the GR expression between Dex-resistant and Dex-sensitive cells, even though the level tended to increase in Dex-resistant cells. Western blotting confirmed that there was no appreciable change in the level of GR protein expression between Dex-resistant and Dex-sensitive cells (Figure 4 C). We also analyzed the sequences of GR genes in BR/ DeR and MPT-3/DeR cells, but no mutations were detected (data not shown).

Figure 4.

Expression of GR. Real-time PCR was conducted to detect the expression levels of GR mRNA (A, B). Relative expression levels of the genes were normalized to a value of GAPDH and calculated using the 2^−ΔΔCT method. Values were standardized to BR (A) or MPT-3 (B). The data are presented as means ± SE of 3 individual experiments. NS — Not significant. Western blotting was conducted to detect the expression levels of GR and β-actin at the protein level (C). The data are representative data of 3 repetitions.

mRNA expression level of drug efflux pumps

MDR1 and MRP5 were significantly increased at the mRNA level in Dex-resistant cells compared with Dex-sensitive cells (Figure 5 A,B). The rate of change was greater in BR/DeR than in MPT-3/ DeR cells, especially for the expression of MDR1. The other drug efflux pump genes, including MRP1, MRP2, MRP3, MRP4, LRP, and BCRP, showed no significant difference between Dex-resistant and Dex-sensitive cells (Figure 5 A,B).

Figure 5.

Gene expression of drug efflux pumps. Real-time PCR was conducted to detect the expression levels of MDR1, MRP1, MRP2, MRP3, MRP4, MRP5, LRP, and BCRP (A, B). Relative expression levels of the genes were normalized to a value of GAPDH and calculated using the 2^−ΔΔCT method. Values were standardized to BR (A) or MPT-3 (B). The data are presented as means ± SE of 3 individual experiments.

* P < 0.05 versus BR (A) or MPT-3 (B).

mRNA expression level of GR transcription inhibitors

The results showed the elevated expression of possible inhibitors of GR-regulated transcription, such as BAG1, HSP90a, and HSP90b, in Dex-resistant cells compared with Dex-sensitive cells (Figure 6 A,B).

Figure 6.

Gene expression of chaperone proteins. Real-time PCR was conducted to detect the expression levels of BAG1, HSP90a, and HSP90b (A, B). Relative expression levels of the genes were normalized to a value of GAPDH and calculated using the 2^−ΔΔCT method. Values were standardized to BR (A) or MPT-3 (B). The data are presented as means ± SE of 3 individual experiments.

* P < 0.05 versus BR (A) or MPT-3 (B).

mRNA expression level of Bcl-2 genes

Real-time PCR indicated that Dex-resistant cells showed a higher gene expression of anti-apoptotic Bcl family proteins, including Bcl-2, Bcl-xL, and Mcl-1, than Dex-sensitive cells (Figure 7 A,B). The elevation in expression was greater in BR/DeR cells than in MPT-3/DeR cells compared with parental BR cells or MPT-3 cells.

Figure 7.

Gene expression of anti-apoptosis factors. Real-time PCR was conducted to detect the expression levels of Bcl-2, Bcl-xL, and Mcl-1 (A, B). Relative expression levels of the genes were normalized to a value of GAPDH and calculated using the 2^−ΔΔCT method. Values were standardized to BR (A) or MPT-3 (B). The data are presented as means ± SE of 3 individual experiments.

* P < 0.05 versus BR (A) or MPT-3 (B).

Discussion

In this study, 2 cell lines with strong Dex-resistance, namely BR/ DeR and MPT-3/DeR cells, have been successfully established. The parental Dex-sensitive cells, BR cells, and MPT-3 cells inhibit proliferation in a low concentration of Dex (10 nM), whereas glucocorticoid-resistant cells proliferate in a high concentration of Dex (1000 nM). The results provide direct evidence that long-term exposure to glucocorticoids causes glucocorticoid resistance in canine MCT cells.

In addition, even Dex-sensitive parental cells gradually proliferate in a high concentration of Dex, suggesting that long-term therapy with glucocorticoids in dogs with MCT will result in the proliferation of glucocorticoid-resistant MCT cells. Considering previous studies and the results of this study, the clinical use of glucocorticoids in dogs with MCT should be combined with additional therapy, including surgical resection, radiotherapy, or chemotherapy with other anti-tumor agents (19,22).

Establishment of pairs of glucocorticoid-resistant and parental glucocorticoid-sensitive canine MCT cell lines enables the mechanism of glucocorticoid treatment-induced resistance in canine MCT to be investigated. The mechanisms can be divided into 2, namely upstream and downstream mechanisms (3). The results demonstrated that the ability of glucocorticoid receptor (GR)-regulated transcription was extremely suppressed in 2 Dex-resistant MCT cells. In particular, there was no increase in the expression of GR target genes after Dex treatment in MPT-3/DeR cells, indicating that upstream mechanisms are dominant in MPT-3/DeR cells. A significant increase in the expression of GR target genes was observed in BR/DeR, however, although the increase was drastically suppressed when compared with parental BR cells. The results suggest that downstream mechanisms play a role in BR/DeR cells, even though the major contribution is from upstream mechanisms.

Previously, we reported that the insufficiency of GR contributes to glucocorticoid resistance in canine MCT cells (7). In contrast, the results in this study demonstrated that the level of GR expression in Dex-resistant MCT cells showed no significant down-regulation compared with Dex-sensitive parental cells. These findings indicate that other mechanisms are involved in glucocorticoid resistance in the established glucocorticoid-resistant MCT cells.

Drug efflux pumps contribute firmly to drug resistance in various cancers (4). In dogs, it has been suggested that MDR1 contributes to glucocorticoid resistance in lymphoma (25–27), although other studies contradict this finding (28,29). From our results, MDR1 and MRP5 were over-expressed in Dex-resistant cells, indicating that the efflux of glucocorticoids may lead to glucocorticoid resistance in these cells. In addition, a high expression of BAG1 and HSP, which has been reported to inhibit GR-regulated transcription (9,13,14), was observed in Dex-resistant MCT cells. This suggests that these factors suppress GR-regulated transcription and contribute to the development of glucocorticoid resistance in these cells.

The results showed that the expression of anti-apoptosis factors, including Bcl-2, Bcl-xL, and Mcl-1, was higher in Dex-resistant cells than in Dex-sensitive cells. The increase in expression of these genes was greater in BR/DeR cells than in MPT-3/DeR cells. These results might explain the strong glucocorticoid resistance in BR/DeR, even when GR-regulated transcription is not fully suppressed.

In conclusion, this study demonstrates that multiple molecular mechanisms contribute to glucocorticoid resistance in canine MCT cells. The results also show that both upstream and downstream mechanisms contribute to this resistance. Further investigation using glucocorticoid-resistant cell lines and parental glucocorticoid-sensitive cell lines will promote the development of a novel therapeutic strategy for glucocorticoid-resistant canine MCT cells.