Abstract
Detection of the Wolbachia endosymbiont in Aedes aegypti mosquitoes through real-time polymerase chain reaction assays is widely used during and after Wolbachia releases in dengue reduction trials involving the wMel and wAlbB strains. Although several different primer pairs have been applied in current successful Wolbachia releases, they cannot be used in a single assay to distinguish between these strains. Here, we developed a new diagnostic primer pair, wMwA, which can detect the wMel or wAlbB infection in the same assay. We also tested current Wolbachia primers and show that there is variation in their performance when they are used to assess the relative density of Wolbachia. The new wMwA primers provide an accurate and efficient estimate of the presence and density of both Wolbachia infections, with practical implications for Wolbachia estimates in field collected Ae. aegypti where Wolbachia releases have taken place.
Introduction
The bacterium, Wolbachia, is providing an increasingly popular method to inhibit dengue virus transmission in the mosquito, Aedes aegypti. Wolbachia-infected populations involving the wMel strain have now been successfully established in Ae. aegypti in regions including northern Australia, Brazil and Indonesia [1–3], while wAlbB-infected Ae. aegypti have been established in Malaysia [4]. Detection of the Wolbachia endosymbiont in Ae. aegypti mosquitoes is a standard requirement for good laboratory practice during Wolbachia mosquito releases in dengue reduction programs and for tracking Wolbachia invasions in the field [4, 5]. Real-time polymerase chain reaction (real-time PCR) and High Resolution Melt (HRM) assays (SYBR® equivalent/non-probe) have been developed that enable detection and Wolbachia density estimation for the strain of interest [6–8]. However, difficulties can arise in using these assays when there is a need to detect Wolbachia and distinguish between multiple Wolbachia strains. In experiments where superinfected lines are used [9], or where mosquitoes carrying different single infections need to be distinguished for experiments or in field collected samples [10], several real-time PCR assays using different primer pairs are currently required. Given that both wMel and wAlbB strains are now actively being used in field releases and that each strain may have advantages in particular situations, the requirement for multiple strain identification is likely to increase in the foreseeable future.
In previous work, we have used a Wolbachia-specific primer pair, w1 [7], which targets a conserved locus VNTR-141 containing tandem repeats [11]. This pair of primers works efficiently in amplifying wMel and wMelPop infections in a real-time PCR and HRM assay, but achieves poor amplification of wAlbB [10]. As well as being used for Wolbachia detection, primers are needed for quantification of Wolbachia density in mosquitoes. There are various Wolbachia specific primers for wMel, wAlbB or wMelPop [9, 12–14], but currently there is no standardized assay for Wolbachia screening that is comparable between strains and that can be used to compare results between laboratories. Although cross-laboratory comparability may not be a realistic aim when using a SYBR® equivalent/non-probe-based assay, the use of extra internal controls can make these assays robust for relative density estimates, improving consistency within laboratory experiments [7, 10].
In this study, we developed a diagnostic primer pair that can detect and distinguish between the wMel and wAlbB infections and also provides an estimate of Wolbachia density. In addition, we assessed primer efficiency of some other published primers for Wolbachia in mosquitoes. We also tested quantification cycle (Cq) [15] value differences between primers for different Wolbachia strains to assess primer suitability for relative Wolbachia density estimation.
Materials and methods
Diagnostic primer design
To develop the new primers, we screened for sequence differences between the wMel and wAlbB strains and then focused on the sequences of a DNA-directed RNA polymerase subunit beta/betagene with locus tag WD_RS06155 in wMel and its analogue in wAlbB. We then developed a new pair of primers designated wMwA (Table 1) to distinguish Wolbachia wMel and wAlbB in a single run of a real-time PCR assay, based on two base-pair mismatches at the 3’- end of each primer, which resulted in the Tm peak for wAlbB being separated from that of wMel. We checked the specificity of this primer pair by an initial test of six males and six females for each strain with different Wolbachia infection type (wMel- or wAlbB-infected or uninfected). Subsequent testing was done with female mosquitoes only.
Table 1. Primers for detection of Wolbachia strains and estimation of density.
| Primer name | Wolbachia status target | Targeted locus | Forward | Reverse | Amplicon size (bp) | Source |
|---|---|---|---|---|---|---|
| mos | uninfected | AF154067 | AGTTGAACGTATCGTTTCCCGCTAC | GAAGTGACGCAGCTTGTGGTCGTCC | 77 | [7] |
| aeg | uninfected | AF154067 | ATCAAGAAGCGCCGTGTCG | CAGGTGCAGGATCTTCATGTATTCG | 66 | [7] |
| w1 | wMel | VNTR 141 region | AAAATCTTTGTGAAGAGGTGATCTGC | GCACTGGGATGACAGGAAAAGG | 16 | [7] |
| wsp | wMel, wAlbB-infected | WD_RS04815 | GCATTTGGTTAYAAAATGGACGA | GGAGTGATAGGCATATCTTCAAT | 139 (wMel), 136 (wAlbB) | [9] |
| wMel | wMel-infected | WD_RS02275 | CAAATTGCTCTTGTCCTGTGG | GGGTGTTAAGCAGAGTTACGG | 68 | [9] |
| wAlbB | wAlbB-infected | DEJ70_RS01110 | CCTTACCTCCTGCACAACAA | GGATTGTCCAGTGGCCTTA | 109 | [9] |
| wMwA | wMel, wAlbB-infected | WD_RS06155 | GAAGTTGAAGCACAGTGTACCTT | GCTTGATATTCCTGTAGATTCATC | 155 (both) | Newly designed |
Sample preparation
The wMel and wAlbB-infected Ae. aegypti were tested for strains transinfected previously [16, 17]. The wMel strain was collected from Cairns, Australia in 2019 from regions that had been invaded several years earlier [2, 12], while the wAlbB strain was derived from a wAlbB infected strain crossed to an Australian background and maintained in the laboratory [13]. An uninfected strain was developed from Ae. aegypti eggs collected in Cairns, Queensland, Australia prior to Wolbachia releases [10, 18].
Female mosquitoes of wMel-infected [17], wAlbB-infected [16] and uninfected were reared with TetraMin® fish food tablets in reverse osmosis (RO) water until the adult stage [19], and then were killed in absolute ethanol before Chelex® DNA extraction. In the standard procedure, DNA of an individual female was extracted in 250 μL 5% Chelex® 100 Resin (Bio-Rad Laboratories, Hercules, CA) and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd, Alexandria NSW, Australia). The Chelex® 100 Resin solution containing DNA was centrifuged at 12500 rpm for 5 min and DNA solution was pipetted from the supernatant.
LightCycler® efficiency test
After extraction, DNA concentration was measured using a QubitTm 1X dsDNA HS Assay Kit and QubitTm 2.0 fluorometer (ThermoFisher Scientific, Waltham, MA USA), and then diluted ten times before making a three-fold dilution series to test the efficiency of currently-used Wolbachia primers in a real-time PCR assay (Table 1). We also diluted the solution six times before making a three-fold dilution series to investigate the influence of Chelex®-extracted DNA concentration.
For the real-time PCR and HRM, we used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat. No. 04909631001, Roche Diagnostics Australia Pty. Ltd., Castle Hill New South Wales, Australia) and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al. (2012) (S1 Table). We used 384-well plates with white wells (SSI Bio, Lodi CA USA, Cat. No. 3430–40), and the PCR conditions for DNA amplification beginning with a 10-minute pre-incubation at 95°C (Ramp Rate = 4.8°C/s), followed by 40 cycles of 95°C for 5 seconds (Ramp Rate = 4.8°C/s), 53°C for 15 seconds (Ramp Rate = 2.5°C/s), and 72°C for 30 seconds (Ramp Rate = 4.8°C/s).
Three technical replicates were run for each sample of each dilution and a graph was produced showing the log3 [dilution factor] (x-axis) against mean Cq (y-axis) and a linear trend line (y = mx + c) was fitted. Slope (m) and R2 values were recorded so that PCR amplification efficiency (E) could be evaluated with the equation:
Compare with Chelex® extraction, we also purified DNA from the above Chelex® 100 Resin solution using the PureLinkTM Quick PCR purification Kit (Invitrogen Cat. No. K3100-01), in which the binding buffer B2 was used. In addition, a different DNA extraction method was used: female mosquitoes were homogenized individually in 100 μL STE buffer (10 mM Tris-HCl pH8, 100 mM NaCl, 1mM EDTA), and then incubated at 95°C for 10 minutes. After these extractions, 10 μL supernatant was pipetted into 90 μL ddH2O and made a three-fold dilution series.
Primer quantification cycle comparison and density estimation
Following the efficiency study, we used a mixture of young (4±1days since eclosion) and old (38 ±1days since eclosion) female mosquitoes and tested for Cq value differences between primers for different Wolbachia strains to assess suitability for relative Wolbachia density estimation. A total of 16 Wolbachia-infected mosquito samples were extracted using Chelex® resin and then diluted ten times before real-time PCR.
Results and discussion
Diagnostic primer design
In this study, we developed a diagnostic primer pair, wMwA, that can detect and distinguish between the wMel and wAlbB infections in Aedes aegypti (Fig 1), which is important in simplifying current approaches for Wolbachia identification. In the initial test for the specificity of this primer pair, all uninfected samples were negative, and all Wolbachia-infected samples were positive with distinctive Tm values from Wolbachia wMel (82.6 ± 0.03°C) and wAlbB (80.4 ± 0.02°C) screening (Fig 1C). The high-resolution melt produces two joined peaks when the template contains both Wolbachia wMel and wAlbB DNA (Fig 1D).
Fig 1. Development of primers to detect Wolbachia wMel and wAlbB infection in Aedes aegypti.
(a) The new primer pair wMwA aligns to a region in gene WD_RS06155 of wMel, and also aligns to its analogue in the wAlbB genome which has two base-pair mismatches at the 3’- end; (b) the wMwA primers showed distinct Tm peaks for Wolbachia wMel and wAlbB. (c) the wMwA primers showed distinct Tm values for Wolbachia wMel (82.6 ± 0.03°C) and wAlbB (80.4 ± 0.02°C), the x axis represents the quantification cycle (Cq) and the y axis represents the amplicon melting temperature; (d) the wMwA primers showed two Tm peaks when mixing DNA templates of wMel and wAlbB-infected Ae. aegypti.
Primer efficiency test
We tested the efficiency of each of the primers for screening Wolbachia in Ae. aegypti by using a threefold dilution series. When template DNA was extracted in Chelex® 100 Resin solution, the efficiencies of all primers ranged from 86.4% to 104.9%, (Table 2 and Fig 2) and the efficiency curves all showed an R2 valued greater than 0.99.
Table 2. Primer efficiency for primer pairs used in detection of Wolbachia strains and estimation of density.
| Colony | Primers | Slope of graph | R2 | Efficiency | DNA concentration* (ng/μL) | Efficiency curve |
|---|---|---|---|---|---|---|
| Uninfected | mos | -1.566 | 0.999 | 101.659% | 5.12 | Fig 2A |
| Uninfected | aeg | -1.531 | 0.999 | 104.946% | 5.12 | Fig 2B |
| wMel | w1 | -1.644 | 0.999 | 95.109% | 5.24 | Fig 2C |
| wMel | wM | -1.677 | 0.998 | 92.559% | 5.24 | Fig 2D |
| wMel | wsp | -1.767 | 0.999 | 86.195% | 5.24 | Fig 2E |
| wMel | wMwA | -1.769 | 0.999 | 86.107% | 5.24 | Fig 2F |
| wAlbB | wA | -1.741 | 0.993 | 87.953% | 6.87 | Fig 2G |
| wAlbB | wsp | -1.755 | 0.999 | 87.032% | 6.87 | Fig 2H |
| wAlbB | wMwA | -1.730 | 0.997 | 88.732% | 6.87 | Fig 2I |
*Template DNA was extracted in 250 μL 5% Chelex® 100 Resin and then diluted ten times before making a three-fold dilution series. Concentration was measured before dilution.
Fig 2. Primer efficiency for detection of Wolbachia strains and estimation of density.
DNA was extracted in 250 μL 5% Chelex® 100 Resin and then diluted ten times before making a three-fold dilution series. The primer names are defined in Table 2.
However, we found the amplification curve increase showed inhibition at the first dilution (Fig 3) for each of the primers, particularly when DNA was first diluted six times instead of ten times, resulting in outliers (S1 and S2 Figs and S2 Table). These results highlight a potential risk of lowering the relative density estimate in Wolbachia screening when using a highly concentrated Chelex®-extracted DNA solution. We also found differences between primer efficiency when a different DNA extraction method was used, with changes ranging from -22.2% to 29% (S3 Table). Different DNA extraction methods may affect DNA yield and quality, and/or change PCR inhibitors and their effects, which can increase variation between host and parasite DNA [20–22]. It is, therefore, worth noting that new standard curves should be run when changing to a different DNA extraction method, given that the efficiency of primers can deviate substantially from recommendations (90% - 110%) [23, 24] to prevent an inaccurate estimate of relative density being made.
Fig 3. Variation in the shape of the PCR amplification curves.
The curves from left to right represent amplification curves of 1/10, 1/30, 1/90, 1/270 and 1/810 DNA dilution from initial extraction in 250 μL 5% Chelex® 100 Resin. The primers are defined in Table 2.
Cq value comparisons in Chelex® 100 Resin
We noticed that primers had different Cq values even when screening the same individual organism/endosymbiont (Ae. aegypti, wMel or wAlbB) and using the same DNA concentration, despite the efficiency of these primers all falling within 85% - 110%. We therefore tested the Cq ranges of the primers and correlated them with wsp. We found variation between these primers (Fig 2), which would be expected to result in differences in relative density estimates. The relationship between Cq values of different primers all fit into a linear relationship, with R2 greater than 0.97, whereas the coefficient varies from 0.83 to 1.05 (Fig 4). For the newly-designed primer pair wMwA, the coefficients for wMel and wAlbB are similar (0.97 for wMel and 1.04 for wAlbB).
Fig 4. Variation in Cq values when using different Wolbachia primers for the same samples.
Correlation of Cq values between (a) wA and wsp primers in Wolbachia wAlbB screening; (b) wMwA and wsp primers in Wolbachia wAlbB screening; (c) mos and aeg primers in Aedes aegypti screening; (d) wM and wsp primers in Wolbachia wMel screening; (e) wMwA and wsp primers in Wolbachia wMel screening; (f) w1 and wsp primers in Wolbachia wMel screening.
These primer differences could not be explained fully by pipetting error and PCR inhibition [25, 26]. Inhibition effects on DNA amplification can vary when using different primers, and/or when the DNA concentration varies. Intercepts of these Cq values ranged from -1.52 to 1.37 though all primers used in this study only have one copy based on their genomic sequences. However, it is possible that there may be different copies of Wolbachia genes inside mosquito cells [27, 28], such as is documented for the octomom region [29, 30] which can be variable under different environmental conditions [31, 32]. As a result, care is needed when choosing primers for assessing the relative concentration of Wolbachia.
In our study, the wsp primers represent a useful pair of universal primers for amplifying the Wolbachia surface protein gene which has been applied as a Wolbachia diagnostic for decades [14]. Given potential variation between Wolbachia primers, comparisons with universal Wolbachia primers should be undertaken before using the newly-designed primers in Wolbachia density calculations. Our newly-designed primer pair, wMwA, correlated with density estimates based on wsp, with coefficients for both wMel and wAlbB close to 1. Thus, this new primer pair has the potential to be accurate and efficient for large-scale Wolbachia detection and relatively density estimate.
Conclusions
Chelex® DNA extraction and real-time PCR provide an easy and economical approach for detecting both currently-released Wolbachia (wMel and wAlbB) infections in Aedes aegypti, while other options like multiplex probe assays and the use of DNA extraction kits are likely to cost more. Here, we designed a new primer pair, wMwA, which not only identifies wMel and wAlbB at the same time, but is also correlated with density estimates based on a universal Wolbachia primer wsp. We demonstrated this new primer pair has the potential to be accurate and efficient for large-scale Wolbachia detection and relatively density estimates, especially for use in field collected Ae. aegypti.
Supporting information
(DOCX)
(DOCX)
(DOCX)
DNA is extracted in 250 μL 5% Chelex® 100 Resin and then diluted six times before making a three-fold dilution series. Outliers are marked with red colour and are excluded from the efficiency curve. The primer names are defined in S3 Table.
(PNG)
The curves from left to right represent amplification curves of 1/6, 1/18, 1/54, 1/162 and 1/486 DNA dilution from 250 μL 5% Chelex® 100 Resin. The primers are defined in S2 Table.
(PNG)
Acknowledgments
We thank Perran A. Ross and Jason Axford for providing the mosquito samples. We also thank the support of the Jasper Loftus-Hills award, offered by the Faculty of Science, the University of Melbourne.
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
Ary A. Hoffmann is funded by the National Health and Medical Research Council (1132412, 1118640, www.nhmrc.gov.au). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Garcia GdA, Sylvestre G, Aguiar R, da Costa GB, Martins AJ, Lima JBP, et al. Matching the genetics of released and local Aedes aegypti populations is critical to assure Wolbachia invasion. PLoS Negl Trop Dis. 2019;13(1):e0007023. doi: 10.1371/journal.pntd.0007023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Hoffmann AA, Montgomery B, Popovici J, Iturbe-Ormaetxe I, Johnson P, Muzzi F, et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 2011;476(7361):454–7. doi: 10.1038/nature10356 [DOI] [PubMed] [Google Scholar]
- 3.Tantowijoyo W, Andari B, Arguni E, Budiwati N, Nurhayati I, Fitriana I, et al. Stable establishment of wMel Wolbachia in Aedes aegypti populations in Yogyakarta, Indonesia. PLoS Negl Trop Dis. 2020;14(4):e0008157. Epub 2020/04/18. doi: 10.1371/journal.pntd.0008157; PubMed Central PMCID: PMC7190183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nazni WA, Hoffmann AA, NoorAfizah A, Cheong YL, Mancini MV, Golding N, et al. Establishment of Wolbachia strain wAlbB in Malaysian populations of Aedes aegypti for dengue control. Curr Biol. 2019;29(24):4241–8. doi: 10.1016/j.cub.2019.11.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sikulu-Lord MT, Maia MF, Milali MP, Henry M, Mkandawile G, Kho EA, et al. Rapid and non-destructive detection and identification of two strains of Wolbachia in Aedes aegypti by near-infrared spectroscopy. PLoS Negl Trop Dis. 2016;10(6):e0004759. Epub 2016/07/01. doi: 10.1371/journal.pntd.0004759; PubMed Central PMCID: PMC4928868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Simoncini L, Casiraghi M, Bazzocchi C, Sacchi L, Bandi C, Genchi C. Real-time PCR for quantification of the bacterial endosymbionts (Wolbachia) of filarial nematodes. Parassitologia. 2001;43(4):173–8. Epub 2002/10/31. . [PubMed] [Google Scholar]
- 7.Lee SF, White VL, Weeks AR, Hoffmann AA, Endersby NM. High-throughput PCR assays to monitor Wolbachia infection in the dengue mosquito (Aedes aegypti) and Drosophila simulans. Appl Environ Microbiol. 2012;78(13):4740–3. doi: 10.1128/AEM.00069-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Berticat C, Rousset F, Raymond M, Berthomieu A, Weill M. High Wolbachia density in insecticide-resistant mosquitoes. Proc Biol Sci. 2002;269(1498):1413–6. Epub 2002/06/25. doi: 10.1098/rspb.2002.2022 ; PubMed Central PMCID: PMC1691032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Joubert DA, Walker T, Carrington LB, De Bruyne JT, Kien DHT, Hoang NLT, et al. Establishment of a Wolbachia superinfection in Aedes aegypti mosquitoes as a potential approach for future resistance management. PLoS Pathog. 2016;12(2):e1005434. doi: 10.1371/journal.ppat.1005434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lau MJ, Endersby-Harshman NM, Axford JK, Ritchie SA, Hoffmann AA, Ross PA. Measuring the host-seeking ability of Aedes aegypti destined for field release. Am J Trop Med Hyg. 2020;102(1):223–31. Epub 2019/11/27. doi: 10.4269/ajtmh.19-0510 ; PubMed Central PMCID: PMC6947783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Riegler M, Sidhu M, Miller WJ, O’Neill SL. Evidence for a global Wolbachia replacement in Drosophila melanogaster. Curr Biol. 2005;15(15):1428–33. doi: 10.1016/j.cub.2005.06.069 [DOI] [PubMed] [Google Scholar]
- 12.Hoffmann AA, Iturbe-Ormaetxe I, Callahan AG, Phillips BL, Billington K, Axford JK, et al. Stability of the wMel Wolbachia infection following invasion into Aedes aegypti populations. PLoS Negl Trop Dis. 2014;8(9):e3115. doi: 10.1371/journal.pntd.0003115 PubMed PMID: WOS:000342796600013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Axford JK, Ross PA, Yeap HL, Callahan AG, Hoffmann AA. Fitness of wAlbB Wolbachia infection in Aedes aegypti: parameter estimates in an outcrossed background and potential for population invasion. Am J Trop Med Hyg. 2016;94(3):507–16. doi: 10.4269/ajtmh.15-0608 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhou W, Rousset F, O’Neill S. Phylogeny and PCR–based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B Biol Sci. 1998;265(1395):509–15. doi: 10.1098/rspb.1998.0324 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22. Epub 2009/02/28. doi: 10.1373/clinchem.2008.112797 . [DOI] [PubMed] [Google Scholar]
- 16.Xi ZY, Khoo CCH, Dobson SL. Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 2005;310(5746):326–8. doi: 10.1126/science.1117607 PubMed PMID: WOS:000232670100056. [DOI] [PubMed] [Google Scholar]
- 17.Walker T, Johnson PH, Moreira LA, Iturbe-Ormaetxe I, Frentiu FD, McMeniman CJ, et al. The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature. 2011;476(7361):450–3. doi: 10.1038/nature10355 PubMed PMID: WOS:000294209400036. [DOI] [PubMed] [Google Scholar]
- 18.Lau MJ, Ross PA, Hoffmann AA. Infertility and fecundity loss of Wolbachia-infected Aedes aegypti hatched from quiescent eggs is expected to alter invasion dynamics. PLoS Negl Trop Dis. 2021;15(2):e0009179. Epub 2021/02/17. doi: 10.1371/journal.pntd.0009179; PubMed Central PMCID: PMC7909672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ross PA, Axford JK, Richardson KM, Endersby-Harshman NM, Hoffmann AA. Maintaining Aedes aegypti mosquitoes infected with Wolbachia. J Vis Exp. 2017;14(126):e56124. doi: 10.3791/56124 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fredricks DN, Smith C, Meier A. Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR. J Clin Microbiol. 2005;43(10):5122–8. doi: 10.1128/JCM.43.10.5122-5128.2005 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Demeke T, Ratnayaka I, Phan A. Effects of DNA extraction and purification methods on real-time quantitative PCR analysis of Roundup Ready soybean. J AOAC Int. 2009;92(4):1136–44. Epub 2009/09/01. . [PubMed] [Google Scholar]
- 22.Ruijter JM, Barnewall RJ, Marsh IB, Szentirmay AN, Quinn JC, van Houdt R, et al. Efficiency correction Is required for accurate quantitative PCR analysis and reporting. Clin Chem. 2021;67(6):829–42. Epub 2021/04/24. doi: 10.1093/clinchem/hvab052 . [DOI] [PubMed] [Google Scholar]
- 23.Moon K, Lee SH, Kim YH. Validation of quantitative real-time PCR reference genes for the determination of seasonal and labor-specific gene expression profiles in the head of western honey bee, Apis mellifera. PLoS One. 2018;13(7):e0200369. Epub 2018/07/10. doi: 10.1371/journal.pone.0200369; PubMed Central PMCID: PMC6037379. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Taylor SC, Nadeau K, Abbasi M, Lachance C, Nguyen M, Fenrich J. The ultimate qPCR experiment: producing publication quality, reproducible data the first time. Trends Biotechnol. 2019;37(7):761–74. Epub 2019/01/19. doi: 10.1016/j.tibtech.2018.12.002 . [DOI] [PubMed] [Google Scholar]
- 25.Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol. 2002;30(6):503–12. Epub 2002/06/14. doi: 10.1016/s0301-472x(02)00806-8 . [DOI] [PubMed] [Google Scholar]
- 26.Kontanis EJ, Reed FA. Evaluation of real-time PCR amplification efficiencies to detect PCR inhibitors. J Forensic Sci. 2006;51(4):795–804. Epub 2006/08/03. doi: 10.1111/j.1556-4029.2006.00182.x . [DOI] [PubMed] [Google Scholar]
- 27.Klappenbach JA, Dunbar JM, Schmidt TM. rRNA operon copy number reflects ecological strategies of bacteria. Appl Environ Microbiol. 2000;66(4):1328–33. doi: 10.1128/AEM.66.4.1328-1333.2000 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Schirrmeister BE, Dalquen DA, Anisimova M, Bagheri HC. Gene copy number variation and its significance in cyanobacterial phylogeny. BMC Microbiol. 2012;12:177. Epub 2012/08/17. doi: 10.1186/1471-2180-12-177; PubMed Central PMCID: PMC3552681. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chrostek E, Teixeira L. Within host selection for faster replicating bacterial symbionts. PloS One. 2018;13(1):e0191530-e. doi: 10.1371/journal.pone.0191530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chrostek E, Teixeira L. Mutualism breakdown by amplification of Wolbachia genes. PLoS Biol. 2015;13(2):e1002065. doi: 10.1371/journal.pbio.1002065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Bordenstein SR, Marshall ML, Fry AJ, Kim U, Wernegreen JJ. The tripartite associations between bacteriophage, Wolbachia, and arthropods. PLoS Pathog. 2006;2(5):e43. Epub 2006/05/20. doi: 10.1371/journal.ppat.0020043; PubMed Central PMCID: PMC1463016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chauvatcharin N, Ahantarig A, Baimai V, Kittayapong P. Bacteriophage WO-B and Wolbachia in natural mosquito hosts: infection incidence, transmission mode and relative density. Mol Ecol. 2006;15(9):2451–61. doi: 10.1111/j.1365-294X.2006.02947.x [DOI] [PubMed] [Google Scholar]




