Abstract
We recently rereported that blood mRNA levels of T cells and IgE receptors are the novel non-invasive biomarkers for eosinophilic esophagitis (EoE) with the aim to establish the panel of T cells and IgE receptor as the novel non-invasive biomarkers for EoE. In addition to earlier proposed cell surface molecules, we now added T cell receptor CXCR6 and eosinophils expressed cell surface molecules CD101 and CD274 mRNA levels. The mRNA levels of eosinophils cell surface molecule CD101 and CD274 and T cell receptor CXCR6, Vβ11, CD1d and chemokine CXCL16 levels were examined using the blood of normal, EoE and GERD patients. The analysis showed statistically significant induced mRNA levels of CD274, CD101 and reduced CXCR6 will be an additional molecule with respective 95%, 90% and 90% positive predictive value in between EoE and GERD patients. In brief, these additional data will be critical to establish a complete panel of earlier published TCRδ (95%), Jα18 (83%) and FCεRII (100%) non-invasive biomarker to monitor the EoE severity and treatment effect in EoE patients. In conclusion, we now propose both induced and reduced transcript levels of cell surface molecules of the cell surface molecules along with earlier reported molecules that will be useful for monitoring EoE status before and following treatment. Most importantly, the complete predictive non-invasive biomarker panel will also serve to differentiate EoE from GERD.
Keywords: Biomarker, Eosinophils, CD101, CD274, CXCR6
Introduction
Expert panel consensus recommendations (FIGURE2) of an interdisciplinary expert physicians define that eosinophilic esophagitis (EoE) represents a chronic, immune/antigen-mediated esophageal disease characterized clinically by symptoms related to esophageal dysfunction and histologically by eosinophil predominant inflammation.1 Further, regarding diagnostic the recommendation suggested that the patients biopsy specimens must show eosinophil-predominant inflammation with 15 eosinophils/hpf (peak value) as minimum threshold for a diagnosis of EoE.2 Another diagnostic consensus recommendation was published in AGRE conference 2018 that indicated esophageal biopsy remains the only reliable diagnostic test for EoE; however, the panel did not recommend molecules in invasive study of a panel of serum biomarkers found that none of the markers studied correlate with disease.3–6 A novel non-invasive biomarker is lacking that differentiate EoE from other esophageal disorders like closely related gastroesophageal reflux disease (GERD). We earlier reported that in the esophageal biopsies of EoE patients IL-15 and iNKT cells are induced7–9 and most recently evaluated the levels of mRNA expression of several potential molecules related IL-15 and its responsive iNKT cell surface molecules and receptors in the blood of EoE patients and showed by ROC curve analysis that TCRδ (95%), Jα18 (83%) and. FCεRII (100%) have positive predictive value in support of individual novel marker for EoE that differentiate clearly EoE from GERD.10 Since we earlier reported that human blood has both CD274 expressing (CD274+) and not expressing (CD274–) eosinophils in normal individuals and EoE patients.3 Therefore, we further examined blood mRNA levels of CD274 and CD101 with some other critical T cells receptors and associated chemokines based on our earlier preliminary report that indicated induced CD274-expressing eosinophils and CD274 mRNA levels in one pediatric and one adult EoE patients compare to normal and their levels reduces following the treatment.11 We extended these observation and now present that indeed the mRNA levels of eosinophils cell surface molecules CD274, CD101 is significantly induced along with significantly reduced T cell receptor CXCR6 in EoE patients compare to the normal individuals and GERD patients. The ROC curve analysis showed CD274, CD101 and CXCR6 transcript has 95%, 90%, and 90% positive predictive value, respectively. Thus, with the inclusion of these additional data, we now predict that the panel of blood mRNA levels of CD274, CD101, CXCR6, TCRδ, Jα18, and FCεRII as the novel non-invasive biomarkers for EoE that even differentiate EoE from GERD patients.
Figure 2. Analysis of CXCR6 in EoE patients compared to normal individuals and GERD patients.
RT-PCR analysis of CXCR6 mRNA expression levels in the blood samples of the EoE patients, GERD, and normal individuals. Each data points indicate individual transcripts expression levels in patients (A). Receiver operating characteristic (ROC) analysis of CXCR6 to discriminate between patients with EoE compared to GERD (B). The solid line (no discrimination) indicates values that have no discriminatory value. Note that on the vertical axis, the scale is from no (0%) to complete (100%) sensitivity. The horizontal axis is a reciprocal scale (100% - % specificity). The optimum performance of a diagnostic test is determined either at the highest sum of the sensitivity and specificity or at an acceptable level of sensitivity for the given disease. Data are expressed as mean± SD, n=3; EoE: 33 patients, GERD: 19 patients, normal individual: 15 nos. Some patient data points are missing as they did not show up during PCR analysis. EoE vs Normal *** p<0.0003; EoE vs GERD ### p<0.001.
Materials and Methods
1. Details of Patients characteristics.
The normal individuals, GERD and EoE patients were selected without regard to age, atopic status, or gender. The treatment strategies for EoE including dietary restriction of food allergens or topical fluticasone therapy and for GERD including PPI therapy are listed in Table 1, as described in published in our recently.10
Table 1:
Patients Clinical and pathological characteristics
| Patients | Age | Gender | Esophageal disease | Allergic diseases | Current Treatment |
|---|---|---|---|---|---|
| 1 | 9 | M | NL | Asthma | None |
| 2 | 11 | F | NL | Unknown | None |
| 3 | 7 | F | NL | None | H1RA |
| 4 | 9 | F | NL | Unknown | INHGC,LTRA |
| 5 | 4 | M | NL | Rhinitis | LTRA |
| 6 | 12 | M | NL | None | INHGC |
| 7 | 5 | F | NL | Unknown | INHGC |
| 8 | 11 | M | NL | None | PPI, OGC |
| 9 | 9 | M | NL | Asthma | None |
| 10 | 10 | M | NL | None | INHGC, SWGC |
| 11 | 12 | M | NL | None | None |
| 12 | 13 | F | NL | Unknown | PPI |
| 13 | 10 | M | NL | Asthma | INHGC |
| 14 | 12 | M | NL | None | PPI |
| 15 | 14 | F | EoE | Asthma | INHGC |
| 16 | 4 | M | EoE | None | INHGC |
| 17 | 9 | F | EoE | Rhinitis/Asthma/Food allergy | PPI, mesalamine |
| 18 | 8 | M | EoE | Food Allergy | Alimentary diet |
| 19 | 10 | M | EoE | None | None |
| 20 | 8 | F | EoE | Asthma/Eczema | Alimentary diet, INHGC |
| 21 | 9 | F | EoE | Rhinitis/Asthma | Alimentary diet, INHGC |
| 22 | 6 | M | EoE | Unknown | INHGC,B2ARA |
| 23 | 11 | F | EoE | Food Allergy | None |
| 24 | 4 | F | EoE | Asthma | Alimentary diet, INHGC |
| 25 | 5 | M | EoE | None | INHGC |
| 26 | 10 | F | EoE | Asthma/Eczema | None |
| 27 | 6 | M | EoE | None | PPI |
| 28 | 7 | M | EoE | Rhinitis/Asthma | B2ARA |
| 29 | 15 | F | EoE | Food Allergy/anaphylaxis | Alimentary diet, Protonix |
| 30 | 8 | M | EoE | None | Alimentary diet, PPI |
| 31 | 11 | M | EoE | Asthma/Rhinitis | Alimentary diet |
| 32 | 21 | F | EoE | Rhinitis/enzema | Alimentary diet, SWGC |
| 33 | 9 | M | EoE | Unknown | B2ARA |
| 34 | 13 | M | EoE | Food Allergy | SWGC,PPI |
| 35 | 18 | F | EoE | Asthma/Rhinitis | SWGC, H1RA |
| 36 | 8 | M | EoE | Eczema | Alimentary diet, SWGC |
| 37 | 11 | M | EoE | Unknown | PPI |
| 38 | 20 | M | EoE | Rhinitis | Alimentary diet, PPI |
| 39 | 8 | M | EoE | Unknown | Alimentary diet, INHGC |
| 40 | 20 | F | EoE | Asthma | PPI |
| 41 | 11 | M | EoE | None | None |
| 42 | 7 | M | EoE | Asthma/Eczema | INHGC |
| 43 | 11 | F | EoE | Rhinitis | INHGC,PPI |
| 44 | 12 | M | EoE | None | B2ARA |
| 45 | 8 | F | EoE | Food Allergy/anaphylaxis/Asthma | SWGC, Alimentary diet |
| 46 | 11 | M | EoE | Unknown | PPI |
| 47 | 20 | M | GERD | Rhinitis | Alimentary diet, |
| 48 | 18 | M | GERD | Unknown | Alimentary diet, INHGC |
| 49 | 20 | F | GERD | Asthma | PPI |
| 50 | 11 | M | GERD | None | None |
| 51 | 7 | M | GERD | Asthma/Eczema | INHGC |
| 52 | 11 | F | GERD | Rhinitis | INHGC,PPI |
| 53 | 12 | M | GERD | None | B2ARA |
| 54 | 8 | F | GERD | Food Allergy/anaphylaxis/Asthma | SWGC, Alimentary diet |
| 55 | 13 | M | GERD | Asthma | OGC |
| 56 | 18 | F | GERD | Unknown | None |
| 57 | 8 | M | GERD | None | H1RA |
| 58 | 11 | M | GERD | Unknown | INHGC,LTRA |
| 59 | 20 | M | GERD | Rhinitis | LTRA, |
| 60 | 8 | M | GERD | None | INHGC, INHGC |
| 61 | 20 | F | GERD | Asthma/ Food allergy | INHGC |
| 62 | 4 | F | GERD | None | PPI |
| 63 | 5 | M | GERD | Rhinitis/enzema | Alimentary diet, SWGC |
| 64 | 10 | F | GERD | Unknown | B2ARA |
| 65 | 6 | M | GERD | Food Allergy | SWGC,PPI |
Abbreviations: NL=normal, M=male, F= female, EoE= eosinophilic esophagitis, GERD. LTRA, leukotriene receptor antagonist; H1RA, H1-receptor antagonist; INHGC, inhaled glucocorticoid; B2ARA, 2 adrenergic receptor antagonists; PPI, proton pump inhibitor; SWGC, swallowed glucocorticoid (fluticasone); OGC, oral glucocorticoid (prednisone). These patient’s samples were also used in our previous publication and their characteristics are also reported.10
2. Patient Blood Collection and Blood RNA Isolation.
human GAPDH amplified from the same cDNA mix and expressed as relative gene expression. cDNA was amplified using the primers listed in Table 2.
Table 2:
List of human primer sequences
| Genes | Sense and anti-sense primer sequence (5’-3’) |
|---|---|
| h-Vβ11 | F: 5’- TCAACAGTCTCCAGAATAAGGACG -3′ |
| R: 5′- GTGGGAGATCTCTGCTTCTG -3′ | |
| h-CD1d | F: 5′- GCCTGTCCTGTCGGGTGAA -3′ |
| R: 5′- GCTGTTCCTCCTCATTGTGGG -3′ | |
| h- CXCR6 | F: 5′- ATGCCATGACCAGCTTTCACT -3′ |
| R: 5′-TTAAGGCAGGCCCTCAGG -3′ | |
| h-CXCL16 | F: 5′- GGCCCACCAGAAGCATTTAC-3′ |
| R: 5′- CTGAAGATGCCCCCTCTGAG -3′ | |
| h-CD274 | F: 5′- CATTTGCTGAACGCCCCATA -3′ |
| R: 5′- TCTTGGAATTGGTGGTGGTG -3′. | |
| h-CD101 | F: 5′- TCGTTCTCCCTCTGCTCGTT-3′ |
| R: 5′- GCCGGATGGCCTTGTACTTT-3′. | |
| h-GAPDH | F: 5’- TGGAAATCCCATCACCAT -3’ |
| R: 5’- GTCTTCTGGGTGGCAGTGA -3’ |
3. Measurement of Biomarkers mRNA Levels by RT-PCR Analysis.
Quantitative PCR analysis was performed on blood RNA (500 ng) and it was subjected to reverse transcription analysis using iScript reverse transcriptase (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. CD274, CD101, T cell receptor-CXCR6, Chemokine ligand 16 (CXCL16), iNKT cell receptor (Vβ11) and activated iNKT cell receptor (CD1d) were quantified by real-time PCR using IQ5 (Bio-Rad, Hercules, CA). Results were then normalized to human GAPDH amplified from the same cDNA mix and expressed as relative gene expression. cDNA was amplified using the primers listed in Table 2.
4. Statistical Analysis.
Esophageal eosinophil counts from each patient were calculated by averaging the mean eosinophil counts obtained from the proximal and distal esophagus. All statistical tests were compared using t tests or analysis of variance. Values are reported as mean ± standard deviation (SD). p values < 0.05 were considered statistically significant. Statistical tests were performed using GraphPad Prism 5 Software (San Diego, CA).
Results
Induced mRNA levels of naïve and pathogenic eosinophils cell surface molecules CD101 and CD274 in EoE, compared to GERD patients and normal individuals.
Most recently, we and others reported a distinguishable subset of CD10112 and CD27413 expressing eosinophils, similar to the other immune cell subset populations that exhibit differences in their phenotypes and functions. Earlier, we reported possibility of induced CD101 and CD274 expressing eosinophils may be used to diagnose eosinophilic esophagitis (EoE) in patients;11,13 and now in this report we validated this possibility by analyzing large number of patient’s blood and confirm that indeed the number of CD274 expressing eosinophils increases with disease severity and decreases following the treatment.11 We examined blood mRNA levels of eosinophils cell surface molecule CD274 and CD101 expression in normal, EoE and GERD patients. We present the data that show significantly induced CD274 and CD101 mRNA levels in the blood of EoE patients compared to GERD patients and non-EoE individuals (Fig 1 A–B). The specificity and sensitivity of these two eosinophils cell surface molecules CD101 and CD274 were compared between normal, EoE and GERD patients. The cut-off levels were determined by ROC curve analysis to maximize the sensitivity and specificity of CD101 and CD274 biomarkers that differentiate EoE from normal and GERD as described earlier.10 The ROC curve analysis of CD274 (95%) and CD101 (90%) in individual yielded an excellent positive predictive value for EoE patient that even differentiate clearly EoE from GERD (Fig 1 C–D). These results further establish that the induced blood mRNA levels CD274 and CD101 will be a novel biomarker that differentiate EoE from GERD.
Figure 1. Analysis of mRNA levels of naïve and pathogenic eosinophils cell surface molecules CD274 and CD101.
RT-PCR analysis of naïve and pathogenic eosinophils differentiation cell surface molecules CD274 (A) and CD101 (B) in EoE, GERD patients and normal individuals. Each data points indicate individual transcripts expression levels in patients. Receiver operating characteristic (ROC) analysis of CD274 and CD101 to discriminate between patients with EoE compared to GERD (C, D). The solid line (no discrimination) indicates values that have no discriminatory value. Note that on the vertical axis, the scale is from no (0%) to complete (100%) sensitivity. The horizontal axis is a reciprocal scale (100% - % specificity). The optimum performance of a diagnostic test is determined either at the highest sum of the sensitivity and specificity or at an acceptable level of sensitivity for the given disease. Data are expressed as mean± SD, n=3; EoE: 33 patients, GERD: 19 patients, normal individual: 15 nos. Some patient data points are missing as they did not show up during PCR analysis. EoE vs Normal *** p<0.0003, ** p<0.01; EoE vs GERD ## p<0.01.
Relative expression analysis of CXCR6 in EoE patients compared to normal individuals and GERD patients.
The CXCR6 receptor is also expressed by T cell subset including iNKT cells; therefore, we also examined CXCR6 mRNA expression in the blood of normal individual, EoE, and GERD patients. Similar to the other reported iNKT cells specific mRNA levels, we also observed significantly reduced CXCR6 mRNA in EoE patients compared to normal and GERD patients. (Fig 2, A) with the 90% specificity and sensitivity by ROC curve analysis that yielded an excellent positive predictive value in support of individual marker for EoE patient that differentiate clearly EoE from GERD (Fig 2 B).
Relative expression of non-specific iNKT cell receptors (Vβ11, CD1d) and chemokine (CXCL16) mRNA levels in the blood of normal, EoE, and GERD patients.
Most recently, we reported that IL-15-responsive iNKT cells, iNKT cell receptor (Vα24, Jα18) are highly expressed in the esophagus, and their levels are reduced in the blood of patients with EoE compared with GERD patients and non-EoE individuals.9,10 Therefore, we further examined few other receptors and chemokines that are present and are shown to be involved in the homing of iNKT and other T cells subsets.9 The receptor Vβ11 and CD1d mRNA level is found decreased in EoE patients compare to normal individuals; but no difference between GERD patients and non-EoE individuals (Fig 3A, C). The specificity and sensitivity of Vβ11 and CD1d were compared between EoE and patients compare to normal individuals; but no difference between GERD patients and non-EoE individuals (Fig 3A, C). The specificity and sensitivity of Vβ11 and CD1d were compared between EoE and GERD patients. The ROC curve analysis for specificity and sensitivity of Vβ11 and CD1d yielded not much positive predictive value (67% and 92%,) respectively; but between normal individual to EoE patients yielded only 77% and 57% (Fig 3 B, D). Thus, both Vβ11 and CD1d cannot be a used as a reliable biomarker for EoE. Additionally, we also examined mRNA levels CXCL16, that also found reduced in EoE vs GERD patients, but no significant change compared to the normal individuals (Fig 3E). The ROC curve analysis for specificity and sensitivity of CXCL16 between EoE and GERD yielded (98%), but yielded only 47% between normal individual to EoE patients (Fig 3 F). Notably, all these receptor Vβ11, CD1d and chemokine CXCL16 are not specific to iNKT cells and found in several other T cell subsets and antigen presenting cells. 14–17
Figure 3. Relative expression of non-specific iNKT cell receptors (Vβ11, CD1d) and chemokine (CXCL16) mRNA levels in the blood of normal, EoE, and GERD patients.
RT-PCR analysis of T cell receptors mRNA levels of Vβ11 (A), CD1d (C) and their chemokine CXCL16 (E) in EoE, GERD and normal individuals are shown. Each data points indicate individual transcripts expression levels of each patient. Receiver operating characteristic (ROC) analysis for sensitivity and specificity of Vβ11 between EoE compared to GERD (B), iNKCD1d (D) and chemokine CXCL16 (F) between EoE compared to normal individuals are analyzed. The solid line (no discrimination) indicates values that have no discriminatory value. Note that on the vertical axis, the scale is from no (0%) to complete (100%) sensitivity. The horizontal axis is a reciprocal scale (100% - % specificity). The optimum performance of a diagnostic test is determined either at the highest sum of the sensitivity and specificity or at an acceptable level of sensitivity for the given disease. Data are expressed as mean± SD, n=3; EoE: 33 patients, GERD: 19 patients, normal individual: 15 nos. Some patient data points are missing as they did not show up during PCR analysis. EoE vs Normal ** p<0.01, * p<0.05; EoE vs GERD,#p<0.05, ## p<0.01, NS, not significant.
Summarized ROC curve positive predictive value for the non-invasive biomarker’s specificity for EoE.
Herein, we present a combined panel of earlier reported genes10 and present additional mRNA levels of eosinophils and T cell surface molecule CD274, CD101 and CXCR6 mRNA level with the percent of positive predictive values compare to the GERD patients. The complete panel ROC curve of biomarkers is presented in Table 3.
Table 3.
The complete panel ROC curve of biomarker
| Name of GENEs | Levels in blood of human EOE com pared to Normal and GERD | Percent ROC Curve positive predictive value (EoE vs GERD) |
|---|---|---|
| CD274 | Induced | 95 |
| CD101 | Induced | 90 |
| FcΣRII | Reduced | 100 |
| TCRδ | Reduced | 95 |
| Ja18α | Reduced | 83 |
| Vβ11 | Reduced | 67 |
| CXCR6 | Reduced | 90 |
Discussion
CD274 is recognized as an activation and maturation marker of T cells 18 and we showed CD274 expressionon the eosinophils present in allergic patients EoE.3,13 We earlier showed that CD274-expressing blood eosinophils in both pediatric and adult EoE patients that suggested CD274+ eosinophils or their mRNA levels may be a possible blood biomarker for human EoE. The two EoE patient reported blood eosinophil analysis showed a strong relation between CD274 expression on eosinophils and histological esophageal biopsy findings. However, in the earlier report we did not compare the CD274 expression levels on the eosinophils of EoE and GERD patients. Therefore, we now examined a large number of EoE compare to GERD patients and normal individuals that showed a significantly induced levels of CD274, CD101 and CXCR6 mRNA levels in EoE patients compare to the normal individuals and GERD patients with the 95%, 90%, 90% positive predictive value by ROC curve analysis, respectively in between EoE and GERD patients. Additionally, we also observed few additional T cell receptor mRNA levels like CXCR6 and Vβ11 mRNA levels that also differentiate EoE from GERD. Blood tests are not used for EoE diagnosis; but our constant approach now indicate that blood test is useful for the diagnosis of EoE and GERD patients. The presented blood mRNA analysis for T cell receptor-CXCR6, iNKT cell receptor (Vβ11), eosinophils express CD274 and CD101 cell surface molecules along with earlier reported blood mRNA levels of T cells and IgE receptors are the novel non-invasive biomarkers for EoE. Additionally, we also recommend initially the expression of CD274 on the blood eosinophils may also be used to differentiate EoE from GERD. Thus, the presented data suggest that peripheral blood mRNA levels of reported molecules are the relevant biomarker panel for monitoring disease activity in EoE patients. In conclusion, we now propose mRNA levels of CD274, CD101, CXCR6, TCRδ, Jα18, a nd FCεRII are the novel non-invasive biomarkers panel for monitoring the EoE disease in patients before and after treatment and to differentiate EoE disease from GERD in patients. EoE disease in patients before and after treatment and to differentiate EoE disease from GERD in patients.
Acknowledgements
This work was supported by the NIH grant R01 AI080581 (AM). Dr. Mishra is the endowed Schlieder Chair; therefore, we thank the Edward G. Schlieder Educational Foundation for financial support. The Cincinnati Children’s Hospital Medical Center, Cincinnati OH for providing blood samples from EoE and GERD patients with healthy individuals. Thanks also to Dr. Madhavi Rayapudi, MD for contribution and Ms. Loula Burton, Office of Research Proposal Development, Tulane University for the manuscript editing
Footnotes
Conflict of Interest Declaration of all sources of funding: All authors have no financial conflict of interest.
References
- 1.Liacouras CA, Furuta GT, Hirano I, Atkins D, Attwood SE, Bonis PA, Burks AW, Chehade M, Collins MH, Dellon ES, et al. Eosinophilic esophagitis: updated consensus recommendations for children and adults. J Allergy Clin Immunol 128, 3–20 e26; 21–22, doi: 10.1016/j.jaci.2011.02.040 (2011). [DOI] [PubMed] [Google Scholar]
- 2.Dellon ES, Liacouras CA, Molina-Infante J, Furuta GT, Spergel JM, Zevit N, Spechler SJ, Attwood SE, Straumann A, Aceves SS, et al. Updated International Consensus Diagnostic Criteria for Eosinophilic Esophagitis: Proceedings of the AGREE Conference. Gastroenterology 155, 1022–1033,doi: 10.1053/j.gastro.2018.07.009 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Venkateshaiah SU, Mishra A, Manohar M, Verma AK, Rajavelu P, Niranjan R, Wild LG, Parada NA, Blecker U, Lasky JA, Mishra A A critical role for IL-18 in transformation and maturation of naive eosinophils to pathogenic eosinophils. The Journal of allergy and clinical immunology 142, 301–305. doi: 10.1016/j.jaci.2018.02.011 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dellon ES Rusin S, Gebhart JH, Covey S, Higgins LL, Beitia R, Speck O, Woodward K, Woosley JT, and Shaheen NJ Utility of a Noninvasive Serum Biomarker Panel for Diagnosis and Monitoring of Eosinophilic Esophagitis: A Prospective Study. The American journal of gastroenterology 110, 821–827, doi: 10.1038/ajg.2015.57 (2015). 121, 218–228, doi:10.1016/j.anai.2018.05.005 (2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Venkateshaiah SU Zhu X, Rajavelu P, Niranjan R, Manohar M, Verma AK, Lasky JA, and Mishra A Regulatory effects of IL-15 on allergen- induced airway obstruction. J Allergy Clin Immunol. 2018. Mar;141(3):906–917.e6. doi: 10.1016/j.jaci.2017.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hines BT Rank MA, Wright BL, Marks LA, Hagan JB, Straumann A, Greenhawt M, and Dellon ES Minimally invasive biomarker studies in eosinophilic esophagitis: A systematic review. Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology 121, 218–228, doi: 10.1016/j.anai.2018.05.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zhu X Wang M, Mavi P, Rayapudi M, Pandey AK, Kaul A, Putnam PE, Rothenberg ME, and Mishra A Interleukin-15 expression is increased in human eosinophilic esophagitis and mediates pathogenesis in mice. Gastroenterology 139, 182–193 e187, doi:S0016–5085(10)00514–7 [pii] 10.1053/j.gastro.2010.03.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Dutt P Shukla JS, Ventateshaiah SU, Mariswamy SJ, Mattner J, Shukla A, and Mishra A Allergen-induced interleukin-18 promotes experimental eosinophilic oesophagitis in mice. Immunol Cell Biol 93, 849–857, doi: 10.1038/icb.2015.30 (2015).8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rayapudi M Rajavelu P, Zhu X, Kaul A, Niranjan R, Dynda S, Mishra A, Mattner J, Zaidi A, Dutt P, Anil Mishra.. Invariant natural killer T-cell neutralization is a possible novel therapy for human eosinophilic esophagitis. Clin Transl Immunology 3, e9, doi: 10.1038/cti.2013.13 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Upparahalli Venkateshaiah S, Rayapudi M, Kandikattu HK, Yadavalli CS & Mishra A Blood mRNA levels of T cells and IgE receptors are novel non-invasive biomarkers for eosinophilic esophagitis (EoE). Clin Immunol 227, 108752, doi: 10.1016/j.clim.2021.108752 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mishra A, Venkateshaiah SU, Mahadevappa CP, Manhoar M, Verma AK, Mattner J Novel noninvasive biomarker of eosinophilc esophagitis (EoE). J Allergy Clin Immunol 137 AB406 (2016). [Google Scholar]
- 12.Mesnil C et al. Lung-resident eosinophils represent a distinct regulatory eosinophil subset. The Journal of clinical investigation 126, 3279–3295, doi: 10.1172/JCI85664 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Venkateshaiah SU, Manohar M, Verma AK, Blecker U & Mishra A Possible Noninvasive Biomarker of Eosinophilic Esophagitis: Clinical and Experimental Evidence. Case reports in gastroenterology 10, 685–692, doi: 10.1159/000452654 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Dellabona P, Padovan E, Casorati G, Brockhaus M & Lanzavecchia A An invariant V alpha 24-J alpha Q/V beta 11 T cell receptor is expressed in all individuals by clonally expanded CD4–8- T cells. J Exp Med 180, 1171–1176, doi: 10.1084/jem.180.3.1171 (1994). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Exley M Garcia J, Wilson SB, Spada F, Gerdes D, Tahir SM, Patton KT, Blumberg RS, Porcelli S, Chott A, Balk SP. CD1d structure and regulation on human thymocytes, peripheral blood T cells, B cells B cells and monocytes. Immunology 100, 37–47, doi: 10.1046/j.1365-2567.2000.00001.x (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chaudhry MS & Karadimitris A Role and regulation of CD1d in normal and pathological B cells. J Immunol 193, 4761–4768 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Day C, Patel R, Guillen C & Wardlaw AJ The chemokine CXCL16 is highly and constitutively expressed by human bronchialepithelial cells. Exp Lung Res 35, 272–283, doi: 10.1080/01902140802635517 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Singh AK, Stock P & Akbari O Role of PD-L1 and PD-L2 in allergic diseases and asthma. Allergy 66, 155–162, doi: 10.1111/j.1398-9995.2010.02458.x (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]