Correction to: Scientific Reports 10.1038/s41598-020-77293-7, published online 26 November 2020
The original version of this Article contained a repeated error in the Results section, under the subheading ‘Gene expression analysis for ZEP paralogs by quantitative real-time PCR’, in Table 1, and in the Methods section, under the subheading ‘qRT-PCR assay for zeaxanthin epoxidase genes’, where
“g16894.t1”
now reads:
“g16874.t1”
In addition, the primer sequence of Actin was incorrect in the Methods section, under the subheading ‘qRT-PCR assay for zeaxanthin epoxidase genes’, where
“Actin (forward: GTTCATTCAAGCCCACAGAG; reverse: TCCTTCCTTCTTCATCAATCTTC)55 was used as a reference gene to normalise the gene expression of targets.”
now reads:
“Actin (forward: TGTTAGCAACTGGGATGATATGG; reverse: GGATAGCACAGCCTGAATAGC)55 was used as a reference gene to normalise the gene expression of targets.”
The original Article has been corrected.