Abstract
α-rhamnrtin-3-α-rhamnoside (ARR) is the principal compound extracted from Loranthus tanakae Franch. & Sav. However, its underlying pharmacological properties remain undetermined. Inflammation is a defense mechanism of the body; however, the excessive activation of the inflammatory response can result in physical injury. The present study aimed to investigate the effects of ARR on lipopolysaccharide (LPS)-induced RAW264.7 macrophages and to determine the underlying molecular mechanism. A Cell Counting Kit-8 assay was performed to assess cytotoxicity. Nitric oxide (NO) production was measured via a NO colorimetric kit. Levels of prostaglandin E2 (PGE2) and proinflammatory cytokines, IL-1β and IL-6, were detected using ELISAs. Reverse transcription-quantitative (RT-q)PCR analysis was performed to detect the mRNA expression levels of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), IL-6 and IL-1β in LPS-induced RAW246.7 cells. Western blotting, immunofluorescence and immunohistochemistry analyses were performed to measure the expression levels of NF-κB and nuclear factor-erythroid 2-related factor 2 (Nrf2) signaling pathway-related proteins to elucidate the molecular mechanisms of the inflammatory response. The results of the cytotoxicity assay revealed that doses of ARR ≤200 µg/ml exhibited no significant effect on the viability of RAW264.7 cells. The results of the Griess assay demonstrated that ARR inhibited the production of NO. In addition, the results of the ELISAs and RT-qPCR analysis discovered that ARR reduced the production of the proinflammatory cytokines, IL-1β and IL-6, as well as the proinflammatory mediators, PGE2, iNOS and COX-2, in LPS-induced RAW264.7 cells. Immunohistochemical analysis demonstrated that ARR inhibited LPS-induced activation of TNF-associated factor 6 (TRAF6) and NF-κB p65 signaling molecules, while reversing the downregulation of the NOD-like receptor family CARD domain containing 3 (NLRC3) signaling molecule, which was consistent with the results of the western blotting analysis. Immunofluorescence results indicated that ARR reduced the increase of NF-κB p65 nuclear expression induced by LPS. Furthermore, the results of the western blotting experiments also revealed that ARR upregulated heme oxygenase-1, NAD(P)H quinone dehydrogenase 1 and Nrf2 pathway molecules. In conclusion, the results of the present study suggested that ARR may exert anti-inflammatory effects by downregulating NF-κB and activating Nrf2-mediated inflammatory responses, suggesting that ARR may be an attractive anti-inflammatory candidate drug.
Keywords: α-rhamnrtin-3-α-rhamnoside, RAW264.7 cells, inflammatory response, NF-κB and nuclear factor-erythroid 2-related factor 2 signaling pathway
Introduction
Inflammation is the body's defense response against various damage factors, including bacteria, viruses and tissue damage, and regulated inflammatory responses play a vital role in coping with pathogens and preventing tissue damage (1). However, abnormal inflammatory responses can facilitate the progression of a wide range of types of disease, including rheumatoid arthritis, chronic hepatitis, Alzheimer's disease, inflammatory bowel disease and cancer (2,3). Thus, effective control of inflammatory responses is pivotal for the prevention and treatment of several diseases, including cancer (3). Inflammatory diseases are complex and difficult to cure, thus inflammatory models are used to screen for anti-inflammatory drugs. For example, the lipopolysaccharide (LPS)-induced inflammatory response model is widely used in inflammation research (4–6).
NF-κB is an important, multi-directional, functional regulator of the anti-inflammatory response (7). The main method for preventing chronic inflammation-mediated disorders is to regulate the secretion of proinflammatory cytokines (8). The production or secretion of proinflammatory cytokines results in the activation of NF-κB, which in turn stimulates several transcription factors that control the gene expression of proinflammatory cytokines, including ILs, inducible nitric oxide synthase (iNOS) and cyclooxygenease-2 (COX-2) (9). The activation of NF-κB also plays an indispensable role in the development of several types of disease, including rheumatoid arthritis, inflammatory bowel disease and autoimmunity, as well as diseases comprising a significant inflammatory component, such as cancer and atherosclerosis (10).
TNF-associated factor 6 (TRAF6) is a key regulator of NF-κB and plays an important regulatory role in inflammation (11). NOD-like receptor family CARD domain containing 3 (NLRC3) has been found to exert inhibitory effects on proinflammatory signaling transduction, the ubiquitination of TRAF6 and nuclear translocation of NF-κB p65 (12). In addition, NLRC3 was discovered to inhibit a major inflammatory pathway controlled by NF-κB, which directly interacts with TRAF6 and forms a new protein complex called the ‘TRAFasome’ (13).
Nuclear factor-erythroid 2-related factor 2 (Nrf2) is a pivotal and significant transcription factor, which controls several antioxidant enzymes including heme oxygenase-1 (HO-1) and NAD(P)H quinone dehydrogenase 1 (NQO1) (14). HO-1 plays a key role in the antioxidant processes and suppressing the immune response (15). Nrf2, coupled with its target genes to act as an inflammation regulatory system, has been reported to downregulate the expression levels of several proinflammatory cytokines, which could antagonize NF-κB activation (16,17).
Loranthus tanakae Franch. & Sav, which grows on the trees of Quercus L. and Betula, has been found to have various biological properties, including anti-microbial, antitumor and antioxidant effects (18). It has been reported that its methanol extracts possess various antitumor activities (19). Natural products represent novel compounds that have been shown to prevent different types of disease, such as cancer, infectious diseases and cardiovascular diseases (20). Epigallocatechin, curcumin and other natural phenolic compounds have been established to possess anti-inflammatory and antioxidant activities (21–23). α-rhamnrtin-3-α-rhamnoside (ARR; Fig. 1A), a phenolic flavonoid compound, is the main active ingredient of Loranthus tanakae Franch. & Sav (24). However, to the best of our knowledge, the pharmacological activities and anti-inflammatory molecular mechanisms of ARR remain unknown. Thus, the present study aimed to investigate the anti-inflammatory effect of ARR in RAW264.7 cells to determine whether it occurred via the NF-κB and Nrf2 signaling pathway. In addition, the study sought to elucidate its underlying molecular mechanism of action to provide a preliminary basis for the development of ARR into an anti-inflammatory drug.
Figure 1.
ARR inhibits the inflammatory response. (A) ARR is a flavonoid compound extracted from the Loranthus tanakae Franch. & Sav. (B) RAW264.7 cells were treated with different concentrations of ARR (0, 5, 10, 20, 40, 80, 100 or 200 µg/ml) for 24 h. A Cell Counting Kit-8 assay was performed to assess cell viability. RAW264.7 cells were pretreated with different concentrations of ARR (0, 25, 50 or 100 µg/ml) or Indo (positive control, 8 µg/ml) at 37°C for 2 h, and incubated with or without LPS (100 ng/ml) at 37°C for 24 h. (C) Levels of NO in the culture media were determined using a NO colorimetric assay kit. The effect of ARR on (D) IL-6, (E) IL-1β and (F) PGE2 cytokine production was detected using ELISA kits. Data are presented as the mean ± SD. #P<0.05, ##P<0.01 vs. untreated control group; *P<0.05, **P<0.01 vs. LPS group. ARR, α-rhamnrtin-3-α-rhamnoside; Indo, indomethacin; LPS, lipopolysaccharide; NO, nitric oxide; PGE2, prostaglandin E2.
Materials and methods
Reagents and chemicals
ARR (purity >95%) was isolated from Loranthus tanakae Franch. & Sav. in our laboratory, as previously described (21). The structure of ARR was elucidated by nuclear magnetic resonance. LPS and indomethacin (Indo) were purchased from Sigma-Aldrich; Merck KGaA. DMEM, FBS and penicillin-streptomycin were purchased from Gibco; Thermo Fisher Scientific, Inc. Primary rabbit monoclonal antibodies, including NF-κB p65 (cat. no. ab16502), phosphorylated-(p)-NF-κB-p65 (cat. no. ab76302), Nrf2 (cat. no. ab92946), NQO1 (cat. no. ab80588), HO-1 (cat. no. ab13243), TRAF6 (cat. no. ab137452), β-actin (cat. no. ab8227) and Histone H3 (cat. no. ab1791) were purchased from Abcam and the NLRC3 antibody (cat. no. DF13411) was obtained from Affinity Biosciences. The nitric oxide (NO) colorimetric kit (cat. no. E-BC-K035-M) and the cytokine mouse ELISA kits specific for prostaglandin E2 (PGE2; cat. no. E-EL-0034c), IL-6 (cat. no. E-EL-M0044c) and IL-1β (cat. no. E-EL-M0037c) were purchased from Elabscience.
Cell lines and culture
Leukemia cells from mouse mononuclear macrophages (RAW264.7; cat. no. CL-0190) were obtained from Procell Life Science & Technology Co. Ltd., and cultured in DMEM supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin, at 37°C with 5% CO2.
Cell viability assay
A Cell Counting Kit-8 (CCK-8) assay (which uses WST-8 for the colorimetric reaction) was performed to assess cell viability. Briefly, RAW264.7 macrophages (4×104 cells/ml) were seeded into 96-well plates (100 µl/well) and treated with different concentrations of ARR (5, 10, 20, 40, 80, 100 or 200 µg/ml) for 24 h at 37°C. Following the incubation, 10 µl CCK-8 reagent (Sigma-Aldrich; Merck KGaA) was added to each well and incubated for an additional 2 h at 37°C. In the presence of the electronic coupling reagent, 1-Methoxy PMS, WST-8 was transformed to orange-yellow water-soluble formazan. The optical density was determined using a microplate reader at a wavelength of 450 nm.
NO assay
For the NO assay, 1×106/ml RAW264.7 macrophages were seeded into 6-well plates. Following incubation for 24 h with different concentrations of ARR (0, 25, 50 and 100 µg/ml) or the positive control drug, Indo (8 µg/ml; commonly used to treat inflammation) for 2 h, LPS (100 ng/ml) was added, and cells were incubated for an additional 24 h. According to the manufacturer's instructions, reagents were added into each well and cells were incubated at 37°C for 30 min in the dark. The absorbance was measured using a microplate reader at a wavelength of 550 nm. The dosage of ARR used was determined according to the preliminary experiments (data not shown), and the dosage of LPS was selected based on our previous study (25).
ELISA
The levels of the cytokines, IL-6, IL-1β and PGE2, in the macrophage supernatants (obtained by centrifugation at 1,000 × g at room temperature for 5 min) from each group were determined using IL-6, IL-1β and PGE2 ELISA kits, according to the manufacturer's instructions. The absorbance was measured using a microplate reader at a wavelength of 450 nm.
Reverse transcription-quantitative (RT-q)PCR
Total RNA was extracted from RAW264.7 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and the quality and concentration of the isolated RNA were determined using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Inc.). First-strand cDNA was synthesized using an RT-qPCR synthesis kit (cat. no. AT311; Beijing TransGen Biotech Co., Ltd.), according to the manufacturer's protocol. Relative expression levels of IL-6, IL-1β, COX-2, iNOS and GAPDH were determined using a PerfectStart™ Green qPCR SuperMix (Beijing TransGen Biotech Co., Ltd.). The following thermocycling conditions were used for the qPCR: Initial denaturation at 94°C for 30 sec; followed by 45 cycles at 94°C for 5 sec and 60°C for 30 sec. The mRNA expression levels of IL-6, IL-1β, COX-2 and iNOS were calculated using the 2−ΔΔCq method (26) and normalized to GAPDH. The primer sequences used for the qPCR are listed in Table I.
Table I.
Primer sequences used for reverse transcription-quantitative PCR.
| Gene | Primer sequence (5′→3′) |
|---|---|
| IL-6 | F: GAGTCCTTCAGAGAGATACAG |
| R: CTGTGACTCCAGCTTATCTG | |
| IL-1β | F: AAATACCTGTGGCCTTGGGC |
| R: CTTGGGATCCACACTCTCCAG | |
| COX-2 | F: GAAGATTCCCTCCGGTGTTT |
| R: CCCTTCTCACTGGCTTATGTAG | |
| iNOS | F: GCTTGGGTCTTGTTCACTCC |
| R: GGCCTTGTGGTGAAGAGTGT | |
| GAPDH | F: CCTTCCGTGTTCCTACCCCC |
| R: AGCCCAAGATGCCCTTCAGT |
COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; F, forward; R, reverse.
Western blotting
Total protein was extracted from RAW264.7 cells using a Whole Cell Lysis assay (Nanjing KeyGen Biotech Co., Ltd.). Total nuclear and cytoplasmic proteins were extracted using the Nuclear and Cytoplasmic Protein Extraction kit (Nanjing KeyGen Biotech Co., Ltd.). Protein concentration was measured using a BCA protein assay kit (Nanjing KeyGen Biotech Co., Ltd.) and 20 µg protein/lane was separated via 10% SDS-PAGE. The separated proteins were subsequently transferred onto PVDF membranes and blocked with 5% BSA (Thermo Fisher Scientific, Inc.) at room temperature for 1 h. The membranes were then incubated overnight at 4°C with primary antibodies against NF-κB p65 (1:1,000), p-NF-κB p65 (1:1,000), Nrf2 (1:1,000), HO-1 (1:1,000), NQO1 (1:1,000), NLRC3 (1:1,000), TRAF6 (1:1,000), β-actin (1:2,000) or Histone H3 (1:2,000). Following the primary antibody incubation, the membranes were incubated with an HRP-conjugated anti-rabbit secondary antibody (Abcam; cat. no. ab6721; 1:5,000) at room temperature for 1 h. The membranes were washed multiple times with TBS-Tween-20 buffer and the protein bands were visualized using enhanced chemiluminescence reagent (cat. no. G2020; Wuhan Servicebio Technology Co., Ltd.) and a chemiluminescence imaging system (Bio-Rad Laboratories, Inc.). Densiometric analysis was performed using Image Lab software (version 6.0; Bio-Rad Laboratories, Inc.).
Immunofluorescence staining
RAW264.7 cells (1×105/ml) were seeded onto glass coverslips, plated into the bottom of 6-well plates and fixed with 4% paraformaldehyde at room temperature for 15 min. Cells were subsequently permeabilized with 0.1% Triton X-100 and blocked with 10% goat serum (Elabscience) at room temperature for 30 min. Cells were then incubated with a rabbit anti-NF-κB p65 antibody (1:1,000) at 37°C for 1 h and Cy3-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Elabscience; cat. no. E-IR-R321; 1:5,000) at 37°C for 1 h. Nuclei were stained with DAPI (Pierce; Thermo Fisher Scientific, Inc.) at 37°C for 5 min, and a drop of anti-fluorescence quenching mounting solution was added prior to visualization using a fluorescence microscope (magnification, ×400). Analysis was performed using ImageJ software (version 1.80; National Institutes of Health).
Immunohistochemistry staining
Immunohistochemistry analysis was performed as previously described (22). The primary antibodies used were as follows: Anti-NLRC3 (1:500), anti-TRAF6 (1:500) and anti-NF-κB p65 (1:500), and an HRP-conjugated anti-rabbit antibody was used as the secondary antibody (Abcam; cat. no. ab6721; 1:500). Following the antibody incubations, all samples were stained with DAB at room temperature for 2 min. Samples were observed using a fluorescence microscope (magnification, ×400) and quantified using ImageJ software.
Statistical analysis
All experiments were repeated at least three times. Statistical analyses were performed using SPSS software (version 26.0; IBM Corp.) and GraphPad Prism software (version 6.0; GraphPad Software, Inc.). Data are presented as the mean ± SD. Significant differences between groups were determined using a one-way ANOVA followed by a Tukey's or Dunnett's T3 post hoc test. P<0.05 was considered to indicate a statistically significant difference.
Results
Effect of ARR on viability in LPS-stimulated RAW 264.7 cells
To investigate the effect of ARR on cell viability, RAW264.7 cells were incubated with 0–200 µg/ml ARR for 24 h. As presented in Fig. 1B, 5–200 µg/ml ARR exerted no significant effect on the viability of RAW264.7 cells. Thus, doses of 25–100 µg/ml ARR were used for subsequent experimentation. The doses of ARR were used according to our prior trial (data not shown).
Effect of ARR on inflammatory mediators in LPS-stimulated RAW264.7 cells
As the LPS-induced inflammatory response model is widely used in inflammation research of anti-inflammatory drugs (4–6), the present study established an LPS-induced inflammatory response model in RAW264.7 cells to evaluate the anti-inflammatory effect of ARR. Following incubation with LPS, NO expression was significantly increased compared with the control group; however, the addition of ARR at all doses significantly suppressed the LPS-induced secretion of NO (Fig. 1C). Among them, the high dose of ARR (100 µg/ml) exhibited the strongest inhibitory effect. These results suggested that ARR markedly suppresses NO production in RAW264.7 cells.
IL-6, IL-1β and PGE2 are critical inflammatory cytokines involved in mediating inflammatory responses (27); thus, in the present study, the expression levels of IL-6, IL-1β and PGE2 were detected in RAW264.7 cell supernatants using ELISA kits. As presented in Fig. 1D-F, LPS significantly upregulated the levels of IL-6, IL-1β and PGE2 compared with the control group, while ARR treatment significantly decreased the expression levels of the three inflammatory cytokines compared with the LPS group. Taken together, these results suggested that ARR may exert anti-inflammatory effects by inhibiting the release of IL-6, IL-1β and PGE2. In addition, the anti-inflammatory effect of ARR seems to occur in a dose-dependent manner, and works best at a concentration of 100 µg/ml.
Effect of ARR on the gene transcription of proinflammatory factors in LPS-stimulated RAW264.7 cells
To determine whether the regulation of inflammatory factors by ARR occurred at the mRNA level, the expression levels of various inflammatory factors were detected via RT-qPCR analysis. As presented in Fig. 2A-D, LPS significantly upregulated the mRNA expression levels of iNOS, IL-6, IL-1β and COX-2 compared with the control group. Compared with the LPS group, the mRNA levels of inflammatory factors, iNOS, IL-6, IL-1β and COX-2 (except 25 µg/ml ARR treatment), were significantly downregulated following the addition of ARR, whereby the effects of ARR were most notable at 100 µg/ml. These findings are consistent with the ELISA results, suggesting that ARR may exert an anti-inflammatory effect by inhibiting the expression of several inflammatory factors at both the mRNA and protein levels.
Figure 2.
ARR decreases the levels of proinflammatory factors. RAW264.7 cells were pretreated with different concentrations of ARR (0, 25, 50 or 100 µg/ml) or Indo (positive control, 8 µg/ml) for 2 h, and incubated with or without LPS (100 ng/ml) for 24 h. Reverse transcription-quantitative PCR analysis was performed to detect the mRNA expression levels of (A) iNOS, (B) IL-6, (C) IL-1β and (D) COX-2. Data are presented as the mean ± SD. (n=3). ##P<0.01 vs. untreated control group; *P<0.05, **P<0.01 vs. LPS group. ARR, α-rhamnrtin-3-α-rhamnoside; Indo, indomethacin; LPS, lipopolysaccharide; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.
Effect of ARR on the Nrf2 signaling pathway in LPS-stimulated RAW264.7 cells
The effect of ARR on the Nrf2 signaling pathway in LPS-stimulated RAW264.7 cells was also investigated. The western blotting results demonstrated that, compared with the control group, LPS significantly upregulated the expression levels of NQO1, while the expression levels of Nrf2 and HO-1 were not significantly altered. Treatment with ARR notably induced the expression levels of Nrf2 protein and its target molecule, HO-1, compared with the LPS group (Fig. 3D-F). Taken together, these results suggest that ARR can also exert anti-inflammatory effects via the Nrf2 signaling pathway.
Figure 3.
ARR inhibits the NF-κB signaling pathway and activates the Nrf2 signaling pathway. RAW264.7 cells were treated with ARR (100 µg/ml) or Indo (positive control, 8 µg/ml) at 37°C for 24 h, with or without LPS (100 ng/ml). The protein expression levels of (A) total NF-κB p65 and p-NF-κB p65, (B) NF-κB p65 in the nucleus, (C) NF-κB p65 in the cytosol, (D) Nrf2, (E) HO-1 and (F) NQO1 were detected using western blotting and semi-quantified using Image Lab software. LPS represents proteins from the 100 ng/ml LPS-treated group. Data are presented as the mean ± SD. ##P<0.01 vs. control group; *P<0.05, **P<0.01 vs. LPS group. ARR, α-rhamnrtin-3-α-rhamnoside; Nrf2, nuclear factor-erythroid 2-related factor 2; Indo, indomethacin; LPS, lipopolysaccharide; HO-1, heme oxygenase-1; NQO1, NAD(P)H quinone dehydrogenase 1; p-, phosphorylated.
Effect of ARR on NF-κB p65 translocation in LPS-stimulated RAW264.7 cells
NF-κB is a well-known transcription factor that is involved in the inflammatory response (28). Western blotting analysis was performed to detect the phosphorylation of p65 and translocation of NF-κB p65 to the nucleus. LPS significantly increased the phosphorylation of NF-κB p65 compared with the control group, while the addition of ARR significantly suppressed the phosphorylation of NF-κB p65 in RAW264.7 cells (Fig. 3A). Stimulation with LPS also induced the translocation of NF-κB p65 to the nucleus (Fig. 3B-C). However, addition of ARR significantly suppressed LPS-induced NF-κB p65 nuclear translocation of RAW264.7 macrophages. Similar results for NF-κB p65 nuclear translocation were observed via immunofluorescence microscopy. As expected, LPS markedly increased NF-κB p65 nuclear translocation compared with the control group (Fig. 4). Notably, ARR markedly suppressed the nuclear translocation of NF-κB p65 compared with the LPS group. Taken together, these results suggested that ARR may exert anti-inflammatory effects by inhibiting NF-κB p65 translocation.
Figure 4.
ARR blocks NF-κB p65 nuclear translocation. RAW264.7 cells were treated with ARR (100 µg/ml) or Indo (positive control, 8 µg/ml) at 37°C for 24 h, with or without LPS (100 ng/ml). The nuclear translocation of NF-κB p65 was detected using immunofluorescence microscopy (magnification, ×400; scale bar, 100-µm). Indo, ARR, α-rhamnrtin-3-α-rhamnoside; Indo, indomethacin.
Effect of ARR on NLRC3, TRAF6 and NF-κB p65 protein expression in LPS-stimulated RAW264.7 cells
To further investigate the effect of ARR on the NF-κB signaling pathway, immunohistochemistry staining and western blotting were performed to determine the expression levels of NLRC3, TRAF6 and NF-κB p65 in RAW264.7 cells. Treatment with LPS did not significantly affect NLRC3 expression, while the expression levels of TRAF6 and NF-κB p65 were upregulated compared with the control group (Fig. 5A-D). However, NLRC3 expression was markedly upregulated following the addition of ARR, while the expression levels of TRAF6 and NF-κB p65 were downregulated compared with the LPS group. Taken together, these results suggested that ARR may significantly upregulate NLRC3 and downregulate TRAF6 and NF-κB p65 expression levels in the inflammatory response.
Figure 5.
ARR downregulates the protein expression of TRAF6 and NF-κB p65 by increasing the content of NLRC3 protein molecules. (A) Expression levels of NLRC3, TRAF6 and NF-κB p65 in LPS-stimulated RAW264.7 cells were detected using immunohistochemistry staining (magnification, ×400; scale bar, 200-µm). The mean optical density values of (B) NLRC3, (C) TRAF6 and (D) NF-κB p65 were quantified using ImageJ software. The protein expression levels of (E) NLRC3 and (F) TRAF6 were detected using western blotting and semi-quantified using Image Lab software. LPS represents protein from the 100 ng/ml LPS-treated group; Indo represents protein from the 8 µg/ml Indo and 100 ng/ml LPS-treated group; ARR represents protein from the 100 µg/ml ARR and 100 ng/ml LPS-treated group. Data are presented as the mean ± SD (n=3). ##P<0.01 vs. control group; *P<0.05, **P<0.01 vs. LPS group. ARR, α-rhamnrtin-3-α-rhamnoside; TRAF6, tumor necrosis factor-associated factor 6; NLRC3, NOD-like receptor family CARD domain containing 3; LPS, lipopolysaccharide; Indo, indomethacin.
Discussion
Inflammation is a natural host defense reaction process, which is divided into acute and chronic inflammation according to the duration (29). The main symptoms of acute inflammation include redness, swelling and pain (30,31). Chronic inflammation is caused by the persistence of inflammatory factors and damage to the tissues, which is manifested by the degeneration, exudation and proliferation of local tissues (32,33). ARR is a flavonoid compound extracted from the Loranthus tanakae Franch. & Sav (19). Flavonoids have been reported to exert anti-inflammatory (34), anticancer (35) and cardioprotective effects (36). However, the effect of ARR on inflammation and its underlying molecular mechanism remain unclear.
When macrophages are activated, they produce various inflammatory cytokines that cause inflammation (9). LPS is a macrophage stimulus, which can cause macrophages to secrete proinflammatory factors, including NO, PGE2, IL-6 and IL-1β (37). The present study established an LPS-induced inflammatory response in vitro model to evaluate the anti-inflammatory effect of ARR on RAW264.7 cells. The use of an LPS-induced macrophage line is a well-established anti-inflammatory in vitro model, which is widely deemed as a standard and reliable model to determine the potential of novel anti-inflammatory drug candidates, and therefore predominantly adopted by researchers of this field (38–41). Exposure to high levels of NO can cause an innate immune response and result in tissue disruption or cell injury (42). The cytokines, IL-6 and IL-1β, cause tissue damage and play an essential role in mediating various types of inflammatory disease (43). The results of the present study demonstrated that ARR notably suppressed the secretion of the proinflammatory factors, IL-6 and IL-1β.
Inflammatory responses are accompanied by the systematic activation of several signaling pathways (44). NF-κB is crucial to inflammatory responses as it releases proinflammatory cytokines and p65 translocation plays a key role in the activation of NF-κB (45), which was also discovered to be the main signaling pathway for LPS to induce inflammation in macrophages (46,47). Suppression of NF-κB activation has been found to represent a promising anti-inflammatory strategy (48). NF-κB downregulates the expression levels of iNOS, COX-2 and other inflammatory-related genes by activating transcription (49). NO is a free gaseous signaling molecule synthesized by iNOS, and excess production of NO mediated by iNOS induces an inflammatory response (50). COX-2 is known to generate proinflammatory prostaglandins, such as PGE2, which induce inflammation (51). A variety of natural compounds, including flavonoids, quercetin, genistein and kaempferol have been considered as natural COX-2 inhibitors (52,53). Kim et al (54) demonstrated that formononetin-7-O-phosphate inhibited COX-2 expression by inhibiting NF-κB nuclear translocation.
The present study also investigated whether ARR exerts anti-inflammatory effects via the NF-κB signaling pathway. As expected, the results demonstrated that ARR not only downregulated iNOS and COX-2 mRNA expression levels, but also suppressed NO and PGE2 content, in a dose-dependent manner. In addition, ARR markedly blocked NF-κB p65 translocation. To the best of our knowledge, the present study was the first to demonstrate that ARR can inhibit the inflammatory response via the NF-κB signaling pathway in LPS-induced RAW264.7 cells.
NLRC3 serves as a checkpoint to prevent dysregulated inflammation. Following stimulation of RAW264.7 cells with LPS, NLRC3 was observed to serve as a de-ubiquitinating enzyme to remove the ubiquitination of TRAF6 and inhibited the nuclear translocation of the NF-κB p65 subunit to reduce the release of IL-1β (55). The results of the present study demonstrated that ARR upregulated NLRC3 expression to inhibit the activation of the NF-κB pathway, which is consistent with previous findings (55,56).
The Nrf2 signaling pathway is another important regulator of inflammation. The activation of Nrf2 and its target molecules, such as HO-1 and NQO1, is considered an intracellular protective mechanism against oxidative stress and inflammatory responses (57). It has been reported that the activation of Nrf2 could disrupt the crosstalk between NF-κB and its target molecules, thereby controlling the inflammatory response (58). In addition, HO-1 and NQO1 were discovered to inhibit the transcription of inflammatory adhesive molecules mediated by NF-κB (41). Moreover, previous studies have revealed that the regulation of NF-κB may be associated with the Nrf2 signaling pathway, and it was reported that Nrf2 knockdown promoted the transcriptional activity of NF-κB (59–61). The results of the present study demonstrated that ARR upregulated Nrf2 expression and inhibited the nuclear translocation of NF-κB. Therefore, it was suggested that ARR-induced Nrf2 activation may prevent the increase of inflammatory cytokines mediated by NF-κB. However, the underlying molecular mechanism by which ARR affects the crosstalk between Nrf2 and NF-κB requires further investigation.
The aim of the present study was to explore the effects of ARR on LPS-induced RAW264.7 macrophages and to investigate the potential underlying mechanism. The western blotting, immunofluorescence and immunohistochemistry experimental results indicated that ARR inhibited the LPS-induced activation of TRAF6 and NF-κB p65 signaling molecules. Furthermore, ARR could upregulate NLRC3, HO-1, NQO1 and Nrf2 expression. The experiments performed and parameters evaluated in the present work suggested that ARR may exert anti-inflammatory effects, at least in part, by downregulating NF-κB and activating Nrf2-mediated inflammatory responses. In future studies, more in-depth investigations on the anti-inflammatory effect of ARR, and the specific relationship between NLRC3, NLRC3 and NF-κB should be performed.
In conclusion, the results of the present study demonstrated that ARR exerted anti-inflammatory effects in LPS-stimulated RAW264.7 cells, at least partially through the modulation of NF-κB- and Nrf2-mediated inflammatory responses. These results suggested that ARR may be an attractive candidate for the treatment of inflammation-related diseases. However, as this study was only performed using one macrophage cell line, future studies should be conducted on a wider variety of cells to verify the current study findings. Currently, numerous studies have evaluated the biological activities and mechanisms of tested compounds by comparing the treatment group (tested compound plus challenge) with the model group (only challenge), seldom employing a group treated with the sole test compound without challenge (62–66). Following this experimental setup, this type of grouping was employed for the LPS-stimulated RAW264.7 cell model in the present work. Hence, in future studies, more in-depth investigations on the anti-inflammatory effects of ARR, including the involvement of an ARR group without LPS challenge and in vivo animal models, should be conducted to gain further insight into the mechanism of action. These future studies should broaden the current understanding of the anti-inflammatory mechanism and highlight the potential of ARR as anti-inflammatory candidate drug.
Acknowledgements
Not applicable.
Funding Statement
The present study was funded by the Central Government Guides Local Scientific and Technological Development Fund Projects (grant no. YDZX20201400001443), Shanxi International Science and Technology Cooperation Project (grant no. 201803D421065), the National Natural Science Foundation of China (grant nos. 30672621 and 81173473) and the Taiyuan City Science and Technology Project Special Talents Star Project (grant no. 120247-08).
Funding
The present study was funded by the Central Government Guides Local Scientific and Technological Development Fund Projects (grant no. YDZX20201400001443), Shanxi International Science and Technology Cooperation Project (grant no. 201803D421065), the National Natural Science Foundation of China (grant nos. 30672621 and 81173473) and the Taiyuan City Science and Technology Project Special Talents Star Project (grant no. 120247-08).
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
JTZ and GY conceived and designed the experiments. KDR, JC and JH performed the experiments and analyzed the data. JTZ and GY confirmed the authenticity of all the raw data. JTZ and KDR drafted the initial manuscript and prepared the figures. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Yang SH, Le B, Androutsopoulos VP, Tsukamoto C, Shin TS, Tsatsakis AM, Chung G. Anti-inflammatory effects of soyasapogenol I-αa via downregulation of the MAPK signaling pathway in LPS-induced RAW 264.7 macrophages. Food Chem Toxicol. 2018;113:211–217. doi: 10.1016/j.fct.2018.01.050. [DOI] [PubMed] [Google Scholar]
- 2.Venkatesan T, Park EJ, Choi YW, Lee J, Kim YK. Anti-inflammatory activity of Ternstroemia gymnanthera stem bark extracts in bacterial lipopolysaccharide-stimulated RAW264.7 murine macrophage cells. Pharm Biol. 2017;55:837–846. doi: 10.1080/13880209.2017.1278778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Venkatesan T, Choi YW, Lee J, Kim YK. Falcarindiol inhibits LPS-induced inflammation via attenuating MAPK and JAK-STAT signaling pathways in murine macrophage RAW 264.7 cells. Mol Cell Biochem. 2018;445:169–178. doi: 10.1007/s11010-017-3262-z. [DOI] [PubMed] [Google Scholar]
- 4.Vašíček O, Lojek A, Číž M. Serotonin and its metabolites reduce oxidative stress in murine RAW264.7 macrophages and prevent inflammation. J Physiol Biochem. 2020;76:49–60. doi: 10.1007/s13105-019-00714-3. [DOI] [PubMed] [Google Scholar]
- 5.Park SM, Lee TH, Zhao R, Kim YS, Jung JY, Park CA, Jegal KH, Ku SK, Kim JK, Lee CW, et al. Amelioration of inflammatory responses by Socheongryong-Tang, a traditional herbal medicine, in RAW 264.7 cells and rats. Int J Mol Med. 2018;41:2771–2783. doi: 10.3892/ijmm.2018.3465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Novilla A, Djamhuri DS, Nurhayati B, Rihibiha DD, Afifah E, Widowati W. Anti-inflammatory properties of oolong tea (Camellia sinensis) ethanol extract and epigallocatechin gallate in LPS-induced RAW 264.7 cells. Asian Pacific J Tropical Biomed. 2017;7:1005–1009. doi: 10.1016/j.apjtb.2017.10.002. [DOI] [Google Scholar]
- 7.Liang N, Sang Y, Liu W, Yu W, Wang X. Anti-inflammatory effects of gingerol on lipopolysaccharide-stimulated RAW 264.7 cells by inhibiting NF-κB signaling pathway. Inflammation. 2018;41:835–845. doi: 10.1007/s10753-018-0737-3. [DOI] [PubMed] [Google Scholar]
- 8.Shim SY, Sung SH, Lee M. Anti-inflammatory activity of mulberrofuran K isolated from the bark of Morus bombycis. Int Immunopharmacol. 2018;58:117–124. doi: 10.1016/j.intimp.2017.11.002. [DOI] [PubMed] [Google Scholar]
- 9.Alam MB, Ju MK, Kwon YG, Lee SH. Protopine attenuates inflammation stimulated by carrageenan and LPS via the MAPK/NF-κB pathway. Food Chem Toxicol. 2019;131:110583. doi: 10.1016/j.fct.2019.110583. [DOI] [PubMed] [Google Scholar]
- 10.Olajide OA, Akande IS, Filho C, Lepiarz-Raba I, de Sousa DP. Methyl 3,4,5-trimethoxycinnamate suppresses inflammation in RAW264.7 macrophages and blocks macrophage-adipocyte interaction. Inflammopharmacology. 2020;28:1315–1326. doi: 10.1007/s10787-020-00720-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gültekin Y, Eren E, Özören N. Overexpressed NLRC3 acts as an anti-inflammatory cytosolic protein. J Innate Immun. 2014;7:25–36. doi: 10.1159/000363602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Schneider M, Zimmermann AG, Roberts RA, Zhang L, Swanson KV, Wen H, Davis BK, Allen IC, Holl EK, Ye Z, et al. The innate immune sensor NLRC3 attenuates toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF-κB. Nat Immunol. 2012;13:823–831. doi: 10.1038/ni.2378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhang L, Mo J, Swanson KV, Wen H, Petrucelli A, Gregory SM, Zhang Z, Schneider M, Jiang Y, Fitzgerald KA, et al. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING. Immunity. 2014;40:329–341. doi: 10.1016/j.immuni.2014.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wu A, Yang Z, Huang Y, Yuan H, Lin C, Wang T, Zhao Z, Zhou Y, Zhu C. Natural phenylethanoid glycosides isolated from Callicarpa kwangtungensis suppressed lipopolysaccharide-mediated inflammatory response via activating Keap1/Nrf2/HO-1 pathway in RAW 264.7 macrophages cell. J Ethnopharmacol. 2020;258:112857. doi: 10.1016/j.jep.2020.112857. [DOI] [PubMed] [Google Scholar]
- 15.Younis NS, Mohamed ME. Protective effects of myrrh essential oil on isoproterenol-induced myocardial infarction in rats through antioxidant, anti-inflammatory, Nrf2/HO-1 and apoptotic pathways. J Ethnopharmacol. 2021;270:113793. doi: 10.1016/j.jep.2021.113793. [DOI] [PubMed] [Google Scholar]
- 16.Kobayashi EH, Suzuki T, Funayama R, Nagashima T, Hayashi M, Sekine H, Tanaka N, Moriguchi T, Motohashi H, Nakayama K, Yamamoto M. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription. Nat Commun. 2016;7:11624. doi: 10.1038/ncomms11624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kim HN, Kim JD, Park SB, Son HJ, Park GH, Eo HJ, Kim HS, Jeong JB. Anti-inflammatory activity of the extracts from Rodgersia podophylla leaves through activation of Nrf2/HO-1 pathway, and inhibition of NF-κB and MAPKs pathway in mouse macrophage cells. Inflamm Res. 2020;69:233–244. doi: 10.1007/s00011-019-01311-2. [DOI] [PubMed] [Google Scholar]
- 18.Qiu HX, Lin YR. Editorial Committee of Flora of China, Chinese Academy of Sciences (eds), corp-author . Flora of China. Vol. 24. Science Press; Beijing: 1988. Loranthaceae Juss; p. p101. [Google Scholar]
- 19.Kim YK, Kim YS, Choi SU, Ryu SY. Isolation of flavonol rhamnosides from Loranthus tanakae and cytotoxic effect of them on human tumor cell lines. Arch Pharm Res. 2004;27:44–47. doi: 10.1007/BF02980044. [DOI] [PubMed] [Google Scholar]
- 20.Chen Y, Lin Y, Li Y, Li C. Total flavonoids of Hedyotis diffusa willd inhibit inflammatory responses in LPS-activated macrophages via suppression of the NF-kappaB and MAPK signaling pathways. Exp Ther Med. 2016;11:1116–1122. doi: 10.3892/etm.2015.2963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Feng H, He Y, La L, Hou C, Song L, Yang Q, Wu F, Liu W, Hou L, Li Y, et al. The flavonoid-enriched extract from the root of Smilax China L. inhibits inflammatory responses via the TLR-4-mediated signaling pathway. J Ethnopharmacol. 2020;256:112785. doi: 10.1016/j.jep.2020.112785. [DOI] [PubMed] [Google Scholar]
- 22.Cho BO, Che DN, Kim JS, Kim JH, Shin JY, Kang HJ, Jang SI. In vitro anti-inflammatory and anti-oxidative stress activities of kushenol C isolated from the roots of sophora flavescens. Molecules. 2020;25:1768. doi: 10.3390/molecules25081768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Chiu YH, Wu YW, Hung JI, Chen MC. Epigallocatechin gallate/L-ascorbic acid-loaded poly-γ-glutamate microneedles with antioxidant, anti-inflammatory, and immunomodulatory effects for the treatment of atopic dermatitis. Acta Biomater. 2021;130:223–233. doi: 10.1016/j.actbio.2021.05.032. [DOI] [PubMed] [Google Scholar]
- 24.Ningning X, Yune B, Qiangqiang X, Shouyuan Z, Guane Y. Preliminary experiments on the chemical constituents of the parasitic mulberry. Chinese Medicines and Clinics. 2012;12:762–763. (In Chinese) [Google Scholar]
- 25.Zhou J, Wang T, Dou Y, Huang Y, Qu C, Gao J, Huang Z, Xie Y, Huang P, Lin Z, Su Z. Brusatol ameliorates 2,4,6-trinitrobenzenesulfonic acid-induced experimental colitis in rats: Involvement of NF-κB pathway and NLRP3 inflammasome. Int Immunopharmacol. 2018;64:264–274. doi: 10.1016/j.intimp.2018.09.008. [DOI] [PubMed] [Google Scholar]
- 26.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 27.Liu S, Man Y, Zhao L. Sinomenine inhibits lipopolysaccharide-induced inflammatory injury by regulation of miR-101/MKP-1/JNK pathway in keratinocyte cells. Biomed Pharmacother. 2018;101:422–429. doi: 10.1016/j.biopha.2018.02.086. [DOI] [PubMed] [Google Scholar]
- 28.Yuan S, Liu H, Yuan D, Xu J, Chen Y, Xu X, Xu F, Liang H. PNPLA3 I148M mediates the regulatory effect of NF-kB on inflammation in PA-treated HepG2 cells. J Cell Mol Med. 2020;24:1541–1552. doi: 10.1111/jcmm.14839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Son ES, Park JW, Kim SH, Park HR, Han W, Kwon OC, Nam JY, Jeong SH, Lee CS. Anti-inflammatory activity of 3,5,6,7,3′,4′-hexamethoxyflavone via repression of the NF-κB and MAPK signaling pathways in LPS-stimulated RAW264.7 cells. Mol Med Rep. 2020;22:1985–1993. doi: 10.3892/mmr.2020.11252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Li LQ, Song AX, Yin JY, Siu KC, Wong WT, Wu JY. Anti-inflammation activity of exopolysaccharides produced by a medicinal fungus Cordyceps sinensis Cs-HK1 in cell and animal models. Int J Biol Macromol. 2020;149:1042–1050. doi: 10.1016/j.ijbiomac.2020.02.022. [DOI] [PubMed] [Google Scholar]
- 31.Lee M, Hong S, Park C, Han MH, Kim SO, Hong SH, Kim GY, Choi YH. Anti-inflammatory effects of Daehwangmokdantang, a traditional herbal formulation, in lipopolysaccharide-stimulated RAW 264.7 macrophages. Exp Ther Med. 2017;14:5809–5816. doi: 10.3892/etm.2017.5296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Leal NRF, Vigliano MV, Pinto FA, de Sousa TV, Velozo LSM, Sabino KC, da Graça Justo M, Coelho MG. Anti-inflammatory effect of diterpenes-enriched fractions from Pterodon polygalaeflorus through inhibition of macrophage migration and cytokine production. J Pharm Pharmacol. 2018;70:808–820. doi: 10.1111/jphp.12889. [DOI] [PubMed] [Google Scholar]
- 33.Kim SJ, Ko WK, Jo MJ, Arai Y, Choi H, Kumar H, Han IB, Sohn S. Anti-inflammatory effect of Tauroursodeoxycholic acid in RAW 264.7 macrophages, Bone marrow-derived macrophages, BV2 microglial cells, and spinal cord injury. Sci Rep. 2018;8:3176. doi: 10.1038/s41598-018-21621-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kim YJ. Rhamnetin attenuates melanogenesis by suppressing oxidative stress and pro-inflammatory mediators. Biol Pharm Bull. 2013;36:1341–1347. doi: 10.1248/bpb.b13-00276. [DOI] [PubMed] [Google Scholar]
- 35.Jnawali HN, Lee E, Jeong KW, Shin A, Heo YS, Kim Y. Anti-inflammatory activity of rhamnetin and a model of its binding to c-Jun NH2-terminal kinase 1 and p38 MAPK. J Nat Prod. 2014;77:258–263. doi: 10.1021/np400803n. [DOI] [PubMed] [Google Scholar]
- 36.Mendis S, Lindholm LH, Anderson SG, Alwan A, Koju R, Onwubere BJ, Kayani AM, Abeysinghe N, Duneas A, Tabagari S, et al. Total cardiovascular risk approach to improve efficiency of cardiovascular prevention in resource constrain settings. J Clin Epidemiol. 2011;64:1451–1462. doi: 10.1016/j.jclinepi.2011.02.001. [DOI] [PubMed] [Google Scholar]
- 37.Kim KH, Kim EJ, Kwun MJ, Lee JY, Bach TT, Eum SM, Choi JY, Cho S, Kim SJ, Jeong SI, Joo M. Suppression of lung inflammation by the methanol extract of Spilanthes acmella Murray is related to differential regulation of NF-κB and Nrf2. J Ethnopharmacol. 2018;217:89–97. doi: 10.1016/j.jep.2018.02.011. [DOI] [PubMed] [Google Scholar]
- 38.Wu H, Wang Y, Zhang Y, Xu F, Chen J, Duan L, Zhang T, Wang J, Zhang F. Breaking the vicious loop between inflammation, oxidative stress and coagulation, a novel anti-thrombus insight of nattokinase by inhibiting LPS-induced inflammation and oxidative stress. Redox Biol. 2020;32:101500. doi: 10.1016/j.redox.2020.101500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ying Y, Sun CB, Zhang SQ, Chen BJ, Yu JZ, Liu FY, Wen J, Hou J, Han SS, Yan JY, et al. Induction of autophagy via the TLR4/NF-κB signaling pathway by astragaloside contributes to the amelioration of inflammation in RAW264.7 cells. Biomed Pharmacother. 2021;137:111271. doi: 10.1016/j.biopha.2021.111271. [DOI] [PubMed] [Google Scholar]
- 40.Li M, Dong L, Du H, Bao Z, Lin S. Potential mechanisms underlying the protective effects of Tricholoma matsutake singer peptides against LPS-induced inflammation in RAW264.7 macrophages. Food Chem. 2021;353:129452. doi: 10.1016/j.foodchem.2021.129452. [DOI] [PubMed] [Google Scholar]
- 41.Guo C, Bi J, Li X, Lyu J, Liu X, Wu X, Liu J. Immunomodulation effects of polyphenols from thinned peach treated by different drying methods on RAW264.7 cells through the NF-κB and Nrf2 pathways. Food Chem. 2021;340:127931. doi: 10.1016/j.foodchem.2020.127931. [DOI] [PubMed] [Google Scholar]
- 42.Kim ME, Na JY, Lee JS. Anti-inflammatory effects of trans-cinnamaldehyde on lipopolysaccharide-stimulated macrophage activation via MAPKs pathway regulation. Immunopharmacol Immunotoxicol. 2018;40:219–224. doi: 10.1080/08923973.2018.1424902. [DOI] [PubMed] [Google Scholar]
- 43.Hwang SJ, Ahn EY, Park Y, Lee HJ. An aqueous extract of Nomura's jellyfish ameliorates inflammatory responses in lipopolysaccharide-stimulated RAW264.7 cells and a zebrafish model of inflammation. Biomed Pharmacother. 2018;100:583–589. doi: 10.1016/j.biopha.2018.01.116. [DOI] [PubMed] [Google Scholar]
- 44.Khajuria V, Gupta S, Sharma N, Tiwari H, Bhardwaj S, Dutt P, Satti N, Nargotra A, Bhagat A, Ahmed Z. Kaempferol-3-o-β-d-glucuronate exhibit potential anti-inflammatory effect in LPS stimulated RAW 264.7 cells and mice model. Int Immunopharmacol. 2018;57:62–71. doi: 10.1016/j.intimp.2018.01.041. [DOI] [PubMed] [Google Scholar]
- 45.Su Y, Xiong S, Lan H, Xu L, Wei X. Molecular mechanism underlying anti-inflammatory activities of lirioresinol B dimethyl ether through suppression of NF-κB and MAPK signaling in in vitro and in vivo models. Int Immunopharmacol. 2019;73:321–332. doi: 10.1016/j.intimp.2019.05.020. [DOI] [PubMed] [Google Scholar]
- 46.Hunto ST, Kim HG, Baek KS, Jeong D, Kim E, Kim JH, Cho JY. Loratadine, an antihistamine drug, exhibits anti-inflammatory activity through suppression of the NF-κB pathway. Biochem Pharmacol. 2020;177:113949. doi: 10.1016/j.bcp.2020.113949. [DOI] [PubMed] [Google Scholar]
- 47.Ha DT, Long PT, Hien TT, Tuan DT, An NT, Khoi NM, Oanh HV, Hung TM. Anti-inflammatory effect of oligostilbenoids from Vitis heyneana in LPS-stimulated RAW 264.7 macrophages via suppressing the NF-κB activation. Chem Cent J. 2018;12:14. doi: 10.1186/s13065-018-0386-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tao MQ, Ji CL, Wu YJ, Dong JY, Li Y, Olatunji OJ, Zuo J. 1,7-Dihydroxy-3,4-dimethoxyxanthone inhibits lipopolysaccharide-induced inflammation in RAW264.7 macrophages by suppressing TLR4/NF-κB signaling cascades. Inflammation. 2020;43:1821–1831. doi: 10.1007/s10753-020-01256-3. [DOI] [PubMed] [Google Scholar]
- 49.Eleazu C, Suleiman JB, Othman ZA, Zakaria Z, Nna VU, Hussain NH, Mohamed M. Bee bread attenuates high fat diet induced renal pathology in obese rats via modulation of oxidative stress, downregulation of NF-κB mediated inflammation and Bax signalling. Arch Physiol Biochem. 2020;2:1–17. doi: 10.1080/13813455.2020.1752258. [DOI] [PubMed] [Google Scholar]
- 50.Huang YF, Zhou JT, Qu C, Dou YX, Huang QH, Lin ZX, Xian YF, Xie JH, Xie YL, Lai XP, Su ZR. Anti-inflammatory effects of Brucea javanica oil emulsion by suppressing NF-kappaB activation on dextran sulfate sodium-induced ulcerative colitis in mice. J Ethnopharmacol. 2017;198:389–398. doi: 10.1016/j.jep.2017.01.042. [DOI] [PubMed] [Google Scholar]
- 51.Huang C, Li W, Zhang Q, Chen L, Chen W, Zhang H, Ni Y. Anti-inflammatory activities of Guang-Pheretima extract in lipopolysaccharide-stimulated RAW 264.7 murine macrophages. BMC Complement Altern Med. 2018;18:46. doi: 10.1186/s12906-018-2086-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Lee SG, Brownmiller CR, Lee SO, Kang HW. Anti-inflammatory and antioxidant effects of anthocyanins of trifolium pratense (Red Clover) in lipopolysaccharide-stimulated RAW-267.4 macrophages. Nutrients. 2020;12:1089. doi: 10.3390/nu12041089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Karki S, Park HJ, Nugroho A, Kim EJ, Jung HA, Choi JS. Quantification of major compounds fromIxeris dentata, Ixeris dentata Var. albiflora, and Ixeris sonchifolia and their comparative anti-inflammatoryactivity in lipopolysaccharide-stimulated RAW 264.7 cells. J Med Food. 2015;18:83–94. doi: 10.1089/jmf.2014.3205. [DOI] [PubMed] [Google Scholar]
- 54.Kim MS, Park JS, Chung YC, Jang S, Hyun CG, Kim SY. Anti-inflammatory effects of formononetin 7-O-phosphate, a novel biorenovation product, on LPS-stimulated RAW 264.7 macrophage cells. Molecules. 2019;24:3910. doi: 10.3390/molecules24213910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Li ZT, Liu H, Zhang WQ. NLRC3 alleviates hypoxia/reoxygenation induced inflammation in RAW264.7 cells by inhibiting K63-linked ubiquitination of TRAF6. Hepatobiliary Pancreat Dis Int. 2020;19:455–460. doi: 10.1016/j.hbpd.2020.04.003. [DOI] [PubMed] [Google Scholar]
- 56.Biliktu M, Senol SP, Temiz-Resitoglu M, Guden DS, Horat MF, Sahan-Firat S, Sevim S, Tunctan B. Pharmacological inhibition of soluble epoxide hydrolase attenuates chronic experimental autoimmune encephalomyelitis by modulating inflammatory and anti-inflammatory pathways in an inflammasome-dependent and -independent manner. Inflammopharmacology. 2020;28:1509–1524. doi: 10.1007/s10787-020-00691-w. [DOI] [PubMed] [Google Scholar]
- 57.Cho YC, Park J, Cho S. Anti-inflammatory and anti-oxidative effects of luteolin-7-O-glucuronide in LPS-stimulated murine macrophages through TAK1 inhibition and Nrf2 activation. Int J Mol Sci. 2020;21:2007. doi: 10.3390/ijms21062007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kwon MY, Park J, Kim SM, Lee J, Cho H, Park JH, Han IO. An alpha-lipoic acid-decursinol hybrid compound attenuates lipopolysaccharide-mediated inflammation in BV2 and RAW264.7 cells. BMB Rep. 2019;52:508–513. doi: 10.5483/BMBRep.2019.52.8.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Li CL, Liu XH, Qiao Y, Ning LN, Li WJ, Sun YS, Liu DS, Gao W, Ma CM. Allicin alleviates inflammation of diabetic macroangiopathy via the Nrf2 and NF-κB pathway. Eur J Pharmacol. 2020;876:173052. doi: 10.1016/j.ejphar.2020.173052. [DOI] [PubMed] [Google Scholar]
- 60.Wardyn JD, Ponsford AH, Sanderson CM. The Keap1/Nrf2 pathway in health and disease dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem Soc Trans. 2015;43:621–626. doi: 10.1042/BST20150014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Ren J, Su D, Li L, Cai H, Zhang M, Zhai J, Li M, Wu X, Hu K. Anti-inflammatory effects of Aureusidin in LPS-stimulated RAW264.7 macrophages via suppressing NF-κB and activating ROS- and MAPKs-dependent Nrf2/HO-1 signaling pathways. Toxicol Appl Pharmacol. 2019;387:114846. doi: 10.1016/j.taap.2019.114846. [DOI] [PubMed] [Google Scholar]
- 62.Zheng Y, Tian C, Fan C, Xu N, Xiao J, Zhao X, Lu Z, Cao H, Liu J, Yu L. Sheng-Mai Yin exerts anti-inflammatory effects on RAW 264.7 cells and zebrafish. J Ethnopharmacol. 2020;267:113497. doi: 10.1016/j.jep.2020.113497. [DOI] [PubMed] [Google Scholar]
- 63.Park YJ, Cheon SY, Lee DS, Cominguez DC, Zhang Z, Lee S, An HJ. Anti-inflammatory and antioxidant effects of carpesium cernuum L. Methanolic extract in LPS-stimulated RAW 264.7 macrophages. Mediators Inflammation. 2020;2020:3164239. doi: 10.1155/2020/3164239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Baek SH, Park T, Kang MG, Park D. Anti-inflammatory activity and ROS regulation effect of sinapaldehyde in LPS-stimulated RAW 264.7 macrophages. Molecules. 2020;25:4089. doi: 10.3390/molecules25184089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Kumar A, Sawhney G, Nagar RK, Chauhan N, Gupta N, Kaul A, Ahmed Z, Sangwan PL, Kumar PS, Yadav G. Evaluation of the immunomodulatory and anti-inflammatory activity of Bakuchiol using RAW 264.7 macrophage cell lines and in animal models stimulated by lipopolysaccharide (LPS) Int Immunopharmacol. 2021;91:107264. doi: 10.1016/j.intimp.2020.107264. [DOI] [PubMed] [Google Scholar]
- 66.Sewwandi S, Dissanayake CY, Natraj P, Lee YJ, Han CH. Anti-inflammatory effect of sulforaphane on LPS-stimulated RAW 264.7 cells and ob/ob mice. J Vet Sci. 2020;21:e91. doi: 10.4142/jvs.2020.21.e91. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.





