Abstract
Age-associated bone loss or osteoporosis is a common clinical manifestation during aging (AG). The mechanism underlying age-associated mitochondrial-specific oxidative damage induced osteoblast dysfunction and loss of bone density remains elusive. Here, we demonstrated that the effect of allyl sulfide (AS), a natural organosulfur compound, on mitochondrial (mt) function in bone marrow-derived mesenchymal stem cells (BMMSCs) and bone density in AG mice. The data demonstrate that AS treatment in AG mice promotes BMMSCs differentiation and mineralization via inhibition of mitochondrial oxidative damage. The data also indicate that AG related mito-damage was associated with reduced mitochondrial biogenesis and oxidative phosphorylation and released a greater concentration of mtDNA. Further, the data showed that mtDNA caused histone H3K27 demethylase inhibition, KDM6B, and subsequent inflammation by unbalancing mitochondrial redox homeostasis. KDM6B overexpression in AG BMMSCs or AS administration in AG mice restore osteogenesis and bone density in vitro and in vivo. Mechanistically, AS or mitochondrial-specific antioxidant, (Mito-TEMPO) increased KDM6B expression, upregulates the expression of Runx2 in BMMSCs, probably via epigenetic inhibition of H3K27me3 methylation at the promoter. These data uncover the previously undefined role of AS mediated prevention of mtDNA release, promoting osteogenesis and bone density via an epigenetic mechanism. Therefore, AS could be a potential drug target for the treatment of aging-associated osteoporosis.
Keywords: Mitochondrial biogenesis, Osteoclastogenesis, BMMSCs mineralization, mtDNA release, Epigenetic H3K27me3 methylation
Graphical abstract
Introduction
Osteoporosis is considered a major global health problem and currently affecting 200 million people globally. It primarily affects women after menopause and both sexes in the aging populations (1, 2). It is also one of the critical metabolic bone disorders and characterized microarchitectural deterioration of the bone tissue due to an imbalance between bone-forming osteoblasts and bone-resorbing osteoclasts (1, 3). Therefore, patients with osteoporosis phenotype are more vulnerable to bone fractures and are also associated with increased mortality (3, 4). Study suggests that age-associated osteoporosis-related fractures increases exponentially after 50 years of age. It correlated with increase porosity in trabecular and cortical bone, decrease osteoblast mineralization, bone strength (5, 6). Therefore, the aging populations will be responsible for a significant increase in osteoporosis incidence worldwide and leading to substantial economic expenses for the patients (7).
Mitochondria are the powerhouse of the cellular system. It generates most ATPs required for cell metabolism using oxidative phosphorylation (8). Mitochondria function as cell autonomous and they have their genomic system, which plays an essential role in mitochondrial biogenesis (9). Mitochondria function is known to deteriorate with age, losing respiratory oxygen consumption activity, accumulating mitochondrial damage to their DNA (mtDNA), and producing excessive amounts of reactive oxygen species (ROS). Hussan et al., 2015 have reported that hydrogen peroxide mediates mitochondrial dysfunction and altered mitochondrial dynamics in osteoblast (10). However, age-associated mitochondrial specific oxidative damage and mtDNA release dependent inflammation inhibits osteoblast differentiation and mineralization is still unknown.
Gene expression is regulated through epigenetic DNA methylation and covalent chromatin modifications of histones, e.g., acetylation, phosphorylation, and methylation (11). Histone methyltransferases and demethylases regulate histone methylation at the gene promoter. The Jumonji domain containing-3 (Jmjd3, KDM6B) and ubiquitously transcribed X-chromosome tetratricopeptide repeat protein (UTX, KDM6A) associated with H3K27 demethylation, have demethylase activity on H3K27me2/3 (12). H3K27 methyltransferase Ezh2 belongs to the polycomb repressive complex. It is known to regulate dimethylation and trimethylation of H3K27 (H3K27me2/3) and is associated with gene suppression (12). However, mechanistic understanding of JMJD3 in regulating osteogenic gene expression during AG-related osteoblast dysfunction is still unclear.
Garlic (Allium sativum Linn.) has many therapeutic values and exerts hypolipidemic, hypocholesterolemic, and antioxidant effects. It has been used as a traditional medicine to prevent inflammation and cellular damage in various diseases (13). Diallyl sulfide (AS), diallyl disulfide (DDS), and diallyl trisulfide (DTS) are organosulfur compounds found in garlic extract. They have antioxidant, anti-inflammatory, and cytoprotective properties (14). However, no study has been conducted on these organosulfur compounds’ direct effects on bone remodeling in an age-associated osteoporosis mouse model. Therefore, we examined the effects of AS on aging (AG)-induced osteoblast dysfunction and the potential mechanisms. Our findings might provide new insights into AS’s protective role in AG-induced deregulation of osteoblast mineralization, thereby highlighting its potential therapeutic application for osteoporosis.
Material and methods
Animals and Experimental Design
20-months-old (aged) and 3-months-old (young) female C57BL/6 J mice were purchased from the Jackson Laboratory (Harbor, ME). The animal procedures were carefully reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Louisville and followed the National Institutes of Health’s animal care and guidelines. The animals were fed standard chow and water ad libitum. Total body weight was measured in young (YG) and aged (AG) mice. To study the beneficial effects of AS in age (AG)-associated osteoblast function and mineralization in AG mice, AS was fed through oral gavage for 3-months (12-weeks). The mouse groups were as follows: (1). 3-months-old Wild-type C57BJ/L6 mice as the young group (YG), (2). 20-months-old Wild-type C57BJ/L6 mice as aging mice (AG), (3). AS-supplemented AG mice (AG+AS), (4). Neutralizing IL-1 antibody-treated AG mice (AG+IL-1-Ab), (5). H3K27me3 inhibitor GSK-463 was treated to AG mice.
BMMSCs culture and pcDNA3.1-JMJD3 plasmid transfection
BMMSCs were cultured as per our previously published protocol (3, 5). Briefly, mouse bone marrow cells were flushed by centrifugation (3000 rpm for 7 min) from the bone cavities of femurs of the experimental groups and collected with alpha minimum essential medium (α-MEM; Invitrogen) containing 2% heat-inactivated fetal bovine serum (FBS; ATCC). They were then washed with PBS. The cells suspended in α-MEM 15% FBS were seeded into 12-well culture plates (Corning) for 24 hr at 37 °C. Following removal of the non-adherent cells, the adherent cells were further cultured under osteogenic induction medium (α-MEM+15% FBS supplemented with 2 mM β-glycerophosphate, 100 nM dexamethasone, and 50 μg/mL ascorbic acid) for 3-weeks. To overexpress Jmjd3 expression, BMMSCs were transfected pcDNA3.1-JMJD3 plasmid (100 ng, Addgene) using a Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA). After 48 hours of transfection in Treg cells, Jmjd3 overexpression was confirmed with qPCR analysis.
ChIP combined with qPCR
We performed a ChIP assay using our previously described procedures (3). To study the mtDNA mediated regulation on Runx2 expression via suppressing histone repressive mark H3K27me3 on Runx2 promoter, ChIP assay was performed in BMMSCs culture. The confluent cells were chemically cross-linked with 2% formaldehyde for 10 min. Cells lysate were immunoprecipitated with an H3K27me3 antibody preabsorbed with 40 μl of protein A beads overnight at 4°C. Following the wash, the immune complexes were used to isolate the DNA. PCR was performed using the primers that amply the promoter regions of Runx2 as follows: Runx2 promoter primers1:, forward, 5’-AAGGAGTTTGCAAGCAGAGC-3’, reverse, 5’CAACTGAGTGTGTGGCGTTC-3’; Runx2 promoter primers 2, forward, 5’-GGCTCCTTCAGCATTTGTGT-3’, reverse, 5’-TGTCCTCTCCCTTTCCTTCC-3’.
Histone methylation/demethylation assay
The histone extract was isolated from BMMSCs culture using the EpiQuik total histone extraction kit (Base Catalog # OP-0006, Epigentek, Farmingdale, NY). Quantification of Jmjd3 activity was measured using Epigenase JMJD3/UTX Demethylase Activity/Inhibition Assay Kit (P-3084–48, colorimetric). Additionally, we also measured H3K27MTase activity that specifically targets histone H3 at lysine 27 (H3-K27) subunit using EpiQuik Histone Methyltransferase Activity/Inhibition assay kit (H3K27) (P-3005–48) according to the manufacturer’s instructions.
X-ray analysis of the skeleton
Following treatment to experimental mice, animals were anesthetized, and x-ray radiographs of femur bones were taken on KODAK In-Vivo Imaging System FX Pro as our previously described protocol (3). Bone mineral density (BMD) was measured after selecting the femur regions of interest (FROI) using Carestream software (DRX-1). To characterize overall bone integrity, average bone densities of multiple regions of the femur were considered.
Statistical Analysis
All statistical analyses and graphical presentations were performed with GraphPad Prism software, v.8.2.0. All experimental data are expressed as the mean ± S.E.M. Significant differences between two groups were determined by Two-tailed, unpaired Student’s t-test. The significant differences in more than two experimental groups were compared by one-way analysis of variance (ANOVA) in combination with Tukey’s multiple comparison test. P < 0.05 was considered statistically significant. Experiments were repeated three times independently.
Results:
Allyl sulfide improves mitochondrial biogenesis and prevents the release of mitochondrial DNA in bone-marrow mesenchymal stem cells
Conventionally raised 20-months-old female (AG) mice were supplemented by oral gavage with AS (200 mg/kg) or vehicle control for 3-months. At the end of the treatment period, femoral bones were collected from each experimental mouse group to study mitochondrial respiration and biogenesis (Fig. 1a). To examine the protective effect of AS on AG-induced mitochondrial dysfunction, several parameters of mitochondrial respiration and biogenesis were assessed in cultured bone marrow mesenchymal stem cells (BMMSCs). Using confocal imaging, we determined mitochondrial superoxide (O2·−) production in BMMSCs incubated with MitoSOX™ Red. The data shows that aged (AG)-BMMSCs displayed a higher amount of mitochondrial O2·− generation than the YG control and AG+AS group (Fig. 1b, c). We also administrated mitochondria-targeted specific antioxidant mito-TEMPO (200 mg/kg) in AG mice and obtained BMMSCs at the end of the treatments. The data found that mito-TEMPO treatment prevented mitochondrial O2·− generation in the AG+mito-TEMPO group (Fig. 1b, c). Mitochondrial oxygen consumption rates and ATP production were improved in the mitochondria of AG+AS or AG+mito-TEMPO group compared to the AG group (Fig. 1d, e). We next examined the mitochondrial contents in cultured BMMSCs by using a MitoTracker™ Green probe. Data found that mitochondrial mass was significantly improved in the BMMSCs of the AG+AS or AG+mito-TEMPO group compared to the BMMSCs of the AG group (Fig. 1f, g).
Figure 1: Allyl sulfide (AS) improves mt-DNA replication and mitochondrial biogenesis in BMMSCs.
(a) Experimental design and administration of AS (200 mg/kg) to 20-months-old mice for three months. (b-c) Mitochondrial ROS production (mitoSOX fluorescence) in BMMSCs using confocal microscopy. Quantification of the fluorescent signal and expressed as relative fluorescence unit (rfu). (d-e) OCR and ATP production in isolated mitochondria from the BMMSCs culture. (f-g) Confocal image of mitochondria in BMMSCs culture and data of mitochondria mass quantified as a mean of MitoTracker Green intensity. (h) Relative complex I activity assay of isolated mitochondria. (i) mRNA transcript expression of mt-transcription factors in isolated mitochondria. (j-k) mtDNA contents in isolated mitochondria and cytoplasm of cultured BMMSCs. Experiments were repeated at least three times. Data are expressed as mean ± SEM. n = 5–6 mice per group. *p < 0.05 compared with the young (YG) mice, #p < 0.05 compared with AG mice.
In addition to the mitochondrial bioenergetic defects, we also tested complex I activity (COX-1) in isolated mitochondria of BMMSCs culture. The data found that COX-1 was markedly improved in AG+AS and AG+MitoTEMPO group (Fig. 1h). TFAM (transcription factor A, mitochondrial) is a DNA-binding protein and functions as a master transcription activator for mtDNA replication. Here, we demonstrated the variants of transcription activator for mtDNA replication. The data found that mtTFA and mtTFB1 were indeed improved but not mtTFB2, in AG+AS and AG+MitoTEMPO group, respectively (Fig. 1i). mtDNA copy number was significantly higher in isolated mitochondria of BMMSCs from AG+AS and AG+mitoTEMPO group than the AG group, as assessed by real-time PCR analysis (Fig. 2j). We also tested the mtDNA release in the cytoplasm of BMMSCs culture, and data showed that AG BMMSCs have a higher amount of mtDNA release into cytoplasm than YG control BMMSCs cytoplasm. However, the above effect is mitigated in AG+AS or AG+MitoTEMPO group (Fig. 1k). This finding suggests for the first time that allyl sulfide (AS) treatments could reverse the AG-associated mitochondrial dysfunction and energy defect in BMMSCs.
Figure 2: Effect of AS on BMMSCs osteogenic differentiation and bone density.
(a) The cell proliferation was estimated in cultured BMMSCs using MTT assay. (b) ALP activity and staining was performed in BMMSCs culture on day 7. (c) BMMSCs bone mineralization was performed by Alizarin Red staining (ARS) on day 21. (d-e) Protein western blot analysis of Runx2 and OCN expression. (f) Biochemical assay confirmed calcium accumulation during BMMSCs culture. (g) Inflammatory cytokine gene expression was profiled using qPCR cytokine PCR array. Red arrow illustrates that upregulated genes in AG condition. (h-j) ELISA of plasma cytokines (IL-1, OPG, RANKL) was measured in the culture supernatants. (k-l) Representative X-ray images of the mice using In-Vivo Imaging System FX Pro. Rectangular box (yellow) illustrates that femur region of interest (FROI). The bar diagram represents the quantification of BD (l). (m) The bar diagram represents the quantification of Plasma (P1NP and CTX) of experimental mice. Experiments were repeated at least three times. Data are expressed as mean ± SEM. n = 5–6 mice per group. *p < 0.05 compared with the young (YG) mice, #p < 0.05 compared with AG mice.
AS prevents age-associated reduced BMMSCs osteogenesis and bone density
To study the potential role of AS on BMMSCs proliferation, differentiation and mineralization in vitro, we cultured BMMSCs under osteogenesis induction medium for 21 days. The data demonstrate that MTT cell proliferation (day 3) and ALP activity was improved in AG+AS or AG+MitoTEMPO BMMSCs group on day 3 and 7, respectively (Fig. 2a, b). Alizarin Red staining also confirmed that AS or MitoTEMPO treatment promoted osteogenic conversion, as shown by the increase in cellular calcium nodule formation in AG+AS or AG+mitoTEMPO group compared to AG BMMSCs group (Fig. 2c). Meanwhile, Western blot results showed that the expression levels of the osteogenic markers Runx2, and OCN were significantly increased in AG+AS or AG+MitoTEMPO group on day 21 compared to AG BMMSCs alone (Fig. 2d, e). Interestingly, the administration of AS and motoTEMPO restored the BMMSCs intracellular calcium level (Fig. 3g, h). Further we tested the inflammatory secretome of AG BMMSCs culture using Inflammatory Cytokines and Receptors RT2 Profiler PCR Array. As expected, the expression of IL-1β and its receptor, Il1r1 upregulated in AG BMMSCs culture (Fig. 2g, red arrowhead). However, AS administration prevented AG induced increased expression of IL-1β and Il1r1. Further, using ELISA in culture supernatants of BMMSCs culture demonstrated that AS prevented AG-induced secretion of IL-1β level (Fig. 2h). Indeed, both OPG and RANKL level was increased and decreased in culture supernatants of AG+AS or AG+MitoTEMPO groups (Fig. 2i, j) respectively.
Figure 3: Effect of AS on BMMSCs regulated osteoclasts differentiation.
(a) Experimental design and induction of osteoclasts differentiation under treatment with BMMSCs derived conditioned medium (CM). (b-c) TRAP+ staining in cultured Osteoclasts on day 5. Total number of TRAP+ osteoclasts was counted. (d) ELISA of TRAP-5b activity in cultured osteoclasts. (e-h) mRNA transcript expression of osteoclastic genes (Nfatc1, Ctsk, RANK, and Oc-stamp) by qPCR analysis. Experiments were repeated at least three times. Data are expressed as mean ± SEM. n = 5 mice per group. *p < 0.05 compared with the YG mice, #p < 0.05 compared with the AG mice.
To investigate further, AS contributes to bone density/formation in AG mice in vivo, the experimental mice were observed under X-ray in vivo imaging (In-Vivo FX PRO; BRUKER Corporation). We observed that bone density (BD) was lower in the femur’s metaphyseal area in the AG mice compared to YG. However, BD improved in AG+AS or AG+ MitoTEMPO group mice compared to AG mice (Fig. 2k, l). In parallel, we also tested various bone remodeling markers in the plasma of experimental mice assessed by ELISA. The plasma level of P1NP (marker of bone formation) and CTx (bone resorption marker), were improved upon AG+AS or AG+ MitoTEMPO group mice compared to AG mice (Fig. 2m).
Effect of AS on BMMSCs regulated osteoclastogenesis via a paracrine mechanism
As we determined, AG-BMMSCs secretes inflammatory cytokines (IL-1β) in the culture supernatants (Fig. 2h), that may influence the osteoclast differentiation, therefore, we performed ex vivo osteoclastogenesis assays. Bone marrow (BM) cells were cultured under 15% conditioned medium (CM) derived from BMMSCs culture of experimental mice (Fig. 3a). At the day 5, mature osteoclasts were stained with TRAP+ staining kit and found that mature TRAP+ positive osteoclasts was indeed increased in AG-CM group compared to YG-CM group (Fig. 3b, c). Using osteoclast lysate, the data demonstrated that TRAP-5b activity was also increased in the AG-CM osteoclast group (Fig. 3d). As we observed, inflammatory IL-1β cytokine levels were increased in AG BMMSCs (Fig. 2h). Therefore, we treated IL-1β neutralizing antibody to neutralize IL-1 β action in CM of the AG BMMSCs condition. Surprisingly, there was a reduced osteoclastogenesis and total TRAP+ positive activity in the AG + IL-1β-Ab group, compared to AG-CM group (Fig. 3c, d). However, AS treatment improves above AG induced changes. We also tested the mRNA transcript expression of osteoclast genes (Nuclear factor of activated T-cells, cytoplasmic 1 (Nfatc1), Cathepsin K (Ctsk), Receptor Activator Of NF-KB (RANK) and Osteoclast stimulatory transmembrane protein (Ocstamp)) in cultured osteoclasts in vitro. The data demonstrate that these genes were reduced in osteoclast cultures incubated with the AG+AS-CM or AG+ IL-1-Ab’s-CM as compared to AG-CM condition (Fig. 3e, f, g, h). These results suggest that AG in BMMSCs induced secretion of IL-1β, which increased osteoclast differentiation and TRAP+ activity. AS supplementation mitigated the AG-associated osteoclastogenesis via the paracrine mechanism (Fig. 3).
AS promotes Runx2 expression by inhibiting H3K27me3 methylation at the promoter in AG-BMMSCs
To examine mitochondria function could exert on Runx2 expression via an epigenetic mechanism. Using western blot analysis, the data found that Jmjd3 protein expression decreased while H3K27me3 expression increased in BMMSCs in the AG mice group compared to the YG mice group (Fig. 4a). In contrast, mitoTEMPO or AS treatment significantly improved Jmjd3 expression and decreased H3K27me3 expression in AG+mitoTEMPO or AG+AS group, respectively (Figure. 4). Further, the H3K27 demethylase activity of JMJD3/UTX and H3K27MTase activity was reduced and increased in AG BMMSCs group’s nuclear extracts, respectively. However, AS treatment or mitoTEMPO treatment had an opposite effect (Fig. 4b, c). To investigate whether mitochondrial oxidative damage associated mtDNA release regulates Runx2 depression by influencing H3K27me3 at the promoter during aging, we performed chromatin immunoprecipitation (ChIP)-qPCR analysis using an anti-H3K27me3 antibody (Fig. 4d). Intriguingly, the data revealed that aging (AG) associated with enhanced H3K27me3 enrichment at the Runx2 promoter, whereas the AS or MitoTEMPO or GSK343 (4 nM, H3K27 methylation inhibitor) administration significantly reduced H3K27me3 enrichment at the Runx2 promoter (Fig. 4e, f). Besides, we transfected cultured AG-BMMSCs with pcDNA3.1-JMJD3/Kdm6b plasmid and estimated the consequences on H3K27me3/Kdm6b enrichment and RunX2 expression. Forty-eight hours after transfection, JMJD3/Kdm6b expression was significantly enhanced in AG+ pcDNA3.1-JMJD3, compared with the pcDNA3.1-control plasmid (Fig. 4g). Consistently, H3K27me3 enrichment at the Runx2 promoter was suppressed after Kdm6b overexpression (pcDNA3.1-JMJD3/Kdm6b plasmid) in AG+JMJD (Fig. 4h). Further, using qPCR assay confirmed that Runx2 mRNA levels were also upregulated in BMMSCs transfected with AG+pcDNA3.1-JMJD3/Kdm6b group, compared with that in the pcDNA3.1-control AG group (Fig. 4i). Our data collectively suggest that AS mediated mitochondrial function; facilitates upregulation of Runx2 via the inhibition of H3K27me3 methylation (through upregulation of JMJD3/Kdm6b) at the RunX2 promoter in BMMSCs of AG+AS mice group (Fig. 4).
Figure 4: AS supplementation restored mitochondria regulated Runx2 expression by preventing H3K27me3 methylation at the Runx2 promoter.
(a) Protein western blot analysis of indicated histone modified protein (JMJD3, H3K27me3). (b-c) JMJD3/UTX Demethylase Activity and H3K27MTase activity was measured from isolated histone protein of BMMSCs culture. (d) Diagrammatic representation of H3K27me3 binding to Runx2 promoter under the action of mtDNA release during aging. (e-f) Level of H3K27me3 enrichment on the Runx2 promoter as assessed by ChIP-qPCR. (g-h) Overexpression of JMJD3/Kdm6b expression (g) and studied the H3K27me3 enrichment on Runx2 promoter (h). (i) qPCR analysis of Runx2 mRNA expression. Experiments were repeated at least three times. Data are expressed as mean ± SEM. n = 5 mice per group. *p < 0.05 compared with the YG mice, #p < 0.05 compared with the AG mice.
Discussion
In the present study, we demonstrated that AG mice exhibit mitochondrial dysfunction via superoxide production, decreased mito-biogenesis, and energy metabolism, leading to mtDNA’s release into the cytoplasm of BMMSCs. This lead to a reduction of BMMSCs osteogenesis, mineralization, and a decrease in bone mineral density (BD). However, overall events were rescued after supplementation with garlic-derived organosulfur compound AS. Mechanistically, AS prevented mtDNA release dependent altered chromatin/histone remodeling at the BMMSCs epigenome. AS increases BMMSCs osteogenesis by upregulating osteogenic transcription factor Runx2, via inhibition of the H3K27me3 methylation mechanism in AG+AS mice. These findings provided proof of principle that AS treatment based mito-function may represent a therapeutic strategy to enhance bone metabolism.
Medicinal plants or derived active compounds are becoming an efficient approach for treating inflammatory diseases. The studies have shown the medicinal compound allyl sulfide has anti-inflammatory and immunomodulatory effects (15–17). In the current study, we demonstrated garlic derived AS exerts an anti-aging function in age-related osteoblast dysfunction and bone mineralization.
Bone metabolism is the balance between bone formation by osteoblast and bone loss by osteoclasts (3). Previous studies have reported that reduced bone formation is due to decreased osteoblast differentiation and mineralization in age-related osteoporosis (18). Also, oxidative damage is associated with regulating osteoblast mineralization (19). However, mtDNA release’s exact role following mitochondrial dysfunction associated with osteoblast dysfunction and mineralization during aging associated osteoporosis in vivo remains unknown. In the present study, we demonstrate dysfunctional mitochondria and defects in mitochondrial respiration and energy metabolism govern AG associated osteoblast dysfunction. This led to the release of mtDNA and activated the inflammatory IL-1 signaling in osteoblast. Further, it enhances osteoclastogenesis (TRAP+ osteoclasts and TRAP activity). However, AS administration in AG mice promotes mitochondrial function and prevents mtDNA release dependent inflammatory IL-1 signaling and osteoclastogenesis. These data demonstrated for the first time that AS mediated increased BMMSCs mineralization in vitro and bone density/formation (BD) in vivo via mitigating mtDNA release associated inflammation in AG condition.
Runt-related transcription factor 2 (RunX2) and Transcription factor Sp7 (Osterix) play an essential role in osteoblast differentiation and bone formation. Mutations of these genes have been associated with skeletal defects in mice (20–21). However, the regulation of osteogenic transcription factors, Runx2 and Osterix during age-induced mitochondrial damage, is not studied yet. In the present study, the data demonstrated for the first time that Runx2 is strongly regulated by mitochondrial function and biogenesis under AS or mitoTEMPO supplementation in BMMSCs of AG mice. A recent study also demonstrated the emerging role of Jmjd3 (Kdm6b), an H3K27me3 demethylase in osteoblast differentiation in vitro (22). However, its role in BMMSCs differentiation and bone formation in vivo remain poorly studied during aging. Our study uncovered a distinct promoter behavior in response to H3K27me3 occupancy on the Runx2 gene under dysfunctional mitochondrial released mtDNA. Interestingly, a reduced level of Jmjd3 expression was decreased the Runx2 promoter activity and increased the level of H3K27me3 on the promoter region of Runx2 under AG condition, whereas AS supplementation had an opposite effect. Also, we showed that AS or overexpression of Jmjd3 through transfected pcDNA3.1-JMJD3 plasmid in BMMSCs culture prevents AG induced increased histone hyper-methylation around Runx2 promoter. This data suggests that AS supplementation restores Jmjd3 expression, thereby removing the repressive transcription mark H3K27me3 on the Runx2 promoter, resulting in increased Runx2 expression required for the bone metabolism.
In summary, the present study provides both in vitro and in vivo evidence of allyl sulfide (AS) promoted osteoblast differentiation and increase of BD in the aging mouse model, which was mediated by mtDNA-JMJD3-Runx2 signaling. Further, AS indeed suppress age-related augmentation of mtDNA release dependent BMMSCs inflammation and osteoclastogenesis. Due to AS’s anti-osteoporotic effect on BMMSCs mineralization and BD in aging mice, it may also be considered a potent bone anabolic drug to cure osteoporosis in future clinical medicine.
Supplementary Material
Table 1.
Sequences of PCR primers used for real time quantitative PCR and ChIP assay PCR.
| Gene | Primer Sequences (5′→3′) |
|---|---|
|
| |
| Mouse Runx2 | FP: TTTAGGGCGCATTCCTCATC |
| RP: TGTCCTTGTGGATTGAAAGGAC | |
|
| |
| Mouse Osteocalcin | FP: GCGCTCTGTCTCTCTGACCT |
| RP: ACCTTATTGCCCTCCTGCTT | |
|
| |
| Mouse Nfatc1 | FP: GAGACAGACATCCGGAGGAGA |
| RP: GTGGGATGTGAACACGGAAGA | |
|
| |
| Mouse Cathepsin-K | FP: GGATGAAATCTCTCGCGTTT |
| RP: GGTTATGGGCAGAGATTGCTT | |
|
| |
| Mouse RANK | FP: ACTGAGGAGGCCACCCAAGGA |
| RP: TGAAGAGGACCAGAACGATGAG | |
|
| |
| Mouse Oc-stamp | FP: TGTAGCCTGGGCTCAGATGT |
| RP: GTTGGTTGAGGACGTAGAGG | |
|
| |
| Mouse GAPDH | FP: TGCACCACCAACTGCTTGC |
| RP: GGCATGGACTGTAGTCAGAG | |
Highlights.
Allyl sulfide (AS) administration ameliorates age-associated mitochondrial dysfunction and prevents the release of mitochondrial DNA in BMMSCs.
AS promotes BMMSCs differentiation, mineralization and bone density in AG mice.
AS administration prevents the age-associated BMMSCs inflammation via reducing IL-1β secretion.
Administration of AS restores the osteoblastic Runx2 expression by histone methylation mechanism.
Acknowledgement
This research study was supported, in part, by National Institute of Health (NIH) grants HL-107640 and AR-067667 to NT.
Footnotes
Competing interests
The authors declare no competing interests.
Biochemical and Biophysical Research Communications
Declaration of competing interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Please note that all Biochemical and Biophysical Research Communications authors are required to report the following potential conflicts of interest with each submission. If applicable to your manuscript, please provide the necessary declaration in the box above.
(1) All third-party financial support for the work in the submitted manuscript.
(2) All financial relationships with any entities that could be viewed as relevant to the general area of the submitted manuscript.
(3) All sources of revenue with relevance to the submitted work who made payments to you, or to your institution on your behalf, in the 36 months prior to submission.
(4) Any other interactions with the sponsor of outside of the submitted work should also be reported. (5) Any relevant patents or copyrights (planned, pending, or issued).
(6) Any other relationships or affiliations that may be perceived by readers to have influenced, or give the appearance of potentially influencing, what you wrote in the submitted work. As a general guideline, it is usually better to disclose a relationship than not.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References:
- [1].Nam M, Huh JE, Kim MS et al. , 2018. Metabolic alterations in the bone tissues of aged osteoporotic mice, Sci. Rep 8, 8127. 10.1038/s41598-018-26322-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].Cooper C, G Campion LJ Melton III, Hip fractures in the elderly: a world-wide projection, Osteoporos. Int 2 (1992) 285–289. 10.1007/BF01623184 [DOI] [PubMed] [Google Scholar]
- [3].Behera J, George AK, Voor MJ et al. , Hydrogen Sulfide Epigenetically Mitigates Bone Loss through OPG/RANKL Regulation During Hyperhomocysteinemia in Mice, Bone 114 (2018) 90–108. 10.1016/j.bone.2018.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].J van Meurs JB, Dhonukshe-Rutten RAM, Plujim SMF et al. , Homocysteine Levels and the Risk of Osteoporotic Fracture, N. Engl. J. Med 350 (2004) 2033–2041. 10.1056/NEJMoa032546 [DOI] [PubMed] [Google Scholar]
- [5].Behera J, Kelly KE, Voor MJ et al. , 2018. Hydrogen Sulfide Promotes Bone Homeostasis by Balancing Inflammatory Cytokine Signaling in CBS-Deficient Mice through an Epigenetic Mechanism, Sci. Rep 8, 15226. 10.1038/s41598-018-33149-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Reginster JY, Burlet N, Osteoporosis: A still increasing prevalence, Bone 38(2 Suppl 1) (2006) S4–S9. 10.1016/j.bone.2005.11.024 [DOI] [PubMed] [Google Scholar]
- [7].Parfitt AM, Age-related structural changes in trabecular and cortical bone: cellular mechanisms and biomechanical consequences, Calcif. Tissue Int 36 (1984) S123–S128. 10.1007/BF02406145 [DOI] [PubMed] [Google Scholar]
- [8].An JH, Yang JY, Ahn BY, et al. , Enhanced mitochondrial biogenesis contributes to Wnt induced osteoblastic differentiation of C3H10T1/2 cells, Bone (2010) 47(1) 140–150. 10.1016/j.bone.2010.04.593 [DOI] [PubMed] [Google Scholar]
- [9].Dobson PF, Dennis EP, Hipps D, et al. , 2020. Mitochondrial dysfunction impairs osteogenesis, increases osteoclast activity, and accelerates age related bone loss, Sci Rep. 10, 11643. 10.1038/s41598-020-68566-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].She F, Wang W, Wang Y, Melatonin protects MG63 osteoblast-like cells from hydrogen peroxide-induced cytotoxicity by maintaining mitochondrial function, Mol. Med. Rep 9 (2013) 493–498 [DOI] [PubMed] [Google Scholar]
- [11].Burchfield JS, Li Q, Wang HY, Wang RF, JMJD3 as an epigenetic regulator in development and disease, Int. J. Biochem. Cell Biol 67 (2015) 148–157. 10.1016/j.biocel.2015.07.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Swigut T, Wysocka J, H3K27 demethylases, at long last, Cell 131 (2007) 29–32. 10.1016/j.cell.2007.09.026 [DOI] [PubMed] [Google Scholar]
- [13].Mukherjee M, Das AS, Mitra S, Mitra C, Prevention of Bone Loss by Oil Extractof Garlic (Allium sativumLinn.) in an Ovariectomized Rat Model of Osteoporosis, Pyother. Res 18 (2004) 389–394. 10.1002/ptr.1448 [DOI] [PubMed] [Google Scholar]
- [14].Shang A, Cao SY, Xu XY, et al. , Bioactive Compounds and Biological Functions of Garlic (Allium sativum L.), Foods 8 (2019) 246. 10.3390/foods8070246 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].Fasolino I, Izzo AA, Clavel T. et al. , Orally administered allyl sulfides from garlic ameliorate murine colitis, Mol. Nutr. Food Res 59 (2015) 434–442. 10.1002/mnfr.201400347 [DOI] [PubMed] [Google Scholar]
- [16].Calixio JB, Campos MM, Otuki MF, Santos AR, Anti inflammatory compounds of plant origin. Part II. modulation of pro inflammatory cytokines, chemokines, and adhesion molecules, Planta Med. 70 (2004) 93–103. 10.1055/s-2004-815483 [DOI] [PubMed] [Google Scholar]
- [17].Lee HS, Lee CH, Tsai HC, Salter DM, Inhibition of cyclooxygenase 2 expression by diallyl sulfide on joint inflammation induced by urate crystal and IL 1beta, Osteoarthritis Cartilage 17 (2009) 91–99. 10.1016/j.joca.2008.05.010 [DOI] [PubMed] [Google Scholar]
- [18].Farr JN, Xu M, Weivoda MM et al. , Targeting cellular senescence prevents age-related bone loss in mice, Nat. Med 23 (2017) 1072–1079. 10.1038/nm.4385 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Mody N, Parhami F. et al. , Oxidative stress modulates osteoblastic differentiation of vascular and bone cells. Free Radic Biol Med. 2001August15;31(4):509–19. doi: 10.1016/s0891-5849(01)00610-4. [DOI] [PubMed] [Google Scholar]
- [20].Xiao Z, Awad HA, Liu S. et al. , Selective Runx2-II deficiency leads to low-turnover osteopenia in adult mice, Dev. Biol 283 (2005) 245–356. 10.1016/j.ydbio.2005.04.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Nakashima K, Zhou X, Kunkel G, The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108 (2002) 17–29. 10.1016/S0092-8674(01)00622-5 [DOI] [PubMed] [Google Scholar]
- [22].Yang D, Okamura H, Nakashima Y, Haneji T, Histone Demethylase Jmjd3 Regulates Osteoblast Differentiation via Transcription Factors Runx2 and Osterix* J. Biol. Chem 288 (2013) 33530–33541. 10.1074/jbc.M113.497040 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.