Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 1999 Sep;19(9):6110–6119. doi: 10.1128/mcb.19.9.6110

The Yeast Trimeric Guanine Nucleotide-Binding Protein α Subunit, Gpa2p, Controls the Meiosis-Specific Kinase Ime2p Activity in Response to Nutrients

Mariel Donzeau 1,, Wolfhard Bandlow 1,*
PMCID: PMC84533  PMID: 10454558

Abstract

Saccharomyces cerevisiae Gpa2p, the α subunit of a heterotrimeric guanine nucleotide-binding protein (G protein), is involved in the regulation of vegetative growth and pseudohyphal development. Here we report that Gpa2p also controls sporulation by interacting with the regulatory domain of Ime2p (Sme1p), a protein kinase essential for entrance of meiosis and sporulation. Protein-protein interactions between Gpa2p and Ime2p depend on the GTP-bound state of Gpa2p and correlate with down-regulation of Ime2p kinase activity in vitro. Overexpression of Ime2p inhibits pseudohyphal development and enables diploid cells to sporulate even in the presence of glucose or nitrogen. In contrast, overexpression of Gpa2p in cells simultaneously overproducing Ime2p results in a drastic reduction of sporulation efficiency, demonstrating an inhibitory effect of Gpa2p on Ime2p function. Furthermore, deletion of GPA2 accelerates sporulation on low-nitrogen medium. These observations are consistent with the following model. In glucose-containing medium, diploid cells do not sporulate because Ime2p is inactive or expressed at low levels. Upon starvation, expression of Gpa2p and Ime2p is induced but sporulation is prevented as long as nitrogen is present in the medium. The negative control of Ime2p kinase activity is exerted at least in part through the activated form of Gpa2p and is released as soon as nutrients are exhausted. This model attributes a switch function to Gpa2p in the meiosis-pseudohyphal growth decision.


Guanine nucleotide-binding proteins (G proteins) are important regulators of a wide spectrum of signal-transducing systems. G proteins consist of β and γ subunits and the GTP-binding α subunit. The activity of these regulatory complexes is controlled by GDP-GTP exchange, which is accomplished by a transmembrane receptor and followed by dissociation of the α subunit from the βγ subcomplex. Then, either the free α subunit or the βγ dimer, or occasionally both, regulates downstream effectors. The signaling system is shut off by hydrolysis of GTP, followed by reassociation of the inactive αβγ complex. In higher eucaryotes, trimeric GTP-binding proteins are involved in the regulation of a large number of effectors, including adenylyl cyclase, phospholipase Cβ, phospholipase A2, phosphoinositide 3-kinase, and ion channels (for reviews, see references 8 and 25).

In the yeast Saccharomyces cerevisiae, two α subunits (Gpa1p and Gpa2p), one β subunit (Ste4p), and one γ subunit (Ste18p) have been characterized (22, 24, 38). The heterotrimeric complex composed of GPA1, STE4, and STE18 gene products has been shown to regulate the mitogen-activated protein kinase pathway in haploid cells upon pheromone stimulation via the pheromone receptor Ste2p or Ste3p (reviewed in references 1 and 18). The β and γ subunits, which associate with the second G-protein α subunit, Gpa2p, are still unknown. Gpa2p plays a role in the regulation of cyclic AMP (cAMP) levels in cooperation with Ras2p (6, 19, 24, 26). Addition of glucose to glucose-starved yeast cells induces a transient peak of the intracellular cAMP level which correlates with the activation of adenylate cyclase by Ras proteins (4, 35). Furthermore, overexpression of Gpa2p causes an additional rise of the cAMP concentration and partially suppresses the growth defect of a temperature-sensitive ras2 mutant (19, 24).

Gpa2p is also involved in the pathway which signals pseudohyphal development under conditions of nitrogen limitation (17, 19). This signaling pathway is, at least in part, mediated by an increase of the cAMP level, leading to activation of protein kinase A (PKA). Whether Gpa2p activates adenylate cyclase directly or indirectly remains unknown (6, 19). In contrast to Ras2p, the Gpa2p signal transfer inducing pseudohyphal differentiation does not involve the mitogen-activated protein kinase cascade (19, 23). Recently, a membrane-spanning receptor, Gpr1p (G-protein-coupled receptor), has been shown to interact with Gpa2p in a two-hybrid assay (39, 41). This Gpa2p-coupled receptor initiates a Ras-independent signaling pathway and may be involved in the response of the cells to nutrients such as nitrogen, glucose, and other fermentable sugars (39, 42). The Gpr1p/Gpa2p pathway is thought to activate Sch9 protein kinase and to act in parallel with the Ras pathway (39). Both Ras2p and Gpa2p signals are likely required for cell growth control and pseudohyphal development.

To better understand the function of Gpa2p and its interplay with effectors, we sought to isolate proteins capable of physically interacting with Gpa2p. To this end, Gpa2p was used as a bait in the yeast interaction trap method (9). Among the genes isolated in this screen, one coded for Ime2p (Sme1p), a meiosis-specific protein kinase essential for the initiation of meiosis and sporulation under conditions of nutrient shortage (21, 30, 40). Kinase activity of Ime2p is required for the regulation of meiotic genes, presumably by phosphorylation of still unidentified substrates (16). In diploid cells, Ime2p expression is strongly induced by the transcriptional activator Ime1p upon exhaustion of nutrients (2, 15, 21, 31). Overexpression of Ime2p from a multicopy plasmid allows diploid cells to sporulate even in the presence of glucose and nitrogen (40).

Here we report that Gpa2p physically interacts with the C-terminal regulatory domain of the protein kinase Ime2p (Ime2CT) and inhibits sporulation when nitrogen or glucose is present. Inhibition of sporulation results, in part, from the inhibition of Ime2p kinase activity by the GTP-bound form of Gpa2p, effecting a switch to Gpa2p in the meiosis-pseudohyphal growth decision.

MATERIALS AND METHODS

Yeast strains and media.

Strains used in this study are listed in Table 1. SD medium contains 0.67% yeast nitrogen base without amino acids (Difco, Detroit, Mich.) and 2% glucose. YPD and YP lactate media contain 1% yeast extract, 2% Bacto Peptone (Difco), and either 2% glucose or 2% lactic acid adjusted to pH 5.5 with KOH. Sporulation (SPO) medium contains 1% potassium acetate (KAc). SLAD medium contains 50 μM ammonium sulfate, 2% glucose, and 0.17% yeast nitrogen base; SLADA medium contains 1% KAc in addition to glucose (19). Media were solidified with 2% agar (Difco).

TABLE 1.

Strains used in this studya

Strain Genotype Reference or source
W303-1B MATα leu2-3 112 trp1-1 ade2-1 his3-11,15 ura3-1 canR1-100 7
W303-1A MATa otherwise isogenic to W303-1B 7
TH101 MATα leu2-3 gpa2::TRP1 ade2-1 his3-11,15 ura3-1 canR1-100 T. Haertel
TH102 MATa leu2-3 gpa2::TRP1 ade2-1 his3-11,15 ura3-1 canR1-100 T. Haertel
MD101 MATα ime2::LEU2 trp1-1 ade2-1 his3-11,15 ura3-1 canR1-100 This study
MD102 MATa ime2::LEU2 trp1-1 ade2-1 his3-11,15 ura3-1 canR1-100 This study
MD111 MATα ime2::LEU2 gpa2::TRP1 ade2-1 his3-11,15 ura3-1 canR1-100 This study
MD112 MATa ime2::LEU2 gpa2::TRP1 ade2-1 his3-11,15 ura3-1 canR1-100 This study
MD211 MD111 × MD112 This study
MD212 MD101 × MD102 This study
MD213 TH101 × TH102 This study
CEN.PK2-1C MATa 27
CEN.PK2-1D MATα, otherwise isogenic to CEN.PK2-1C 27
TH103 MATa gpa2::TRP1 ura3 ade2 his3 leu2 T. Haertel
TH104 MATα gpa2::TRP1 ura3 ade2 his3 leu2 T. Haertel
TH201 CEN.PK2-1C × CEN.PK2-1D T. Haertel
TH202 TH103 × TH104 T. Haertel
RS13-58A-1 MATa his3 leu2 ura3 trp1 ade8 tpk1w1 tpk2::HIS3 tpk3::TRP1 bcy1::LEU2 5
MD214 Diploid strain isogenic to RS13-58A-1 This study
a

The strains were derived from either W303-1A and W303-1B (7), CEN.PK2-1C and CEN.PK2-1D (27) or RS13-58A-1 (5). 

Plasmids.

Plasmids used for protein expression and oligonucleotides used for subcloning are listed in Tables 2 and 3, respectively.

TABLE 2.

Plasmids used in this study

Plasmid Protein
E. coli
 pQE12-GPA2 Gpa2p-His6
 pQE-IME2 His6-Ime2p
 pGEX-IME2 GST-Ime2
Yeast
 pAS-GPA2 Gpa2p fused to BD
 pAS-GPA2/G132V Gpa2pG132V mutant fused to BD
 pAS-GPA2/G299A Gpa2pG299A mutant fused to BD
 pACT-GPA2 Gpa2p fused to GAD
 pAS-IME2CT Ime2CT fused to BD
 pACT-IME2CT Ime2CT fused to GAD
 pACT-IME2 Full-length Ime2p fused to GAD
 pG0304 (23) Gpa2p under its own promoter
 pCUP1-His6GAP2 His6-Gpa2p under CUP1 promoter
 pCUP1-HAIME2CT HA-Ime2CT under CUP1 promoter
 pVT-GPA2/G132V Gpa2pG132V mutant under ADH promoter
 pVT-GPA2/G299A Gpa2pG299A mutant under ADH promoter
 pP584-IME2 Ime2p under its own promoter
 pP584-IME2His6 Ime2p-His6 under its own promoter

TABLE 3.

Oligonucleotides used for subcloning

Oligonucleotide Sequencea Restriction site
Gpa2/Bam 5′-ATTTAGGATCCTGCGCATCTTCAG-3′ BamHI
Gpa2/Bgl 5′-ATTTAAGATCTTTGTAACACTCCAG-3′ BglII
GPA2-5 5′-GCATGCCATGGGTCTCTGCGCATCTTCAGAAAAG-3′ NcoI
GPA2-3 5′-CGCGGATCCTAAGCTGTGCATTCATTGTAACACTCC-3′ BamHI
GPA2-His 5′-TTCACACTAGTATAATGGGCTGCACGGGTTCATCTGAGAAGCATCACCACCATCACCAT AACGGCAGCACTCCTG-3′ SpeI
GPA2-r 5′-AACATCCATGGTTTTAGCTGTGCAT-3′ NcoI
S5-S 5′-GGGGATCCACGATCACGATTCTCATGCTATGTGC-3′ BamHI
SM5-L 5′-CGGAAGATCTTAATGGTTGAAAAACGTAGTAGACAGAGT-3′ BglII
S3-S 5′-GGGGCTCGAGAAGGTTACATTTCCAAAATGTTGGTT-3′ XhoI
P584 5′-CGGGATCCCCTTTTCTCCGGTTGTCCAA-3′ BamHI
P-RI 5′-CATTATCTTCTTCAACGAATTCG-3′
His6 5′-CCGCTCGAGTTAGTGATGATGGTGATGATGGAAGGTTACATTTCCAAA-3′ XhoI
a

Sequences from the coding and promoter regions are underlined. 

Escherichia coli plasmid pQE12-GPA2, expressing His-tagged Gpa2p, was constructed as follows. The GPA2 gene was amplified as a 1.4-kbp DNA fragment from pG0304 (24) by PCR using primers Gpa2/Bam and Gpa2/Bgl, digested with BamHI and BglII, and ligated to the corresponding restriction sites of pQE12 (Qiagen, Hilden, Germany).

Plasmids expressing chimeric proteins (Gpa2p fused either to the binding domain [BD] or to the activating domain [AD] of Gal4p) were constructed as follows. The GPA2 gene was isolated from pQE12-GPA2 as an EcoRI-BglII DNA fragment or amplified by PCR with primers GPA2-5 and GPA2-3, using as a template pQE12-GPA2, pML160, or pML179 (19), and then cut by NcoI and BamHI. These fragments were ligated to the corresponding restriction sites of pAS2-1 or pACT2 (Clontech) (pAS-GPA2, pAS-GPA2/G132V, pAS-GPA2/G299A, and pACT-GPA2). pCUP1-His6GPA2, expressing a chimera consisting of wild-type Gpa2 fused to His6 under the CUP1 promoter, was constructed in several steps. The His6 tag was introduced into the open reading frame of GPA2 after the Lys9 codon by PCR using primers GPA2-His and GPA2-r. The SpeI-NcoI 1.4-kbp DNA fragment was ligated to the corresponding restriction sites of pEX (29). Then an 850-bp BamHI-SpeI DNA fragment containing the AKY2 promoter was replaced by a 435-bp BamHI-EcoRI DNA fragment containing the CUP1 promoter from pW9420 (7), after fill-in reaction, yielding pEXCUP1-His6GPA2. The CUP1-His6-GPA2 terminal fragment obtained from pEXCUP1-His6GPA2 by restriction with EcoRI was then inserted into the corresponding restriction site of vector pRS426 (30). pVTGPA2/G132V and pVTGPA2/G299A were constructed by inserting the NcoI blunt-ended BamHI DNA fragments isolated from pAS-GPA2/G132V and pAS-GPA2/G299A into the PvuII-BamHI restriction sites of pVT100-U (36).

The IME2 3′-terminal segment (from positions +1333 to +1938) and the complete coding sequence of IME2 were amplified from yeast genomic DNA by PCR using 3′ primer S3-S and primers S5-S and SM5-L, respectively. These DNA fragments were digested with BamHI and XhoI or BglII and XhoI and ligated to BamHI- and XhoI-restricted pACT2 (pACT-IME2CT and pACT-IME2). pAS-IME2CT was constructed by ligating the BamHI and BglII DNA fragment from pACT-IME2CT to the BamHI restriction site of pAS2-1. pCUP1-HAIME2CT and pCUP1-HAIME2, which express Ime2pCT and full-length Ime2p fused to the hemagglutinin (HA) peptide sequence (YPYDVPDYA) from human influenza virus HA under the CUP1 promoter, were made in several steps. First, the HA-IME2CT- and HA-IME2-containing BglII DNA fragments, isolated from pACT-IME2CT and pACT-IME2, respectively, were blunt ended with Klenow polymerase and ligated to pW9420 cleaved with EcoRI and XhoI after fill-in reaction. The plasmids were then cleaved by NotI and XhoI, respectively, and the CUP1-IME2CT- and CUP1-IME2-containing DNA fragments were inserted into the corresponding restriction sites of vector pRS423 (30). Plasmid pP548-IME2, a multicopy plasmid derived from pRS423 expressing IME2 under its own promoter (from position −584), was constructed as follows. The IME2 promoter region (positions −584 to +1405) was amplified by PCR from yeast genomic DNA by using primers P584 and P-RI. This DNA fragment was restricted by BamHI and used to replace the CUP1 promoter from pCUP1-HAIME2 (pP584-IME2). pP584-IME2His6, encoding His6-tagged Ime2p, was constructed as follows. First, the His6 tag was introduced at the C terminus of IME2 by PCR using primers S5-S and His6. The DNA fragment was digested by EcoRI-XhoI and used to replace the EcoRI and XhoI restriction fragment of pP584-IME2.

Plasmids pGEX-IME2 and pQE-IME2, expressing glutathione S-transferase (GST)–Ime2 and His6-Ime2 chimeric proteins, respectively, were constructed by inserting the IME2 NcoI-XhoI DNA fragment into pGEX-B and pQE30 (Qiagen).

Interaction trap.

For selection of interaction partners by the two-hybrid system, S. cerevisiae Y190 (Clontech, Heidelberg, Germany) containing pGAL4-GPA2 as a bait was transformed with a yeast genomic interaction library (Clontech) by the lithium acetate method (14) to obtain 106 transformants. Transformants were selected on SD plates lacking Trp, His, and Leu and containing 25 mM 3-amino-1,2,4-triazole. His-prototrophic colonies were assayed for β-galactosidase activity as described by Fields and Song (9). Library plasmids were isolated as described by Hoffman and Winston (12) and analyzed by DNA sequencing.

Gene disruption.

Gene disruption was performed by the one-step method of Rothstein (28). The GPA2 disruption cassette was constructed by replacing the GPA2 EcoRV DNA fragment with a blunt-ended EcoRI DNA fragment containing the TRP1 gene from plasmid Yrp7. The cassette was linearized with PvuII and DraI and used to disrupt GPA2 in strains W303 (7) and CEN.PK2 (27). For disruption of IME2, a BamHI-EcoRI fragment was replaced, after fill-in reaction, by a 2.4-kb HpaI DNA fragment containing LEU2. A 4.5-kbp NcoI and XhoI linear fragment was used to transform strains W303 and W303 Δgpa2/Δgpa2. Correct integration of the disruption cassettes was verified by Southern blot analysis or by PCR.

Construction of a homozygous tpk1w1/tpk1w1 diploid strain.

A bcy1-tpk1w1 haploid strain was transformed with a plasmid expressing the HO gene under the control of the GAL1 promoter. Transformants were grown on galactose medium, and zygotes were isolated by micromanipulation.

Purification of fusion proteins from E. coli.

Recombinant proteins were expressed in E. coli BL21(DE3). Gpa2p-His6 and Ime2p-His6 were purified according to the protocol of the manufacturer, using Ni nitrilotriacetic acid (NTA) columns (Qiagen). GST and GST-Ime2p were purified as previously described (10).

Copurification experiments.

Diploid strain MD211 cotransformed with pCUP1-His6GPA2 and with either pCUP1-HAIMECT or pRS423 was precultured in SD selective medium, diluted in lactate medium containing 1 mM CuSO4, and induced for 6 h. Cells were harvested, resuspended in lysis buffer I (50 mM Tris-HCl [pH 7.5], 1% [vol/vol] Triton X-100, 0.1% [vol/vol] sodium dodecyl sulfate [SDS], 1 mM phenylmethylsulfonyl fluoride, 10 mM imidazole, and 1 μg each of aprotinin, leupeptin, and pepstatin A per ml), and disrupted with glass beads.

Diploid strain MD211 transformed with pG0304 expressing Gpa2p together with pP584-IME2His6 expressing Ime2p-His6 or an empty plasmid, pRS423, was precultured in SD selective medium, diluted in YPD, and incubated for 6 h. Cells were isolated and plated on SPO medium or SPO medium containing 10 mM NH4Cl and incubated at 30°C for 12 h. Cells were collected by centrifugation and disrupted as described above in lysis buffer II (50 mM Na2HPO4 [pH 7.5], 300 mM NaCl, 1% [vol/vol] Triton X-100, 0.1% [vol/vol] SDS, 1 mM phenylmethylsulfonyl fluoride, 1 μg each of aprotinin, leupeptin, and pepstatin A per ml). Total cell extracts were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) on 12% gels and analyzed by Western blotting. Alternatively, total cell extracts were incubated with Ni-NTA beads for 2 to 4 h at 4°C in the presence of 10 mM imidazole. Bound material was washed off with lysis buffer II containing 20 mM imidazole, separated by SDS-PAGE, and analyzed by Western blotting using antibodies directed against Gpa2 (Eurogentech, Ougre, Belgium) or the HA-tag (Roche Diagnostics, Mannheim, Germany).

In vitro binding assay.

Purified Gpa2p-His6 was incubated with either 1 mM guanosine-5′-O-thiotriphosphate (GTPγS) or 1 mM GDP (Sigma, Deisenhofen, Germany) for 30 min at 30°C in STE buffer (10 mM Tris-HCl [pH 8], 150 mM NaCl, 1 mM EDTA). The reaction was stopped by the addition of MgCl2 to a final concentration of 20 mM. Gpa2p (500 ng) bound to GDP or to GTPγS was diluted in 500 μl and incubated with glutathione-bound GST or GST-Ime2p at 4°C for 1 h. Columns were washed three times with STE buffer. Bound proteins were released from the columns by boiling, separated by SDS-PAGE, and analyzed by Western blotting with anti-Gpa2p antibodies and by Coomassie staining.

Protein kinase assay.

Ni-NTA columns loaded with Gpa2p-His6 were incubated with either 1 mM GTPγS or 1 mM GDP in 20 mM Tris-HCl (pH 7.5). Columns were washed with reaction buffer (20 mM Tris-HCl [pH 7.5], 10 mM MgCl2) to eliminate the excess of guanine nucleotides. After elution with 100 mM imidazole, Gpa2p-His6 was used for kinase assays.

GST and GST-Ime2p purified from E. coli and Ime2p-His6 purified from yeast were assayed in 30 μl of reaction buffer containing 5 μg of histone H1 (Roche Diagnostics) and 5 μCi of [γ-32P]ATP (6,000 Ci/mmol) with 5 μg of either bovine serum albumin (BSA), Gpa2p-His6 bound to GDP, or Gpa2p-His6 bound to GTPγS. PKA (Promega, Heidelberg, Germany) was used as a specificity control. The reaction mix was then incubated at 30°C for 30 min. Products were analyzed by SDS-PAGE and autoradiography.

Miscellaneous.

Antibodies directed against E. coli-purified Gpa2p-His6 were raised in rabbits (Eurogentech). These antibodies were purified by affinity column chromatography using the purified Gpa2-His6 recombinant protein coupled to cyanogen bromide-activated Sepharose. β-Galactosidase assays were performed as previously described (11), using total cell extracts or permeabilized cells. β-Galactosidase activities are expressed in Miller units. Protein concentrations were estimated by the method of Bradford (3).

RESULTS

Gpa2p interacts with Ime2p in a two-hybrid system.

To identify proteins which interact with Gpa2p, we used the yeast two-hybrid system (9). Out of 20 independent positive clones, 17 were found to encode various overlapping parts of the 3′ end of Ime2p, a protein kinase essential for meiosis and sporulation (40). These clones had in common a stretch of DNA coding for 33 amino acid residues of Ime2p (amino acids 445 to 478) (data not shown). To verify the specificity of the interaction between Gpa2p and Ime2p, BD-Gpa2p or AD-Gpa2p was assayed with Ime2CT (amino acids 445 to 645) or with full-length Ime2p. Ime2CT coexpressed with Gpa2p activated lacZ expression irrespective of whether the Ime2p part was fused to the Gal4p AD and Gpa2p was fused to the BD or vice versa (Table 4). About 1/40 of this activation potential was observed when the whole IME2 gene was used instead of the C-terminal segment. None of the plasmids, either alone or in combination with pLAM5′-1 as a control, led to activation of lacZ expression.

TABLE 4.

Gpa2p and Ime2p interact in the two-hybrid assay

Protein(s) expressed by strain Y190 His proto-trophy β-Galactosidase activitya
Color on plate U (10) in liquid medium (mean ± SD)
Fusion proteins
 BD-Gpa2p + AD-Gal4p White 2 ± 1.2
 BD-Gpa2p + AD-Ime2CT + Blue 450 ± 100
 BD-Gpa2p + AD-Ime2p + Blue 13 ± 3
 BD-lamin + AD-Ime2CT White 2 ± 1.3
 BD-lamin + AD-Ime2p White 1 ± 0.8
 BD-Ime2CT + AD-Gal4p White 5 ± 2
 BD-Ime2CT + AD-Gpa2p + Blue 470 ± 120
Gal4p wild type + Blue 1,600 ± 200
a

Tested both on filter and in liquid medium, using permeabilized cells (11). 

Ime2p interacts specifically with the active form of Gpa2p.

GDP-bound Gα subunits are associated with βγ subunits and thereby inactive. Addition of GTP to the Gα subunits triggers dissociation of the trimeric complex, leading to activation. Being a Gα subunit, Gpa2p may bind either GTP or GDP in response to specific signals in vivo. To test whether the GTP- or the GDP-bound form of Gpa2p was capable of interacting with Ime2p, transcriptional activation of the lacZ reporter gene was assayed, using a constitutively active Gpa2pG132V or an inactive Gpa2pG299A mutant as the target protein (19). Ime2p coexpressed together with the active form of Gpa2p led to activation of the reporter gene (Table 5). In contrast, Ime2p did not lead to activation of the lacZ reporter when coexpressed with the inactive form of Gpa2p. These findings demonstrate that interactions between the two proteins are specific and regulated by the activation status of Gpa2p. Most interestingly, Ime2pCT expressed together with either Gpa2G132V or Gpa2pG299A led to the same level of β-galactosidase activity, which reveals that both GPA2 alleles are stably expressed. These results indicate that conformational changes of Gpa2p triggered by GTP or GDP binding are critical for the interaction with Ime2p whereas Ime2pCT interacts constitutively and independently of the activation status of Gpa2p.

TABLE 5.

A constitutively active form of Gpa2p interacts with Ime2p in the two-hybrid assaya

Protein(s) β-Galactosidase activityb
Color on plate U (10) in liquid medium (mean ± SD)
Fusion proteins
 BD-Gpa2p + AD-Gal4p White 4.5 ± 1.3
 BD-Gpa2pG132V + AD-Ime2CT Blue 469 ± 100
 BD-Gpa2pG132V + AD-Ime2p Blue 21 ± 4
 BD-Gpa2pG299A + AD-Ime2CT Blue 463 ± 105
 BD-Gpa2pG299A + AD-Ime2p White 5.9 ± 1.5
Gal4p wild type Blue 1260 ± 200
a

Strain Y190 was transformed with pACT2-IME2CT or pACT2-IME2 and crossed with strain Y187 transformed with either pAS2-GPA2/G132V or pAS2-GPA2/G299A. 

b

Tested both on filter and in liquid medium, using protein extracts (11). 

Interactions between Gpa2p and Ime2p depend on the GTP-bound form of Gpa2p.

We further investigated whether protein-protein interactions also occurred in yeast cells by using affinity copurification experiments. Since the GTP/GDP status of Gpa2p is not critical for its interaction with Ime2pCT, His-tagged Gpa2p and Ime2pCT fused to the HA epitope were coexpressed in a diploid strain disrupted for both copies of GPA2 and IME2 genes (strain MD211). Cell extracts were loaded onto Ni-NTA columns, and bound proteins were analyzed by Western blotting using anti-Gpa2 and anti-HA antibodies. HA-Ime2p was retained on the His6-Gpa2p columns but not on the Ni-NTA matrix alone, demonstrating complex formation between the two proteins in vitro (Fig. 1).

FIG. 1.

FIG. 1

Ime2CT specifically binds to Gpa2p. Strain MD211 was transformed with pCUP1-HAIME2CT together with an empty plasmid, pRS426 (lane 1), or with pCUP1-HisGPA2 (lane 2). Extracts from cells grown on lactate medium containing CuSO4 were purified on Ni-NTA columns. Bound proteins were analyzed by Western blotting using anti-Gpa2p and anti-HA antibodies.

Complex formation between Gpa2p and Ime2p in yeast may require additional components. To address this question, interactions were analyzed by using recombinant proteins purified from E. coli. Gpa2p charged with either GDP or GTPγS was loaded onto a GST-Ime2p column, and after elution, protein fractions were analyzed by Western blotting using anti-Gpa2p antibodies. Both forms of Gpa2p were retained on the GST-Ime2p resin (Fig. 2, lanes 4 and 5). However, Gpa2p-GTPγS associated with GST-Ime2p with at least twofold-higher efficiency. Neither Gpa2p-GDP nor Gpa2p-GTPγS bound to the GST matrix (Fig. 2, lane 3). Binding of both forms of Gpa2p may be explained by an incomplete in vitro charging with GTPγS or GDP. Thus, we conclude from these experiments that Ime2p interacts physically and preferentially with the GTPγS-bound form of Gpa2p.

FIG. 2.

FIG. 2

Gpa2p bound to GTP physically interacts with Ime2p in vitro. Purified E. coli Gpa2p-His6 was preincubated with either GDP (lanes 2 and 4) or GTPγS (lanes 3 and 5) and loaded onto glutathione resin carrying GST (lanes 2 and 3) or GST-Ime2p (lanes 4 and 5). Resin-bound proteins were analyzed by Western blotting with anti-Gpa2p antibodies and by Coomassie blue staining for GST and GST-Ime2p. Lane 1, Gpa2p-His6 purified from E. coli; lane M, molecular weight standards.

Gpa2p is a negative regulator of sporulation.

Ime2p is essential for sporulation (40). Its expression is regulated positively by Ime1p and negatively by nutrients (21, 31). Deletion of IME2 abolishes sporulation, whereas its overexpression enables diploid cells to sporulate in the presence of glucose or nitrogen, conditions which normally inhibit spore formation. To address the physiological relevance of the interaction between Gpa2p and Ime2p, the IME2 gene was disrupted in wild-type cells and in Δgpa2/Δgpa2 homozygous diploid cells. Diploid mutant strains bearing the single deletion of GPA2 and IME2 sporulated normally, and both spore viability and germination were comparable to those for wild-type cells. The resulting haploid strains carrying the double disruption of GPA2 and IME2 displayed no obvious growth defects and had normal mating ability. These observations were not surprising, as IME2 expression is detected only in diploid strains under conditions of nutrient starvation (15). Finally, the Δime2/Δime2 Δgpa2/Δgpa2 homozygous diploid mutant showed the same defect in sporulation as the isogenic Δime2/Δime2 homozygous diploid single mutant (data not shown).

A possible effect of Gpa2p on sporulation was scored by measuring the sporulation efficiency of wild-type diploid cells and Δgpa2/Δgpa2 mutant cells grown on low-nitrogen SPO medium for 10 days. We found that 5 to 7% of the cells lacking GPA2 sporulated, whereas only 0.5 to 1% of the wild-type cells entered meiosis (Fig. 3A). In contrast, in the absence of a nitrogen source, the two strains sporulated with the same efficiency (data not shown). These results demonstrate that Gpa2p is a negative regulator of sporulation in the presence but not in the absence of nitrogen.

FIG. 3.

FIG. 3

Gpa2p inhibits sporulation in the presence of nitrogen or glucose. (A) Wild-type (wt) and Δgpa2/Δgpa2 mutant strains were grown on glucose-rich medium, shifted to SPO medium containing 4 mM NH4Cl, and incubated for 10 days. Sporulation was measured by counting the asci. (B) The strain wild-type (◊), a Δgpa2/Δgpa2 strain (■) transformed with empty vectors, and a Δime2/Δime2 Δgpa2/Δgpa2 strain cotransformed either with pP584-IME2 and pG0304 (○) or with pP584-IME2 and an empty vector (▴) were cultured on SD medium and shifted to SPO medium containing increasing concentrations of glucose as indicated. (C) Experiment performed as for panel B except that cells were shifted to SPO medium containing increasing concentrations of NH4Cl as indicated. Values represent averages of at least three independent experiments.

We further examined the inhibitory effect of Gpa2p on sporulation by overexpressing both Gpa2p and Ime2p and measuring sporulation efficiency. It had been shown that deletion of IME2 promoter sequences upstream of position −584 caused a twofold decrease in IME2 transcription but did not affect regulation by Ime1p and nutrients (2). The diploid strain MD211 homozygously disrupted for both copies of GPA2 and IME2 was transformed with a multicopy plasmid expressing Ime2p from its own truncated promoter. These cells sporulated on SPO medium after 3 days with the same efficiency as the wild type (Fig. 3B and C) and, moreover, sporulated in the presence of glucose or nitrogen with much higher efficiency than the wild-type strain and the Δgpa2/Δgpa2 mutant diploid strains (Fig. 3B and C). In contrast, coexpression of Ime2p and Gpa2p from multicopy plasmids decreased sporulation efficiency three- to fivefold in SPO medium supplemented with glucose or nitrogen but had no effect in SPO medium. These results suggest that Gpa2p inhibits spore formation, likely because of its interference with some activity of Ime2p in the presence but not in the absence of nitrogen or glucose.

The negative effect of Gpa2p on sporulation is independent of cAPK.

Modulation of PKA activity by cAMP interferes with entry of yeast cells into meiosis. Since overexpression of GPA2 leads to increased levels of cAMP, the negative regulation of sporulation by Gpa2p could be explained through the cAMP pathway (17, 24). To address this question, the effect of Gpa2p overproduction on sporulation was measured in a bcy1- tpk1w1 mutant strain which lacks a cAMP-responsive protein kinase (cAPK) but still responds to nutrient starvation (5).

bcy1- tpk1w1 diploid cells transformed with a low-copy-number plasmid carrying either the constitutively active GPA2G132V allele or the constitutively inactive GPA2G299A allele were incubated in SPO medium for 2 days, and the extent of sporulation was scored (Fig. 4). Whereas 35% of cells expressing the inactive form of Gpa2pG299A sporulated with the same efficiency as control cells, only 12% of cells expressing the active form of Gpa2pG132V entered meiosis. These results demonstrate that activation of Gpa2p causes a down-regulation of sporulation also by a cAMP-independent mechanism.

FIG. 4.

FIG. 4

The constitutively active Gpa2p acts in a cAMP-independent pathway to regulate meiosis. A bcy1-tpk1w1 diploid strain transformed with either pVT-GPA2G132V (G132V), pVT-GPA2/G299A (G299A), or an empty plasmid (vector) was incubated in SPO medium for 2 days. Sporulation was scored by counting the asci. Values represent averages of at least three independent experiments.

Overproduction of Ime2p as well as the presence of acetate inhibits pseudohyphal development.

Earlier reports have demonstrated the positive role of GPA2 in pseudohyphal development (17, 19). Our finding that Gpa2p also inhibited sporulation through its interaction with Ime2p led us to investigate whether IME2 overexpression or the presence of acetate may have an inhibitory effect on pseudohyphal development. The pseudohypha-forming diploid strain CEN.PK2 was transformed with pP584-IME2 expressing Ime2p and tested for filamentous growth. Wild-type cells developed pseudohyphae when grown on SLAD medium (Fig. 5A). In contrast, overexpression of Ime2p drastically reduced filamentous growth similarly to the Δgpa2/Δgpa2 mutation (Fig. 5B and 4C). Furthermore, the presence of 1% KAc in SLAD medium totally abolished filament formation (Fig. 5D). Thus, formation of pseudohyphae is prevented by overexpression of IME2 or by the presence of acetate. We conclude that pseudohyphal and meiotic developments are two mutually exclusive pathways which, in addition to RAS and cAMP, are regulated by Gpa2p and Ime2p.

FIG. 5.

FIG. 5

Ime2p and the presence of acetate inhibit pseudohyphal development. Filamentous growth of the diploid strain CEN.PK2 transformed with an empty plasmid (A) or with pP584-IME2 overexpressing Ime2p (B) and of the isogenic Δgpa2/Δgpa2 mutant diploid strain (C) was inspected after 4 days of growth on SLAD medium. Strain CEN.PK2 strain was also tested for filamentous growth on SLADA medium (D).

Gpa2p does not affect the stability of Ime2p.

Gpa2p binds to the acidic C-terminal tail of Ime2p, a domain which may be important for the proteolytic stability of Ime2p (16). It is, therefore, conceivable that Gpa2p regulates Ime2p activity by promoting its proteolytic degradation in vivo. To test this hypothesis, Western blot analyses were carried out under conditions where sporulation is repressed by Gpa2p. In these experiments, strain MD211 was transformed with pP584-IME2His6 and pG0304, expressing Ime2p-His6 and Gpa2p, respectively. Cells were grown on glucose medium and then shifted to SPO medium with or without nitrogen. Ime2p-His6 could complement the Δime2/Δime2 mutation and allowed sporulation with wild-type efficiency, indicating that addition of the His6 tag at the C-terminal of Ime2p had no effect on its physiological function (data not shown). Ime2p was detectable by immunodecoration when cells were grown on SPO medium (Fig. 6A, lanes 4 and 7) but not in YPD (Fig. 6A, lanes 3 and 6). In the presence of nitrogen, the level of Ime2p was down-regulated about threefold (Fig. 6A, lanes 2 and 4 or 5 and 7). These results are consistent with previous observations that transcriptional expression of the IME2 gene is regulated negatively by nutrients and positively by acetate (15). Coexpression of Gpa2p and Ime2p did not affect the level of Ime2p (Fig. 6A, lanes 2, 4, 5, and 7), indicating that Gpa2p does not induce proteolytic degradation of Ime2p.

FIG. 6.

FIG. 6

Gpa2p does not promote proteolytic degradation of Ime2p. (A) Strain MD211 was transformed with pP584-IME2-His together with pRS426 as a control (−Gpa2p) or with pG0304 (+Gpa2p). As a negative control, MD211 was transformed with plasmids pRS423 and pRS426 (Control). Transformants were grown in SPO medium containing 10 mM NH4Cl (+N), in SPO medium (−N), or in YPD medium (G). After purification on an Ni-NTA column using the same protein amounts, bound proteins were analyzed by Western blotting using anti-His6 antibodies. (B) MD211 was transformed with either pRS426 as a control (−Gpa2p) or pG0304 (+Gpa2p). Cells were grown in YPD medium (G), in SPO medium (−N), or in SPO medium containing 10 mM NH4Cl (+N). Total extracts were analyzed by Western blotting using anti-Gpa2p antibodies. Control, Gpa2-His6 recombinant protein from E. coli.

The Gpa2p expression pattern was also analyzed in total yeast extracts. Gpa2p was not detectable in extracts prepared from cells grown in glucose (Fig. 6B, lane 3), presumably because of a low level of expression. Indeed, it has been shown that GPA2 mRNA levels decrease after addition of glucose (6). Gpa2p was detectable by Western blotting only under starvation conditions (KAc) and was slightly up-regulated on SPO medium containing nitrogen (Fig. 6B, lanes 4 and 5). Thus, the Gpa2p concentration is highest under conditions in which Ime2p is expressed but inactive, indicating an important role of Gpa2p during starvation. This finding is in accordance with the involvement of Gpa2p as a negative regulator in the sporulation pathway.

Nitrogen induces interaction between Gpa2p and Ime2p.

We further investigated whether the interaction of Gpa2p and Ime2p was regulated by the growth conditions. Gpa2p and Ime2p-His6 were coexpressed in the diploid strain MD211, and cells were grown either on SPO medium or on SPO medium containing nitrogen. Cell extracts were loaded onto Ni-NTA columns, and bound proteins were analyzed by Western blotting using anti-Gpa2p antibodies (Fig. 7). Gpa2p alone did not bind to the Ni-NTA column (Fig. 7a, lanes 2 and 3). Gpa2p was retained on the column only when Ime2p-His6 was purified from cells grown on KAc in the presence of nitrogen (Fig. 7a, lane 5), not when Ime2p-His6 was purified from cells grown on KAc in the absence of nitrogen (Fig. 7a, lane 4). As nitrogen causes an about twofold increase in Gpa2p abundance (Fig. 7b), Gpa2p bound to Ime2p-His6 could be directly proportional to the amount of Gpa2p present in the cell extracts. In contrast, Ime2p was expressed at higher levels when cells were grown in the absence of nitrogen, and recovery of Ime2p from the Ni-NTA columns was two to three times higher in SPO medium than in SPO medium supplemented with nitrogen (Fig. 7a). Therefore, copurification of Ime2p and Gpa2p should have been detected in both growth conditions if the interaction between the proteins was independent of the nitrogen source. As this was not the case, it may be reasonable to conclude that the presence of nitrogen regulates the association of Gpa2p and Ime2p in cells, i.e., under conditions when spore formation is inhibited by Gpa2p.

FIG. 7.

FIG. 7

Nitrogen influences interaction between Gpa2p and Ime2p in vivo. Copurification of Gpa2p and Ime2p-His6 was performed as follows. Strain MD211 was cotransformed with pG0304 and either pRS423 as a control (lanes 2 and 3) or pP584-IME2His6 (lanes 4 and 5). Cells were grown in SPO medium (−N; lanes 2 and 4) or in SPO medium containing nitrogen (+N; lanes 3 and 5). Total cell extracts were loaded onto an Ni-NTA column, and bound proteins were analyzed by Western blotting with purified anti-Gpa2p and anti-His6 antibodies (a). Aliquots of total cell extracts were also analyzed by Western blotting using purified Gpa2 antibodies (b). Lane 1, Gpa2p-His6 recombinant protein, purified from E. coli; lane M, molecular weight standards.

Gpa2p inhibits Ime2p kinase activity.

Ime2p contains two characteristic domains. The amino-terminal domain (approximately 400 amino acids) harbors the kinase catalytic center and is required for initiation of meiosis. The carboxy-terminal peptide of 260 amino acids, which harbors six highly acidic subdomains, is not essential for kinase activity or sporulation but has a negative effect on either kinase activity or protein stability under certain nutritional conditions: deletion of almost the entire acidic tail has been shown to enhance sporulation efficiency on SPO plates containing glucose and to increase kinase activity in vitro (16). These observations suggest that Ime2p performs its physiological function through the phosphorylation of some unknown factors and that the C-terminal tail receives a signal to inhibit the kinase activity in the presence of nutrients.

Since Gpa2p inhibits sporulation on SPO plates containing glucose or nitrogen and interacts with the acidic tail of Ime2p, we investigated whether Gpa2p affects Ime2p kinase activity through this interaction. In vitro phosphorylation experiments were carried out with GST-Ime2p and Gpa2p purified after expression in E. coli. GST-Ime2p phosphorylated histone H1 whereas GST alone did not (Fig. 8A, lanes 1 and 2). Addition of recombinant Gpa2p loaded with GTPγS decreased Ime2p kinase activity, whereas Gpa2p loaded with GDP did not (Fig. 8A, lanes 3 and 4). Inhibition by Gpa2p was specific for Ime2p kinase activity, as Gpa2p preloaded with either GDP or GTPγS did not inhibit PKA activity (Fig. 8A, lanes 6 and 7). These data indicate that activated Gpa2p inhibits the kinase activity of Ime2p in vitro.

FIG. 8.

FIG. 8

Autoradiograms showing that Gpa2p-His6 recombinant protein bound to GTPγS inhibits Ime2p kinase activity. (A) Histone H1 phosphorylation was assayed with GST-Ime2p purified from E. coli and [γ-32P]ATP in the presence of BSA (lane 2), Gpa2p bound to GDP (lane 3), or Gpa2p bound to GTPγS (lane 4), washed free of unbound guanine nucleotides. GST was incubated under the same conditions in the presence of BSA (lane 1). As a control, histone H1 phosphorylation by PKA was assayed in the presence of either BSA (lane 5), Gpa2-GDP (lane 6), or Gpa2-GTPγS (lane 7). (B) Ime2p-His6 purified from MD211 cells transformed with pP583-IME2His6 and grown in SPO medium was assayed for histone H1 phosphorylation in the presence of either BSA (lane 2), Gpa2p bound to GDP (lane 3), or Gpa2p bound to GTPγS (lane 4). As a control, extracts from yeast cells transformed with an empty plasmid and grown in SPO medium were used (lane 1).

Autophosphorylation of Ime2p has been previously reported (16). In our experiments, GST-Ime2p was, however, not phosphorylated (data not shown), suggesting that the N-terminal fusion of GST to Ime2p inhibits autophosphorylation of Ime2p, perhaps by steric hindrance. Alternatively, phosphorylation of Ime2p may require additional components present in yeast but absent from GST-Ime2p purified from E. coli. To discriminate between these two hypotheses, Ime2p-His6 was expressed and purified from E. coli. Ime2p-His6 phosphorylated histone H1 in an in vitro assay but did not lead to autophosphorylation under the same conditions (data not shown). Ime2p-His6 was then expressed in strain MD211 grown in SPO medium. Equal amounts of purified Ime2p-His6 incubated with either BSA or Gpa2p-GDP led to phosphorylation of histone H1 (Fig. 8B, lanes 2 and 3). In contrast, phosphorylation of histone H1 was markedly impaired in the presence of Gpa2p-GTPγS (Fig. 8B, lane 4). Samples prepared from cells carrying an empty control plasmid showed no kinase activity (lane 1), demonstrating that the kinase activity correlated with Ime2p expression.

Most interestingly, Gpa2p purified from E. coli was also phosphorylated (Fig. 8B, lanes 3 and 4). This phosphorylation was specific for Ime2p purified from S. cerevisiae, as PKA did not phosphorylate Gpa2p (Fig. 8A, lanes 6 and 7). Interestingly, phosphorylation of Gpa2p did not occur with GST-Ime2p or His6-Ime2p purified from E. coli (Fig. 8A and data not shown), suggesting that modification of Ime2p in yeast is necessary to perform this function. Alternatively, a component required could be absent when Ime2p is expressed in E. coli. We could not detect phosphorylation of bands corresponding to the molecular size of Ime2p, suggesting that Ime2p is also not autophosphorylated when isolated from yeast extracts. These results, which are in conflict with a previous report (16), could be due to different experimental procedures. Taken together, these results show that binding of the GTP-loaded form of Gpa2p to the C-terminal regulatory domain of Ime2p inhibits its kinase activity. Moreover, phosphorylation of Gpa2p by Ime2p suggests a feedback regulation on Gpa2p.

DISCUSSION

The G-protein α subunit Gpa2p has previously been shown to play a positive role in signaling pseudohyphal development (17, 19). Here we report that in addition to signaling pseudohyphal development, Gpa2p represses sporulation. Furthermore, Gpa2p interacts with the C-terminal regulatory domain of Ime2p, a protein kinase essential for spore formation, thereby regulating its activity.

Ime2p has been identified as a specific interaction partner of Gpa2p in the yeast two-hybrid system. Ime2p is a serine/threonine protein kinase of the CLK (Cdk-like kinase) subfamily and consists of two domains, an N-terminal kinase domain and an acidic C-terminal regulatory domain of about 260 amino acids (13). Both the regulatory C-terminal domain of Ime2p and the complete protein are able to interact with Gpa2p in the screen. Furthermore, using a constitutively active or inactive allele of GPA2, we show that the active conformation of Gpa2p associates with Ime2p whereas its inactive conformation does not. Similar results are obtained with the proteins purified from E. coli or S. cerevisiae in copurification experiments. GST-Ime2p purified from E. coli interacts more efficiently with Gpa2p bound to GTP than with Gpa2p bound to GDP. In contrast, when expressed alone in yeast, the acidic tail of Ime2p binds to Gpa2p independently of its GTP/GDP status. This latter observation explains why only overlapping clones bearing the C-terminal domain of Ime2p were isolated in the two-hybrid screen. Taken together, our data demonstrate that Gpa2p and Ime2p physically interact in yeast cells and that the GTP charge on Gpa2p is essential for this interaction.

The acidic tail of Ime2p has been shown to negatively regulate the kinase domain of Ime2p: removal of the C-terminal regulatory domain increases kinase activity in vitro (16). Direct protein-protein interactions with regulatory domains of protein kinases have previously been reported to be required for proper signaling (6, 32, 32, 37). We show here that GTP-bound Gpa2p inhibits Ime2p kinase activity whereas GDP-bound Gpa2p does not. This inhibition is specific for Ime2p kinase activity, as Gpa2p had no effect on PKA activity. Furthermore, Gpa2p is specifically phosphorylated by Ime2p, whereas it is not a substrate of PKA. It is conceivable that Ime2p modulates the activity or the location of the Gpa2p. These observations indicate that the active form of Gpa2p inhibits Ime2p kinase activity by interacting with the regulatory domain of Ime2p and suggest a feedback regulation of Ime2p on Gpa2p.

At least two signals are necessary for yeast cells to enter meiosis and sporulation. One is derived from heterozygosity at the mating-type locus; the other is produced by starvation for both nitrogen and fermentable carbon sources. The cAMP/PKA pathway signals both glucose and nitrogen proficiency in yeast. The Ras2p/cAMP pathway controls growth in response to the presence of fermentable sugar (4, 6, 34), whereas Gpa2p and cAMP are thought to be a component of the nitrogen sensing pathway (19, 20). The finding that Δgpa2/Δgpa2 Δras2/Δras2 double mutants display an additional growth defect compared to the single mutants demonstrates that Gpa2p and Ras2p have partially redundant functions (6, 23, 39). It has been demonstrated that overactivation of the Ras2/cAMP pathway in diploid cells impedes sporulation even in the absence of nitrogen and a fermentable carbon source, and it was assumed that this control was exerted via PKA. Our work provides evidence that at least part of this control is exerted through inhibition of Ime2p, the key regulator of entrance to the meiotic pathway, by its interaction with Gpa2p. Indeed, the sporulation efficiency of diploid cells expressing Ime2p from a multicopy plasmid in SPO medium containing glucose or nitrogen is 10- to 25-fold greater than that of wild-type cells. Coexpression of Gpa2p together with Ime2p reverts this effect three- to fivefold. Overexpression of Gpa2p decreases sporulation efficiency in the presence but not in the absence of nitrogen or glucose. Moreover, homozygous deletion of GPA2 allows diploid cells to sporulate in the presence of nitrogen at higher frequency than in wild-type cells. Finally, the active form of Gpa2p inhibits sporulation in a bcy1- tpk1w1 strain. This strain, which contains disruptions of the catalytic subunits TPK2, TPK3, and the regulatory subunit BCY1 and encodes a functionally attenuated allele of TPK1, lacks cAPK (5). We conclude from these observations that at least one regulatory function of Gpa2p on meiosis is independent of the cAMP fluctuation and exerted through its interaction with the regulatory domain of Ime2p as long as nitrogen or glucose is available. These results are consistent with the previous observation that the acidic tail of Ime2p inhibits sporulation under partial starvation conditions: enhancement of sporulation in SPO medium containing glucose is observed in diploid cells expressing a truncated version of Ime2p lacking the C-terminal 207 residues (16).

Previous studies have revealed that Gpa2p is involved in the transfer cascade for induction of pseudohyphal growth upon exhaustion of the nitrogen source (17, 19). We show here that overexpression of Ime2p partially inhibits formation of pseudohyphae and that the presence of acetate, a sporulation inducer, completely abolishes this developmental program. These results suggest that sporulation and pseudohyphal development are mutually exclusive pathways and in part regulated by Gpa2p and Ime2p.

Interactions between Gpa2p and Ime2p are also linked to the supply of nitrogen and correlate with inhibition of sporulation. Indeed, Gpa2p interacts with Ime2p only in yeast cells grown on SPO medium containing nitrogen, not in cells grown on SPO medium alone. Our results indicate that the presence of nitrogen in SPO medium may lead to the activation of Gpa2p by GDP-GTP exchange and triggers interaction with Ime2p to inhibit sporulation. These observation are consistent with the finding that permanently active Gpa2pR273A inhibits spore formation in SPO medium (39). Accordingly, an active Gpa2p relieves the requirement for the nitrogen signal and thereby inhibits sporulation even in SPO medium. Hence, wild-type Gpa2p is incapable of interacting with Ime2p in SPO medium without activation by nitrogen.

Gpa2p expression parallels Ime2p expression, in accord with a function in sporulation through regulation of Ime2p. On rich glucose medium, down-regulation of Ime2p activity is not required because Ime2p expression is repressed (15). Consistently, Gpa2p is expressed at low levels. Under starvation conditions, the expression of both Ime2p and Gpa2p is derepressed. After exhaustion of glucose, Ime2p is expressed through induction by IME1 but unable to allow sporulation as long as nitrogen is available. Gpa2p expression is induced about twofold under the same conditions. These findings support the idea that complete starvation for nutrients is required for sporulation to occur despite expression of Ime2p and that nitrogen inhibits sporulation-specific events downstream of Ime2p. Our data suggest that in wild-type cells, inhibition of Ime2p by Gpa2p is part of this down-regulating mechanism. This conclusion, however, does not exclude the contribution of the cAMP/PKA pathway to the regulation of meiosis and sporulation. On the contrary, the antagonistic action of Ime2p and cAMP/TPK kinases in pseudohyphal development and sporulation allows the abrupt switch from one developmental program to the other and prevents the occurrence of transition states, even under very gentle changes of solute concentration. This mechanism attributes the role of a switch between the two programs to Gpa2p.

In summary, two signals impinge on the control of sporulation: one in the presence of nitrogen or glucose through the inhibition of Ime2p kinase activity by Gpa2p, and the other through the cAMP/PKA and/or Sch9 pathway. This model is supported by the fact that inhibition of sporulation by the active GPA2R273A allele is higher than that conferred by the active RAS2 allele, which, in contrast, causes a 10-fold-higher increase in heat shock sensitivity (39). These observations demonstrate that each of the two regulators, Gpa2p and Ras2p, must have a specific target(s) in addition to adenylate cyclase (6, 19, 39). Indeed, RAS2 promotes pseudohyphal growth through the activation of the Cdc42/Ste20/mitogen-activated protein kinase cascade. Alternatively, Gpa2p does not activate this cascade but appears to modulate the cAMP pool through an as yet unknown mechanism (17, 19, 23). It is still unclear whether, similarly to the mammalian Gαs subunit, Gpa2p activates adenylate cyclase directly or indirectly (6, 19). Thus, Gpa2p interacts with different effectors under partial nutritional stress conditions to induce pseudohyphal development by activation of the cAMP/PKA and Sch9 pathways in cooperation with Ras2p. Simultaneously, Gpa2p prevents sporulation in part via inhibition of Ime2p kinase activity. The decision between the two alternatives is made through the availability of glucose. Glucose activates Ras2p and cAMP-dependent pathways and represses expression of IME1 and IME2. Thus, activation of the filamentous growth pathway excludes entrance to meiosis through the cooperation of both regulators Gpa2p and Ras2p. Further studies should focus on the identification of the βγ subunits of the presumptive Gpa2p-containing trimeric G protein and their targets as well as their possible roles in Gpa2p-dependent signaling.

ACKNOWLEDGMENTS

We thank T. Haertel, Munich, Germany, for providing strains TH101 and TH102; J. M. Thevelein, Heverlee, Belgium, for sending strain RS13-58A-1 bcy1- tpk1w1; W. Seufert, Stuttgart-Hohenheim, Germany, for plasmid pW9420; K. Matsumoto, Nagoya, Japan, for plasmid pG0304; and J. Heitman for plasmids pML160 and pML179. We gratefully acknowledge L. Van Dyck for critical reading of the manuscript.

The work was supported by a grant from the Deutsche Forschungsgemeinschaft to W.B.

REFERENCES

  • 1.Bardwell L, Cook J G, Inouye C J, Thorner J. Signal propagation and regulation in mating pheromone response pathway of the yeast Saccharomyces cerevisiae. Dev Biol. 1994;166:363–379. doi: 10.1006/dbio.1994.1323. [DOI] [PubMed] [Google Scholar]
  • 2.Bowdish K S, Mitchell A P. Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol Cell Biol. 1993;13:2172–2181. doi: 10.1128/mcb.13.4.2172-2181.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bradford M M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 4.Broach J R. Ras-regulated signaling processes in Saccharomyces cerevisiae. Curr Opin Genet Dev. 1991;1:370–377. doi: 10.1016/s0959-437x(05)80302-8. [DOI] [PubMed] [Google Scholar]
  • 5.Cameron S, Levin L, Zoller M, Wigler M. cAMP-independent control of sporulation, glycogen metabolism, and heat shock resistance in S. cerevisiae. Cell. 1988;53:555–566. doi: 10.1016/0092-8674(88)90572-7. [DOI] [PubMed] [Google Scholar]
  • 6.Colombo S, Ma P, Cauwenberg L, Winderickx J, Crauwels M, Teunissen A, Nauwelaers D, de Winde J H, Gorwa M F, Colavizza D, Thevelein J M. Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae. EMBO J. 1998;17:3326–3341. doi: 10.1093/emboj/17.12.3326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Crivellone M D, Wu M A, Tzagoloff A. Assembly of the mitochondrial membrane system: analysis of structural mutants of the yeast coenzyme QH2-cytochrome c reductase complex. J Biol Chem. 1988;263:14323–14333. [PubMed] [Google Scholar]
  • 8.Exton J H. Cell signaling through guanine-nucleotide-binding regulatory proteins (G proteins) and phospholipases. Eur J Biochem. 1997;243:10–20. doi: 10.1111/j.1432-1033.1997.t01-1-00010.x. [DOI] [PubMed] [Google Scholar]
  • 9.Fields S, Song O K. A novel genetic system to detect protein-protein interactions. Nature. 1989;340:245–246. doi: 10.1038/340245a0. [DOI] [PubMed] [Google Scholar]
  • 10.Frangioni J V, Neel B G. Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal Biochem. 1993;210:179–187. doi: 10.1006/abio.1993.1170. [DOI] [PubMed] [Google Scholar]
  • 11.Guarente L, Ptashne M. Fusion of Escherichia coli LacZ to the cytochrome c gene of Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 1981;78:2199–2203. doi: 10.1073/pnas.78.4.2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hoffman C S, Winston F. A ten minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of E. coli. Gene. 1983;57:257–272. doi: 10.1016/0378-1119(87)90131-4. [DOI] [PubMed] [Google Scholar]
  • 13.Hunter T, Plowman G D. The protein kinases of budding yeast: six scores and more. Trends Biochem Sci. 1997;22:18–22. doi: 10.1016/s0968-0004(96)10068-2. [DOI] [PubMed] [Google Scholar]
  • 14.Ito H, Fukuda Y, Murata K, Kimura A. Transformation of intact yeast cells treated with alkali cations. J Bacteriol. 1983;153:163–168. doi: 10.1128/jb.153.1.163-168.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kawaguchi H, Yoshida M, Yamashita I. Nutritional regulation of meiosis-specific gene expression in Saccharomyces cerevisiae. Biosci Biotechnol Biochem. 1992;56:289–297. [Google Scholar]
  • 16.Kominami K I, Sakata Y, Sakai M, Yamashita I. Protein kinase activity associated with the IME2 gene product, a meiotic inducer in the yeast Saccharomyces cerevisiae. Biosci Biotechnol Biochem. 1993;57:1731–1735. doi: 10.1271/bbb.57.1731. [DOI] [PubMed] [Google Scholar]
  • 17.Kübler E, Mösch H U, Rupp S, Lisanti M P. Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via cAMP-dependent mechanism. J Biol Chem. 1997;272:20321–20323. doi: 10.1074/jbc.272.33.20321. [DOI] [PubMed] [Google Scholar]
  • 18.Kurjan J. The pheromone response pathway in Saccharomyces cerevisiae. Annu Rev Genet. 1993;27:147–179. doi: 10.1146/annurev.ge.27.120193.001051. [DOI] [PubMed] [Google Scholar]
  • 19.Lorenz M C, Heitman J. Yeast pseudohyphal growth is regulated by GPA2, a G protein α homologue. EMBO J. 1997;16:7008–7018. doi: 10.1093/emboj/16.23.7008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lorenz M C, Heitman J. Regulators of pseudohyphal differentiation in Saccharomyces cerevisiae identified through multicopy suppressor analysis in ammonium permease mutant strains. Genetics. 1998;150:1443–1457. doi: 10.1093/genetics/150.4.1443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mitchell A P, Driscoll S E, Smith H E. Positive control of sporulation-specific genes by the IME1 and IME2 products in Saccharomyces cerevisiae. Mol Cell Biol. 1990;10:2104–2110. doi: 10.1128/mcb.10.5.2104-2110.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Miyajima I, Nakafuku M, Nakayama N, Brenner C, Miyajima A, Kaibuchi K, Arai K I, Kaziro Y, Matsumoto K. GPA1, a haploid-specific essential gene, encodes a yeast homologue of mammalian G protein which may be involved in mating factor signal transduction. Cell. 1987;50:1011–1019. doi: 10.1016/0092-8674(87)90167-x. [DOI] [PubMed] [Google Scholar]
  • 23.Mösch H-U, Roberts R L, Fink G R. Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 1996;93:5352–5356. doi: 10.1073/pnas.93.11.5352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nakafuku M, Obara T, Kaibuchi K, Miyajima I, Miyajima A, Itoh H, Nakamura S, Arai K I, Matsumoto K, Kaziro Y. Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions. Proc Natl Acad Sci USA. 1988;85:1374–1378. doi: 10.1073/pnas.85.5.1374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Neer J E. Heterotrimeric G proteins: organizers of transmembrane signals. Cell. 1995;80:249–257. doi: 10.1016/0092-8674(95)90407-7. [DOI] [PubMed] [Google Scholar]
  • 26.Papasavvas S, Arkinstall S, Reid J, Payton M. Yeast a-mating factor receptor and G-protein-linked adenylyl cyclase inhibition requires RAS2 and GPA2 activities. Biochem Biophys Res Commun. 1992;184:1373–1385. doi: 10.1016/s0006-291x(05)80035-x. [DOI] [PubMed] [Google Scholar]
  • 27.Proft M, Kötter P, Hedges D, Bojunga N, Entian K-D. CAT5, a new gene necessary for derepression of gluconeogenetic enzymes in Saccharomyces cerevisiae. EMBO J. 1995;14:6116–6126. doi: 10.1002/j.1460-2075.1995.tb00302.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rothstein R J. One-step disruption in yeast. Methods Enzymol. 1983;101:202–211. doi: 10.1016/0076-6879(83)01015-0. [DOI] [PubMed] [Google Scholar]
  • 29.Schricker R, Magdolen V, Kaniak A, Wolf K, Bandlow W. The adenylate kinase family in yeast: identification of URA6 as a multicopy suppressor of deficiency in major AMP kinase. Gene. 1992;122:111–118. doi: 10.1016/0378-1119(92)90038-q. [DOI] [PubMed] [Google Scholar]
  • 30.Sikorski R S, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. doi: 10.1093/genetics/122.1.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Smith H E, Mitchell A P. A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae. Mol Cell Biol. 1989;9:2142–2152. doi: 10.1128/mcb.9.5.2142-2152.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Soler M, Plovins A, Martin H, Molina M, Nombela C. Characterization of domains in the yeast MAP kinase Slt2 (Mkp1) required for functional activity and in vivo interaction with protein kinases Mkk1 and Mkk2. Mol Microbiol. 1995;17:833–842. doi: 10.1111/j.1365-2958.1995.mmi_17050833.x. [DOI] [PubMed] [Google Scholar]
  • 33.Su Y-C, Han J, Xu S, Cobb M, Skolnik E Y. NIK is a new Ste20-related kinase that binds NCK and MEKK1 and activates the SAPK/JNK cascade via a conserved regulatory domain. EMBO J. 1997;16:1279–1290. doi: 10.1093/emboj/16.6.1279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Thevelein J M. Signal transduction in yeast. Yeast. 1994;10:1753–1790. doi: 10.1002/yea.320101308. [DOI] [PubMed] [Google Scholar]
  • 35.Toda T, Uno I, Ishikawa T, Powers S, Kataoka T, Broek D, Cameron S, Broach J, Matsumoto K, Wigler M. In yeast, RAS are controlling elements of adenylate cyclase. Cell. 1985;40:27–36. doi: 10.1016/0092-8674(85)90305-8. [DOI] [PubMed] [Google Scholar]
  • 36.Tu H, Barr M, Dong D L, Wigler M. Multiple regulatory domains on the Byr2 protein kinase. Mol Cell Biol. 1997;17:5876–5887. doi: 10.1128/mcb.17.10.5876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Vernet T, Digrand D, Thomas M. A family of yeast expression vectors containing the phage f1 intergenic region. Gene. 1987;52:225–233. doi: 10.1016/0378-1119(87)90049-7. [DOI] [PubMed] [Google Scholar]
  • 38.Whiteway M, Hougan L, Dignard D, Thomas D Y, Bell L, Saari G C, Grant F J, O’Hara P, Mackay V L. The STE4 and STE18 genes of yeast encode potential β and γ subunits of the mating factor receptor-coupled G protein. Cell. 1989;56:467–477. doi: 10.1016/0092-8674(89)90249-3. [DOI] [PubMed] [Google Scholar]
  • 39.Xue Y, Batlle M, Hirsch J P. GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p Gα subunit and functions in a Ras-independent pathway. EMBO J. 1998;17:1996–2007. doi: 10.1093/emboj/17.7.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yoshida M, Kawaguchi H, Sakata Y, Kominami K I, Hirano M, Shima H, Akada R, Yamashita I. Initiation of meiosis and sporulation in Saccharomyces cerevisiae requires a novel protein kinase homologue. Mol Gen Genet. 1990;221:176–186. doi: 10.1007/BF00261718. [DOI] [PubMed] [Google Scholar]
  • 41.Yun C W, Tamaki H, Nakayama R, Yamamoto K, Kumagai H. G-protein coupled receptor from yeast Saccharomyces cerevisiae. Biochem Biophys Res Commun. 1997;240:280–292. doi: 10.1006/bbrc.1997.7649. [DOI] [PubMed] [Google Scholar]
  • 42.Yun C W, Tamaki H, Nakayama R, Yamamoto K, Kumagai H. Gpr1, a putative G-protein coupled receptor, regulates glucose-dependent cellular cAMP level in yeast Saccharomyces cerevisiae. Biochem Biophys Res Commun. 1998;252:29–33. doi: 10.1006/bbrc.1998.9600. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES