Skip to main content
Journal of Veterinary Science logoLink to Journal of Veterinary Science
. 2021 Aug 3;22(5):e68. doi: 10.4142/jvs.2021.22.e68

Colistin resistance and plasmid-mediated mcr genes in Escherichia coli and Salmonella isolated from pigs, pig carcass and pork in Thailand, Lao PDR and Cambodia border provinces

Chanika Pungpian 1, Scarlett Lee 2, Suthathip Trongjit 1, Nuananong Sinwat 3, Sunpetch Angkititrakul 4, Rangsiya Prathan 1, Songsak Srisanga 1, Rungtip Chuanchuen 1,✉
PMCID: PMC8460466  PMID: 34423604

Abstract

Background

Colistin and carbapenem-resistant bacteria have emerged and become a serious public health concern, but their epidemiological data is still limited.

Objectives

This study examined colistin and carbapenem resistance in Escherichia coli and Salmonella from pigs, pig carcasses, and pork in Thailand, Lao PDR, and Cambodia border provinces.

Methods

The phenotypic and genotypic resistance to colistin and meropenem was determined in E. coli and Salmonella obtained from pigs, pig carcasses, and pork (n = 1,619). A conjugative experiment was performed in all isolates carrying the mcr gene (s) (n = 68). The plasmid replicon type was determined in the isolates carrying a conjugative plasmid with mcr by PCR-based replicon typing (n = 7). The genetic relatedness of mcr-positive Salmonella (n = 11) was investigated by multi-locus sequence typing.

Results

Colistin resistance was more common in E. coli (8%) than Salmonella (1%). The highest resistance rate was found in E. coli (17.8%) and Salmonella (1.7%) from Cambodia. Colistin-resistance genes, mcr-1, mcr-3, and mcr-5, were identified, of which mcr-1 and mcr-3 were predominant in E. coli (5.8%) and Salmonella (1.7%), respectively. The mcr-5 gene was observed in E. coli from pork in Cambodia. Two colistin-susceptible pig isolates from Thailand carried both mcr-1 and mcr-3. Seven E. coli and Salmonella isolates contained mcr-1 or mcr-3 associated with the IncF and IncI plasmids. The mcr-positive Salmonella from Thailand and Cambodia were categorized into two clusters with 94%–97% similarity. None of these clusters was meropenem resistant.

Conclusions

Colistin-resistant E. coli and Salmonella were distributed in pigs, pig carcasses, and pork in the border areas. Undivided-One Health collaboration is needed to address the issue.

Keywords: Drug resistance, swine, Thailand, Laos, Cambodia

INTRODUCTION

Antimicrobial resistance (AMR) is an ongoing One Health problem of global dimensions. The emergence and rapid spread of multidrug resistance (MDR) have complicated the AMR situation. Last-line antibiotics, e.g., polymyxins and carbapenems, have been used to treat infections involved in MDR Gram-negative bacterial pathogens. On the other hand, resistance to last-resort treatments has been increasingly reported [1], which has raised the alarm over the potentially limited treatment options in the near future.

Carbapenems are critically essential antimicrobials used to treat infections caused by MDR, including ESBL-producing Enterobacteriaceae [1]. Carbapenem-resistant Enterobacteriaceae (CRE) infections with high mortality have increased rapidly in hospitals [2], and CRE has also been observed in food animals [1]. Carbapenem resistance is commonly mediated by carbapenemase genes (e.g., blaKPC, blaNDM, blaVIM, blaIMP, and blaOXA), which are located on large conjugative plasmids carrying other resistance genes [3]. The coexistence of carbapenem and colistin resistance genes was reported in E. coli in patients and animals [1,4].

Colistin or polymyxin B is a last-resort antibiotic against MDR infections, especially CRE in humans [4]. The drug is used widely in pigs to treat intestinal infections caused by Escherichia coli, particularly post-weaning diarrhea [5]. Colistin resistance has been identified in pathogens from various sources, e.g., E. coli from pigs in China [5]; poultry in Argentina [6]; patients, pigs, and poultry in Cambodia [2]; and Salmonella from patients in Denmark [7]. Since the report of plasmid-mediated mcr-1 in E. coli and Klebsiella pneumoniae from animals and patients in China in 2016 [8], several mcr variants have been discovered [9]. Currently, the detection of plasmid-mediated colistin resistance is included in various national AMR monitoring and surveillance programs globally [10].

The coexistence of bla NDM-1 and mcr-1 was detected in E. coli from patients in China and Taiwan and CRE from broilers and pigs in China [1]. The cotransfer of carbapenem and colistin resistance genes located on different plasmids has been demonstrated [3]. These could contribute to the emergence and spread of superbugs no longer susceptible to any commercially available antibiotic.

Pig and pork production is one of the largest markets worldwide, and several antimicrobials are used to improve the quantity and quality of products [11]. This phenomenon also occurs in Southeast Asia border trade areas, where imports and exports of live animals and products are an important contributor to increased cross-border trade. As a borderless One Health threat, AMR in one region may pose a risk to public health, animal health, and environmental health within or outside the region. AMR monitoring and surveillance is the foundation for assessing the burden of AMR and providing information for strategic action to control and prevent threats and evaluate the strategic interventions. Many developing countries still lack national AMR surveillance. Epidemiological data on AMR and data on last-line antibiotics are insufficient, particularly in these areas. Therefore, this study examined the prevalence and genetics underlying the resistance to carbapenems and colistin in E. coli and Salmonella isolated from pigs, pig carcasses, and pork in Thailand, Lao PDR, and Cambodia border provinces.

MATERIALS AND METHODS

Sample collection and bacterial isolation

A total of 988 E. coli and 631 Salmonella isolates from pigs (n = 377 and 139), pig carcasses (n = 328 and 174), and pork (n = 283 and 318) were included. They were isolated previously as part of AMR epidemiological studies in food animals and products in Southeast Asia between 2014 and 2018 [12,13,14,15]. The E. coli and Salmonella isolates were obtained from Thailand (n = 508 and 276), Lao PDR (n = 351 and 237), and Cambodia (n = 129 and 118) (Table 1). The sampling sites were located in the provinces with the two largest border-crossing points between Thailand-Lao PDR (i.e., Nong Khai-Vientiane and Mukdahan-Savannakhet) and Thailand-Cambodia (i.e., Sa Kaeo-Banteay Meanchey).

Table 1. Source and number of E. coli and Salmonella isolates (n = 1,619).

Bacteria Country Provinces Sampling location Sample type No. of isolates Total
E. coli (n = 988) Thailand (n = 508) Nong Khai, Mukdahan, Sa Kaeo Slaughterhouse Pig rectal swab 180 508
Slaughterhouse Pig carcass swab 185
Retail meat market Pork 143
Lao PDR (n = 351) Vientiane, Savannakhet Slaughterhouse Pig rectal swab 115 351
Slaughterhouse Pig carcass swab 132
Retail meat market Pork 104
Cambodia (n = 129) Banteay Meanchey, Siem Reap Slaughterhouse Pig rectal swab 82 129
Slaughterhouse Pig carcass swab 11
Retail meat market Pork 36
Salmonella (n = 631) Thailand (n = 276) Nong Khai, Mukdahan, Sa Kaeo Slaughterhouse Pig rectal swab 58 276
Slaughterhouse Pig carcass swab 63
Retail meat market Pork 155
Lao PDR (n = 237) Vientiane, Savannakhet Slaughterhouse Pig rectal swab 59 237
Slaughterhouse Pig carcass swab 82
Retail meat market Pork 96
Cambodia (n = 118) Banteay Meanchey, Siem Reap Slaughterhouse Pig rectal swab 22 118
Slaughterhouse Pig carcass swab 29
Retail meat market Pork 67
Grand total 1,619

In the Thailand-Lao PDR border areas, the sampling sites included one municipal pig slaughterhouse and one municipal fresh market in each province. The slaughterhouses have large-scale facilities with a daily throughput of 50–200 or more pigs, and the municipal markets are located in the same area. In the Thailand-Cambodia border provinces, the samples were collected from three private pig slaughterhouses and one municipal fresh market in Sa Kaeo. The pig slaughterhouses are small-scale facilities producing pork for local consumption only. For the sampling sites in Cambodia, the samples were obtained from one municipal pig slaughterhouse and one municipal fresh market in Banteay Meanchey.

The rectal swabs were collected from the dead pigs immediately after bleeding but before the scalding process at the slaughterhouses. The pig carcass samples were obtained by swabbing the inner side of a half pig carcass from the neck to the bottom after the first whole carcass was cut lengthwise and divided into two halves. The pork samples were collected by swabbing at least 50 cm2 of raw meat at the retail fresh markets. Sample collection at the slaughterhouses and retail markets was performed by the authors' sample collection team consisting of laboratory staff and veterinarians trained in the same sampling protocol [16]. All samples collected were stored in an icebox and transported to the laboratory within 24 h after sampling.

The E. coli strains were isolated and confirmed biochemically [17]. The E. coli isolates were selected on MacConkey agar and Eosin Methylene Blue agar and confirmed by an indole test. One E. coli colony was collected from each positive sample. The Salmonella strains were isolated according to ISO6579:2002 (E) [18] and subjected to serotyping by slide agglutination [19]. A single colony of each serotype was collected from each positive sample. Forty-five serovars were included, of which the serovars Typhimurium and Rissen were most common (Table 2).

Table 2. Salmonella serovars from pig, pig carcass, and pork samples in Thailand, Lao PDR, and Cambodia border provinces in this study (n = 631).

Salmonella serovars No. of isolates
Thailand Lao PDR Cambodia Total
Pig Carcass Pork Sub total Pig Carcass Pork Sub total Pig Carcass Pork Sub total
Afula 2 2 2
Agona 1 1 1
Anatum 3 15 18 9 25 16 50 1 1 2 70
Braenderup 1 1 1
Chincol 1 1 1
Corvallis 21 21 21
Derby 4 4 4 3 10 17 3 6 9 30
Dessau 2 2 2
Doncaster 1 1 1
Duesseldort 4 4 4
Eindegi 1 6 2 9 9
Enteritidis 1 1 1 1 2
Fufu 1 1 1
Give 1 2 1 4 1 1 2 6
Havana 2 2 2
Hvittingfoss 2 2 1 1 3
Indians 1 1 1
Kedougou 11 4 11 26 26
Kentucky 1 1 1
Lexington 3 2 5 5
London 1 1 1
Mbandaka 1 1 1
Menden 1 1 1
Monschaui 2 2 2
Mowanjum 1 1 1
Newmexico 2 1 3 3
Norwish 1 1 1
Panama 1 2 3 1 1 4
Parathyphi 1 1 2 3 3 13 19 21
Preston 2 2 2
Readind 1 1 1
Rissen 11 20 16 47 7 11 17 35 4 42 46 128
Saintpaul 6 7 13 13
Schleissheim 1 1 2 2
Schwarzengrund 1 1 1
Singapore 2 1 3 3
Stanley 1 6 9 16 11 10 13 34 1 1 2 52
Stuttgart 1 1 1
Tsevie 2 2 2
Typhimurium 27 16 52 95 15 22 19 56 3 8 11 162
Urbana 2 2 2
Wandsworth 1 1 1
Warragul 1 1 2 2
Welterreden 1 6 4 11 5 3 1 9 1 1 21
Worthington 1 1 10 10 1 2 3 14
Total 58 63 154 276 59 82 96 237 22 29 67 118 631

Determination of colistin and meropenem susceptibility (n=1,619)

The minimum inhibitory concentrations (MICs) of colistin were determined using the agar dilution method [20]. The joint CLSI-EUCAST Polymyxin Breakpoints Working Group recommended the broth microdilution method for determining the colistin MIC. On the other hand, the plastic binding feature of colistin and the synergistic effects of polysorbate 80 with colistin have been observed [21]. The agar dilution method generates a comparable colistin MIC value to the broth microdilution method [21], but is superior in reproducibility, robustness, and user-friendliness. Therefore, the agar dilution method was used to determine the colistin MIC in this study. The colistin concentration range was 0.125–64 μg/mL with an MIC breakpoint of 2 μg/mL [22]. E. coli ATCC25922, Staphylococcus aureus ATCC29213, and Pseudomonas aeruginosa ATCC27853 served as the quality control strains.

Carbapenemase production was screened by the disk diffusion method using meropenem disks (10 µg) [20] and confirmed using the modified Hodge test (MHT) with meropenem (10 µg). E. coli ATCC25922 was the control strain.

PCR and DNA sequencing analysis

The total DNA prepared by whole-cell boiling was used as a PCR template [23]. Table 3 lists all the primers used. The PCR products were purified using Nucleospin Gel and PCR clean up (Macherey-Nagel, Germany) and submitted for DNA sequencing using the PCR primers (First Base Laboratories, Selangor Darul Ehsan, Malaysia). The nucleotide sequences were analyzed by a comparison to the published sequences available at the NCBI website.

Table 3. Primers used in this study.

Target Primer Primer sequenc (5′-3′) Product size (bp) Reference
MCR
Multiplex mcr1-F AGTCCGTTTGTTCTTGTGGC 320 [24]
mcr1-R AGATCCTTGGTCTCGGCTTG
mcr2-F CAAGTGTGTTGGTCGCAGTT 715 [24]
mcr2-R TCTAGCCCGACAAGCATACC
mcr3-F AAATAAAAATTGTTCCGCTTATG 929 [24]
mcr3-R AATGGAGATCCCCGTTTTT
mcr4-F TCACTTTCATCACTGCGTTG 1116 [24]
mcr4-R TTGGTCCATGACTACCAATG
mcr5-F ATGCGGTTGTCTGCATTTATC 1644 [24]
mcr5-R TCATTGTGGTTGTCCTTTTCTG
Carbapenemase genes
Multiplex blaIMP-F GGAATAGAGTGGCTTAAYTCTC 232 [25]
blaIMP-R GGTTTAAYAAAACAACCACC
blaVIM-F GATGGTGTTTGGTCGCATA 390 [25]
blaVIM-R CGAATGCGCAGCACCAG
blaOXA-F GCGTGGTTAAGGATGAACAC 477 [25]
blaOXA-R CATCAAGTTCAACCCAACCG
blaNDM-F GGTTTGGCGATCTGGTTTTC 621 [25]
blaNDM-R CGGAATGGCTCATCACGATC
blaKPC-F CGTCTAGTTCTGCTGTCTTG 798 [25]
blaKPC-R CTTGTCATCCTTGTTAGGCG
PBRT
Multiplex 1 HI1-F GGAGCGATGGATTACTTCAGTAC 471 [27]
HI1-R TGCCGTTTCACCTCGTGAGTA
HI2-F TTTCTCCTGAGTCACCTGTTAACAC 644 [27]
HI2-R GGCTCACTACCGTTGTCATCCT
I1-F CGAAAGCCGGACGGCAGAA 139 [27]
I1-V TCGTCGTTCCGCCAAGTTCGT
Multiplex 2 X-F AACCTTAGAGGCTATTTAAGTTGCTGAT 376 [27]
X-R TGAGAGTCAATTTTTATCTCATGTTTTAGC
L/M-F GGATGAAAACTATCAGCATCTGAAG 785 [27]
L/M-R CTGCAGGGGCGATTCTTTAGG
N-F GTCTAACGAGCTTACCGAAG 559 [27]
N-R GTTTCAACTCTGCCAAGTTC
Multiplex 3 FIA-F CCATGCTGGTTCTAGAGAAGGTG 462 [27]
FIA-R GTATATCCTTACTGGCTTCCGCAG
FIB-F GGAGTTCTGACACACGATTTTCTG 702 [27]
FIB-R CTCCCGTCGCTTCAGGGCATT
W-F CCTAAGAACAACAAAGCCCCCG 242 [27]
W-R GGTGCGCGGCATAGAACCGT
Multiplex 4 Y-F AATTCAAACAACACTGTGCAGCCTG 765 [27]
Y-R GCGAGAATGGACGATTACAAAACTTT
P-F CTATGGCCCTGCAAACGCGCCAGAAA 534 [27]
P-R TCACGCGCCAGGGCGCAGCC
FIC-F GTGAACTGGCAGATGAGGAAGG 262 [27]
FIC-R TTCTCCTCGTCGCCAAACTAGAT
Multiplex 5 A/C-F GAGAACCAAAGACAAAGACCTGGA 465 [27]
A/C-R ACGACAAACCTGAATTGCCTCCTT
T-F TTGGCCTGTTTGTGCCTAAACCAT 750 [27]
T-R CGTTGATTACACTTAGCTTTGGAC
FIIS-F CTGTCGTAAGCTGATGGC 270 [27]
FIIS-R CTCTGCCACAAACTTCAGC
Simplex 1 FrepB-F TGATCGTTTAAGGAATTTTG 270 [27]
FrepB-R GAAGATCAGTCACACCATCC
Simplex 2 K-F GCGGTCCGGAAAGCCAGAAAAC 160 [27]
K-R TCTTTCACGAGCCCGCCAAA
Simplex 3 B/O-F GCGGTCCGGAAAGCCAGAAAAC 159 [27]
B/O-R TCTGCGTTCCGCCAAGTTCGA
MLST fimA-F TCAGGGGAGAAACAGAAAACTAAT 760 [28]
fimA-R TCCCCGATAGCCTCTTCC
manB-F CCGGCACCGAAGAGA 893 [28]
manB-R CGCCGCCATCCGGTC
mdh-F ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 849 [28]
mdh-R ATATCTTTYTTCAGCGTATCCAGCAT

PBRT, polymerase chain reaction-based replicon typing; MLST, multi-locus sequence typing.

All bacterial isolates (n = 1,619) were screened for colistin-resistance encoding genes, including mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5 using multiplex PCR with the specific primers [24]. Representatives of PCR amplicons were purified and submitted for DNA sequencing to confirm the specificity of PCR amplification. The DNA sequences obtained were deposited in the GenBank database, of which the accession numbers are as follows: mcr-1, MW314264; mcr-3, MW314265; mcr-5, MW314266.

Carbapenem-resistance encoding genes were detected in all bacterial isolates using multiplex PCR with the specific primers [25], including blaIMP, blaVIM, blaOXA, blaNDM-1, and blaKPC.

Conjugation experiments and plasmid replicon typing

A biparental mating experiment was performed in all mcr-positive E. coli and Salmonella isolates. All mcr-carrying E. coli (n = 57) were used as donors and spontaneous rifampicin-resistant Salmonella Enteritidis SE12 (SE12rifr, MIC = 256 µg/mL) was used as the recipient [26]. The transconjugants were selected on LB agar containing rifampicin (32 µg/mL) with colistin (2 µg/mL) and confirmed to be Salmonella on brilliant green agar and xylose lysine deoxycholate agar (Difco, MD, USA) containing 2 µg/mL colistin. For all mcr-positive Salmonella isolates (n=11), the spontaneous rifampicin-resistant E. coli K12 strain MG1655 (MG1655rifr) was used as the recipient [26]. The transconjugants were selected on LB agar containing rifampicin (32 µg/mL) with colistin (2 µg/mL) and confirmed to be E. coli on MacConkey agar and Eosin Methylene Blue agar (Difco, MD) containing 2 µg/mL colistin. The presence of the corresponding genes in all transconjugants was confirmed by PCR using specific primers as described above.

The plasmid Inc groups were determined in all the isolates containing the conjugative plasmid by a PCR-based replicon typing (PBRT) [27]. Eighteen plasmid Inc groups were detected using five multiplex PCR (i.e., HI1/HI2/I1-Iγ; X/L-M/N; FIA/FIB/W; Y/P/FIC and A-C/T/FIIA) and three simplex PCR (i.e., F, K, and B/O).

Salmonella phylogenetic analysis

All mcr-positive Salmonella (n = 11) were characterized for the phylogenetic groups by multi-locus sequence typing (MLST). Three housekeeping genes, fimA, manB, and mdh were PCR amplified as described previously [28]. All PCR products were purified and submitted for nucleotide sequencing. The obtained sequences were assembled and proofread using the DNASTAR program [29] and aligned using the MUSCLE options in MEGA-X software [30]. A phylogenetic tree with 1000 bootstrap replicates was constructed based on the concatenated alignment of fimA, manB, and mdh sequences using the Neighbor-Joining (NJ) method [28]. The Maximum Composite Likelihood method was used to calculate the evolutionary distances [30]. All positions containing gaps and missing data were removed for each sequence pair. The final data set contained 18,129 positions. Evolutionary analyses were conducted using MEGA X [30].

Statistical analysis

Statistical analysis was performed using the SPSS version 22.0 (IBM Corporation) program. A chi-squared test was used to compare the AMR phenotype and genotype. The statistical significance (p < 0.05) of the differences between the AMR phenotypic and genotypic percentage was determined.

RESULTS

Phenotypic resistance to colistin and meropenem (n=1,619)

Table 4 lists the colistin resistance rates of E. coli and Salmonella from Thailand, Lao PDR, and Cambodia. The prevalence of colistin-resistant E. coli was higher than that of Salmonella in all countries (p < 0.05). Colistin resistance was commonly observed in either E. coli (17.8%; 23/129) or Salmonella (1.7%; 2/118) from Cambodia (p < 0.05). When considering the sample sources, colistin-resistant E. coli were most common in pigs in Thailand (9.4%; 17/180), Lao PDR (7.8%; 9/115), and Cambodia (22%; 18/82). Colistin-resistant Salmonella was identified most frequently in pigs in Thailand (3.4%; 2/58) and Cambodia (4.5%; 1/22) (Table 4). None of the isolates in this collection was meropenem resistant.

Table 4. Colistin resistance rates of E. coli and Salmonella from pigs, pig carcasses, and pork in Thailand, Lao PDR, and Cambodia (n = 1,619).

Bcateria Resistance rate* Grand total
Thailand Lao PDR Cambodia
Pig Carcass Pork Total Pig Carcass Pork Total Pig Carcass Pork Total
E. coli 9.4% (17/180) 5.4% (10/185) 7.7% (11/143) 7.5%†,§ (38/508) 7.8% (9/115) 6.1% (8/132) 1.9% (2/104) 5.4%†,§ (19/351) 22% (18/82) 9.1% (1/11) 11.1% (4/36) 17.8%†,∥ (23/129) 8% (80/988)
Salmonella 3.4% (2/58) 0 (0) 0.6% (1/155) 1.1%‡,§ (3/276) 0 (0) 1.2% (1/83) 0 (0) 0.5%‡,§ (1/218) 4.5% (1/22) 0 (0) 1.5% (1/67) 1.7%‡,∥ (2/118) 1% (6/631)

*In parenthesis, Number of colistin-resistant isolates/Number of bacterial isolates from each source; †,‡values bearing a different superscript in the same column are significantly different (p < 0.5); §,∥values bearing a different superscript in the same row are significantly different (p < 0.5).

Distribution of mcr genes (n = 1,619)

Of the E. coli isolates (n = 988), 57 isolates (5.8%; 57/988) carried at least one mcr gene, including the isolates from Thailand (3.5%; 18/508), Lao PDR (6%; 21/351), and Cambodia (14%; 18/129) (Table 5). The percentage of mcr-carrying E. coli isolates in Cambodia was significantly higher than in Thailand and Lao PDR (p < 0.05). The mcr genes were most common among the pig isolates (8.8%; 33/377), followed by the pig carcasses (4.3%; 14/328), and pork (3.5%; 10/283) isolates and corresponded to the colistin resistance phenotype. The percentage of mcr-carrying E. coli from pigs was significantly higher than pork (p < 0.05). The mcr-1 gene was predominant (56.1%; 32/57), followed by mcr-3 (38.6%; 22/57), mcr-1/mcr-3 (3.5%; 2/57), and mcr-5 (1.8%; 1/57). The mcr genes were identified more commonly among E. coli (5.8%; 57/988) than the Salmonella (1.7%; 11/631) isolates (p < 0.05). No mcr-2 and mcr-4 genes were detected.

Table 5. Presence and transfer of mcr genes in E. coli and Salmonella (n = 1,619).

Bacteria Country mcr-gene Sample source MIC (µg/mL) No. of isolates (%) Transferability*
E. coli (n = 988) Thailand (n = 508) mcr-1 Pig 8 4 -
Pig carcass 0.5, 8 3 + (1)
Pork 4 1 + (1)
mcr-3 Pig 4–8 6 -
Pig carcass 0.5 1 -
Pork 8 1 + (1)
mcr-1/ mcr-3 Pig 1 2 -
Subtotal 18 (4%)†
Lao PDR (n = 351) mcr-1 Pig 8 3 -
Pig carcass 4–8 6 -
Pork 4–8 2 -
mcr-3 Pig 4–8 5 + (1)
Pig carcass 2–8 3 -
Pork 0.5–4 2 -
Subtotal 21 (6%)†
Cambodia (n = 129) mcr-1 Pig 8–16 10 -
Pig carcass 8 1 -
Pork 4–8 2 -
mcr-3 Pig 4 3 -
Pork 0.5 1 -
mcr-5 Pork 2 1 -
Subtotal 18 (14%)‡
Grand total 57 (6%)§
Salmonella (n = 631) Thailand (n = 276) mcr-1 Pig 1 1 -
mcr-3 Pig 1–8 3 + (2)
Pork 1–2 2 -
Subtotal 6 (2.2%)
Cambodia (n = 118) mcr-3 Pig 0.5–4 4 + (1)
Pork 4 1 -
Subtotal 5 (4.2%)
Grand total 11 (2.8%)∥

MIC, minimum inhibitory concentration.

*The number indicates the colistin-resistant isolate that can transfer mcr; †,‡Values for E. coli from different countries bearing a different superscript in the same column are significantly different (p ≤ 0.05); §,∥Values for E. coli and Salmonella bearing a different superscript in the same column are statistical different (p ≤ 0.05).

The co-occurrence of mcr-1/mcr-3 was detected in two colistin-susceptible isolates (colistin MIC = 1 µg/mL) from pigs in Thailand. To the best of the authors' knowledge, this is the first report of mcr-5 in pork isolates in Cambodia (colistin MIC=2 µg/mL).

In Salmonella (n = 631), 11 isolates (1.7%; 11/631) were positive to at least one mcr gene tested, including six Thai (2.2%; 6/276) and five Cambodian (4.2%; 5/118) isolates. The mcr genes were more common in the pig isolates than the pork isolates (p < 0.05). The mcr-3 gene (90.9%; 10/11) was most common, followed by mcr-1 (9.1%; 1/11). None was positive to mcr-2, mcr-4, or mcr-5.

None of the E. coli and Salmonella isolates were positive to the carbapenem-resistance genes tested.

Horizontal transfer and plasmid replicon typing of mcr gene carrying isolates

Two E. coli isolates from pig carcass and pork in Thailand were mcr-1 transferred conjugally to Salmonella recipients. The mcr-3 gene in two E. coli isolates (one from Thai pork and the others from a Laos pig) and three Salmonella (two from Thai pigs and one from Cambodian pig) were transferred horizontally. All the isolates were resistant to colistin (colistin MIC = 4–8 µg/mL) and harbored the IncF plasmid. The mcr-conjugative plasmids were in the IncF and IncI groups (Table 6).

Table 6. Characteristics of E. coli and Salmonella transconjugant (n = 7).

Bacteria Country Sample MIC (µg/mL) Bacterial donor Bacterial recipient
mcr gene Inc group mcr gene Inc group
E. coli Thailand Carcass 8 mcr-1 IncI, IncFIB, IncFrepB mcr-1 IncI
E. coli Thailand Pork 4 mcr-1 IncFrepB mcr-1 IncFrepB
E. coli Thailand Pork 8 mcr-3 IncY, IncFrepB mcr-3 IncFrepB
E. coli Lao PDR Pig 8 mcr-3 IncFrepB mcr-3 IncFrepB
Salmonella Thailand Pig 8 mcr-3 IncI, IncFIB mcr-3 IncI
Salmonella Thailand Pig 8 mcr-3 IncI, IncFIB mcr-3 IncI
Salmonella Cambodia Pig 4 mcr-3 IncFrepB mcr-3 IncFrepB

MIC, minimum inhibitory concentration.

Evolutionary relationship among mcr-carrying Salmonella

The NJ phylogenetic tree showed that mcr-carrying Salmonella isolates (n = 11) could be classified into two clusters, Clusters A and B (Table 7). The percentage similarity within each cluster ranged from 94% to 97%, and the average branch lengths of the Salmonella isolates within the same cluster ranged from 0.00 to 0.01 (Fig. 1). The phylogenetic cluster A (n = 7) was predominant, including four isolates from Thailand [S. Typhimurium from pigs (n = 2), S. Kedougou from pork (n = 1), and S. Rissen from a pig (n = 1)] and three isolates from Cambodia [S. Parathyphi from pigs (n = 2) and S. Kentucky from a pig (n = 1)]. Cluster B contained four Salmonella isolates, including three isolates from Thailand [S. Typhimurium from a pig (n = 1), S. Huettwillen from a pig (n = 1), and S. Rissen from pork (n = 1)], and one isolate from Cambodia [S. Typhimurium from pork (n = 1)].

Table 7. Cluster and characteristics of selected Salmonella in multi-locus sequence typing (n = 11).

Cluster Salmonella Country Source mcr gene
Serovars (n = 11)
A Parathyphi (n = 2) Cambodia Pig mcr 3
Kentucky (n = 1) Cambodia Pig mcr 1
Typhimurium (n = 2) Thailand Pig mcr 3
Kedougou (n = 1) Thailand Pork mcr 3
Rissen (n = 1) Thailand Pig mcr 1
B Typhimurium (n = 1) Cambodia Pig mcr 3
Typhimurium (n = 1) Cambodia Pork mcr 3
Huettwillen (n = 1) Thailand Pig mcr 3
Rissen (n = 1) Thailand Pork mcr 3

Fig. 1. Phylogenetic tree of the Salmonella isolates (n = 11). Phylogenetic analysis was based on the alignment of the three multi-locus sequence typing genes (manB, mdh, and fimA) sequenced. The sequence was aligned by the MUSCLE options in MEGA-X, and a phylogenic tree was constructed using the neighbor-joining method. The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.

Fig. 1

DISCUSSION

One of the major findings of this study was the presence of colistin-resistant E. coli and Salmonella harboring mcr in pigs, pig carcasses, and pork, indicating the circulation of colistin-resistant bacteria and genes in the pig production chain in the region. A previous study reported that flattening pigs entering slaughterhouses acted as vehicles for colistin-resistant bacteria distribution to the slaughterhouse environment [31]. This agrees with the observation of a high percentage of colistin-resistant E. coli in pigs in this study. Pig carcasses might be contaminated with resistant bacteria during the slaughtering process that is transferred to the pork in the retail meat markets [32]. The resistant bacteria may spread to workers at pig farms or slaughterhouses and butchers at the retail markets by direct contact and the food chain. These results show that the circulation of colistin-resistant bacteria in the pig and pork production chain is a potential route for introducing resistant bacteria to humans and the environment [32].

For Thailand, the colistin-resistant E. coli (7.5%) in this study was more common than a previous study reporting the absence of colistin-resistant E. coli in pig farms in other provinces of Northeastern Thailand [11]. Although the extent of antimicrobial use is largely unclear, the results may reflect the increase in colistin consumption in pig production in the area [31]. This discrepancy might be associated with diverse sources and different geographical origins of the samples as well. Furthermore, colistin resistance could be the result of co-selection caused by other antimicrobials. A previous study in E. coli showed that host cationic antimicrobial peptides (e.g., LL-37 and lysozyme) could promote cross-resistance to polymyxins, possibly explaining the spread of colistin resistance in the limited colistin use [33]. In contrast, the percentage of colistin resistance in Cambodia (17.8%) was significantly higher than that in Thailand (7.5%) and Lao PDR (5.4%), but was slightly lower than a previous study in Cambodia [34]. This may be because of the higher use of colistin and other antimicrobial drugs in the country, which agrees with a previous study showing that the greater use and longer application of antimicrobials in pig feed on farms may increase the AMR prevalence in Cambodia [34].

The phenotypic colistin resistance and mcr in E. coli are more common than that in Salmonella (p < 0.05). A previous study reported that the resistance rates to antimicrobials in different classes in E. coli were frequently higher than those in Salmonella [35]. E. coli are commensals existing in the intestinal tract of all animals and have a longer contact duration to antimicrobials administered to animals than Salmonella. Therefore, they have greater effectiveness in the development of resistance to antimicrobials than Salmonella [36]. In addition, AMR development in E. coli is affected more by the antimicrobials used than in Salmonella under the same condition [36].

The mcr-1 and mcr-3 genes were predominant mcr variants in this study. The mcr-1 gene was most common among colistin-resistant E. coli (59.6%), which agrees with a previous study in pigs in China [31]. This gene has been detected in E. coli and Salmonella from humans and livestock in most parts of the world, including Asia (e.g., China) [32], Europe (e.g., Spain) [9], America (e.g., Argentina) [6] and South Africa (e.g., Algeria) [37]. The mcr-1 gene was located on a conjugative plasmid, supporting its wide presence in E. coli and Salmonella. On the other hand, it was previously reported that mcr-1 is stable and can be transferred without selective pressure from colistin [33]. The mcr-3 gene was found in the E. coli and Salmonella isolates from pigs, pig carcasses, and pork in Thailand and Cambodia but was predominant among colistin-resistant Salmonella (10/11). Previous studies reported mcr-3 in Salmonella in patients in Canada [38] and Denmark [7] who traveled to Thailand and E. coli and Klebsiella pneumoniae in patients in Thailand [39]. Plasmids carrying mcr-3 were previously observed in E. coli from pigs in China and Malaysia, of which its sequence was similar to that in K. pneumoniae patient isolates in Thailand [40]. These data indicate the worldwide spread of mcr-3 in humans and animals. An E. coli isolate from pork in Cambodia carried mcr-5. The mcr-5 gene was previously detected in E. coli from pigs and poultry in China and Spain [9], suggesting the wide distribution of mcr-5. To the best of the authors' knowledge, this is the first report of mcr-5 in E. coli from pork in Cambodia.

The coexistence of mcr-1 and mcr-3 was observed in E. coli from pigs in Thailand, which concurs with previous studies in Taiwan and China [41]. Almost all E. coli and Salmonella isolates carrying individual mcr-1 or mcr-3 were resistant to colistin (MIC≥2 µg/mL), suggesting that the presence of mcr in these isolates corresponded well to the colistin resistance phenotype. In contrast, the E. coli isolates carrying mcr-1/mcr-3 were susceptible to colistin (MIC = 1 µg/mL), which is in agreement with the study in China [41], supporting the premise that the coexistence of mcr in a single E. coli isolate does not generate a cumulative effect on colistin susceptibility [41]. These results indicate that the contribution of mcr to the colistin resistance phenotype varies and that the mcr genes should be screened in either colistin-susceptible or resistant isolates.

In this study, transconjugants (n = 7) harbored the mcr gene on the IncF (n = 4) or IncI (n = 3) plasmids, which is in agreement with a previous study demonstrating IncF, IncI, IncHI2, and IncX4 plasmids carrying the mcr-1 and mcr-3 [42]. The IncF plasmid is associated with several resistance genes worldwide. Overall, these observations highlight the potential distribution of mcr genes globally.

The prevalence of mcr genes in E. coli and Salmonella from Cambodia was significantly higher than in Thailand and Lao PDR, which agrees with the colistin resistance phenotype observed and suggests that the colistin resistance phenotype was being driven by the presence of the mcr genes [1]. Such higher prevalence may be associated with the use of colistin and antimicrobial drugs in other classes on-farm, resulting in the preservation and transfer of the genes [11].

Infection with mcr-carrying Salmonella may be difficult to treat and result in treatment failure. Knowledge of the genetic relatedness of mcr-harboring Salmonella will increase the understanding of their transmission mode [28]. In this study, all mcr-positive Salmonella were categorized into two clusters by MLST. Each cluster contained the pig and pork isolates from Thailand and Cambodia. The close similarity within the same cluster suggests the clonal expansion of mcr-positive Salmonella between the two countries. The mcr-positive Salmonella in Thailand and Cambodia were categorized into two clusters, possibly due to the multiple and independent acquisitions of mcr in bacteria in the same geographical area. This is similar to a study in China where mcr-1 was harbored by multiple clones of E. coli isolates (e.g., ST10, ST101, and ST410) from hospital sewage water [43]. E. coli ST624 with mcr-1 isolates from a patient in South Africa was identified in E. coli from poultry in Spain and Japan [44]. Overall, these observations suggest that mcr-1 has circulated among different bacterial clones within and across countries, which may occur by diverse independent acquisitions of mcr-carrying plasmids [43].

CRE has spread globally and was previously reported in patients in the study areas [2]. In contrast, all E. coli isolates in this study were susceptible to meropenem and were not positive to any carbapenem resistance gene tested. Carbapenems are not approved for use in livestock in any country, resulting in minimized selective pressure conditions [3]. Simultaneously, carbapenem use is uncommon in livestock production in the region, due mainly to their high cost.

In summary, colistin resistance was detected in E. coli and Salmonella isolated from pigs, pig carcasses, and pork in Thailand, Lao PDR, and Cambodia border areas. The mcr-1, mcr-3, and mcr-5 genes were found. Moreover, mcr-1 and mcr-3 co-occurred in the same E. coli isolates from pigs. The mcr-1 and mcr-3 genes were transferred horizontally, while resistance to meropenem was absent. Monitoring and surveillance of the resistance to last-line antibiotics at the phenotypic and genotypic levels should be encouraged as a collaboration between countries. Further study to characterize the genetic structure of mcr-carrying plasmids is currently underway.

ACKNOWLEDGEMENTS

The authors wish to thank Dr. Tanittha Chatsuwan, department of microbiology, Chulalongkorn University, for providing control strains for blaKPC, blaNDM-1, blaOXA, blaIMP, and blaVIM.

Footnotes

Funding: This work was supported by TRF Basic Research Grant BRG6080014 co-funded by Thailand Research Fund (TRF), the Faculty of Veterinary Science, and Chulalongkorn University. The work was also partially supported by the 90th anniversary-Ratchadaphiseksomphot Endowment Fund and Chulalongkorn University-the One Health Research Cluster. CP is a recipient of a RGJ Ph.D. program PHD/0054/2558, co-funded by the TRF and Chulalongkorn University.

Conflict of Interest: The authors declare no conflicts of interest.

Author Contributions:
  • Conceptualization: Chuanchuen R, Angkititrakul S, Pungpian C.
  • Data curation: Pungpian C, Lee S, Trongjit S, Sinwat N.
  • Formal analysis: Chuanchuen R, Pungpian C.
  • Funding acquisition: Chuanchuen R.
  • Investigation: Chuanchuen R, Angkititrakul S, Pungpian C, Lee S, Trongjit S, Sinwat N, Prathan R, Srisanga S.
  • Methodology: Chuanchuen R, Angkititrakul S, Pungpian C, Lee S, Trongjit S, Sinwat N, Prathan R, Srisanga S.
  • Project administration: Chuanchuen R.
  • Resources: Chuanchuen R, Angkititrakul S.
  • Software: Chuanchuen R, Pungpian C.
  • Supervision: Chuanchuen R.
  • Validation: Chuanchuen R, Angkititrakul S, Pungpian C, Lee S, Trongjit S, Sinwat N, Prathan R, Srisanga S.
  • Visualization: Chuanchuen R.
  • Writing - original draft: Chuanchuen R, Pungpian C.
  • Writing - review & editing: Chuanchuen R, Angkititrakul S, Pungpian C, Lee S, Trongjit S, Sinwat N, Prathan R, Srisanga S.

References

  • 1.Peng Z, Li X, Hu Z, Li Z, Lv Y, Lei M, et al. Characteristics of carbapenem-resistant and colistin-resistant Escherichia coli co-producing NDM-1 and MCR-1 from pig farms in China. Microorganisms. 2019;7(11):482. doi: 10.3390/microorganisms7110482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Atterby C, Osbjer K, Tepper V, Rajala E, Hernandez J, Seng S, et al. Carriage of carbapenemase- and extended-spectrum cephalosporinase-producing Escherichia coli and Klebsiella pneumoniae in humans and livestock in rural Cambodia; gender and age differences and detection of blaOXA-48 in humans. Zoonoses Public Health. 2019;66(6):603–617. doi: 10.1111/zph.12612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Long H, Feng Y, Ma K, Liu L, McNally A, Zong Z. The co-transfer of plasmid-borne colistin-resistant genes mcr-1 and mcr-3.5, the carbapenemase gene blaNDM-5 and the 16S methylase gene rmtB from Escherichia coli . Sci Rep. 2019;9(1):696. doi: 10.1038/s41598-018-37125-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liu L, Feng Y, Zhang X, McNally A, Zong Z. New variant of mcr-3 in an extensively drug-resistant Escherichia coli clinical isolate carrying mcr-1 and bla NDM-5 . Antimicrob Agents Chemother. 2017;61(12):e01757-17. doi: 10.1128/AAC.01757-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wang Z, Fu Y, Schwarz S, Yin W, Walsh TR, Zhou Y, et al. Genetic environment of colistin resistance genes mcr-1 and mcr-3 in Escherichia coli from one pig farm in China. Vet Microbiol. 2019;230:56–61. doi: 10.1016/j.vetmic.2019.01.011. [DOI] [PubMed] [Google Scholar]
  • 6.Dominguez JE, Redondo LM, Figueroa Espinosa RA, Cejas D, Gutkind GO, Chacana PA, et al. Simultaneous carriage of mcr-1 and other antimicrobial resistance determinants in Escherichia coli from poultry. Front Microbiol. 2018;9:1679. doi: 10.3389/fmicb.2018.01679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Litrup E, Kiil K, Hammerum AM, Roer L, Nielsen EM, Torpdahl M. Plasmid-borne colistin resistance gene mcr-3 in Salmonella isolates from human infections, Denmark, 2009-17. Euro Surveill. 2017;22(31):30587. doi: 10.2807/1560-7917.ES.2017.22.31.30587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
  • 9.García-Meniño I, Díaz-Jiménez D, García V, de Toro M, Flament-Simon SC, Blanco J, et al. Genomic characterization of Prevalent mcr-1, mcr-4, and mcr-5 Escherichia coli within swine enteric colibacillosis in Spain. Front Microbiol. 2019;10:2469. doi: 10.3389/fmicb.2019.02469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. EFSA J. 2019;17(2):e05598. doi: 10.2903/j.efsa.2019.5598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Olaitan AO, Diene SM, Kempf M, Berrazeg M, Bakour S, Gupta SK, et al. Worldwide emergence of colistin resistance in Klebsiella pneumoniae from healthy humans and patients in Lao PDR, Thailand, Israel, Nigeria and France owing to inactivation of the PhoP/PhoQ regulator mgrB: an epidemiological and molecular study. Int J Antimicrob Agents. 2014;44(6):500–507. doi: 10.1016/j.ijantimicag.2014.07.020. [DOI] [PubMed] [Google Scholar]
  • 12.Pungpian C, Sinwat N, Angkititrakul S, Prathan R, Chuanchuen R. Presence and transfer of antimicrobial resistance determinants in Escherichia coli in pigs, pork, and humans in Thailand and Lao PDR border provinces. Microb Drug Resist. 2021;27(4):571–584. doi: 10.1089/mdr.2019.0438. [DOI] [PubMed] [Google Scholar]
  • 13.Trongjit S, Angkititrakul S, Tuttle RE, Poungseree J, Padungtod P, Chuanchuen R. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand-Cambodia border provinces. Microbiol Immunol. 2017;61(1):23–33. doi: 10.1111/1348-0421.12462. [DOI] [PubMed] [Google Scholar]
  • 14.Sinwat N, Angkittitrakul S, Coulson KF, Pilapil FM, Meunsene D, Chuanchuen R. High prevalence and molecular characteristics of multidrug-resistant Salmonella in pigs, pork and humans in Thailand and Laos provinces. J Med Microbiol. 2016;65(10):1182–1193. doi: 10.1099/jmm.0.000339. [DOI] [PubMed] [Google Scholar]
  • 15.Trongjit S, Angkittitrakul S, Chuanchuen R. Occurrence and molecular characteristics of antimicrobial resistance of Escherichia coli from broilers, pigs and meat products in Thailand and Cambodia provinces. Microbiol Immunol. 2016;60(9):575–585. doi: 10.1111/1348-0421.12407. [DOI] [PubMed] [Google Scholar]
  • 16.FAO. Monitoring and Surveillance of Antimicrobial Resistance in Bacteria from Healthy Food Animals Intended for Consumption. Bangkok: Food and Agriculture Organization of the United Nations; 2019. pp. 9–26. [Google Scholar]
  • 17.U.S. Food and Drug Administration. Enumeration of Escherichia coli and the coliform bacteria [Internet] Silver Spring: U.S. Food and Drug Administration; [Updated 2017]. https://www.fda.gov/food/laboratory-methods-food/bam-chapter-4-enumeration-escherichia-coli-and-coliform-bacteria. [Google Scholar]
  • 18.ISO. Microbiology of Food and Animal Feeding Stuffs – Horizontal Method for the Detection of Salmonella Spp: ISO6579-Fourth Edition. Geneva: International Organization for Standardization; 2002. [Google Scholar]
  • 19.Popoff M, LeMinor L. Antigenic Formulas of the Salmonella Serovars. Paris: Institut Pasteur; 1992. [Google Scholar]
  • 20.CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Test for Bacteria Isolated from Animals 3rd VET01-S3. Wayne: Clinical and Laboratory Standards Institute; 2015. [Google Scholar]
  • 21.Dafopoulou K, Zarkotou O, Dimitroulia E, Hadjichristodoulou C, Gennimata V, Pournaras S, et al. Comparative evaluation of colistin susceptibility testing methods among carbapenem-nonsusceptible Klebsiella pneumoniae and Acinetobacter baumannii clinical isolates. Antimicrob Agents Chemother. 2015;59(8):4625–4630. doi: 10.1128/AAC.00868-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 7.1, Valid from 2017-03-10. Basel: European Committee on Antimicrobial Susceptibility Testing; 2017. [Google Scholar]
  • 23.Lévesque C, Piché L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39(1):185–191. doi: 10.1128/aac.39.1.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rebelo AR, Bortolaia V, Kjeldgaard JS, Pedersen SK, Leekitcharoenphon P, Hansen IM, et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 2018;23(6) doi: 10.2807/1560-7917.ES.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–123. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
  • 26.Khemtong S, Chuanchuen R. Class 1 integrons and Salmonella genomic island 1 among Salmonella enterica isolated from poultry and swine. Microb Drug Resist. 2008;14(1):65–70. doi: 10.1089/mdr.2008.0807. [DOI] [PubMed] [Google Scholar]
  • 27.Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63(3):219–228. doi: 10.1016/j.mimet.2005.03.018. [DOI] [PubMed] [Google Scholar]
  • 28.Sukhnanand S, Alcaine S, Warnick LD, Su WL, Hof J, Craver MP, et al. DNA sequence-based subtyping and evolutionary analysis of selected Salmonella enterica serotypes. J Clin Microbiol. 2005;43(8):3688–3698. doi: 10.1128/JCM.43.8.3688-3698.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Burland TG. DNASTAR's Lasergene sequence analysis software. Methods Mol Biol. 2000;132:71–91. doi: 10.1385/1-59259-192-2:71. [DOI] [PubMed] [Google Scholar]
  • 30.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang X, Zhang B, Guo Y, Wang J, Zhao P, Liu J, et al. Colistin resistance prevalence in Escherichia coli from domestic animals in intensive breeding farms of Jiangsu Province. Int J Food Microbiol. 2019;291:87–90. doi: 10.1016/j.ijfoodmicro.2018.11.013. [DOI] [PubMed] [Google Scholar]
  • 32.Huang X, Yu L, Chen X, Zhi C, Yao X, Liu Y, et al. High prevalence of colistin resistance and mcr-1 Gene in Escherichia coli isolated from food animals in China. Front Microbiol. 2017;8:562. doi: 10.3389/fmicb.2017.00562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xu F, Zeng X, Hinenoya A, Lin J. MCR-1 confers cross-resistance to bacitracin, a widely used in-feed antibiotic. MSphere. 2018;3(5):e00411-18. doi: 10.1128/mSphere.00411-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Strom G, Halje M, Karlsson D, Jiwakanon J, Pringle M, Fernstrom LL, et al. Antimicrobial use and antimicrobial susceptibility in Escherichia coli on small- and medium-scale pig farms in north-eastern Thailand. Antimicrob Resist Infect Control. 2017;6:75. doi: 10.1186/s13756-017-0233-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Langata LM, Maingi JM, Musonye HA, Kiiru J, Nyamache AK. Antimicrobial resistance genes in Salmonella and Escherichia coli isolates from chicken droppings in Nairobi, Kenya. BMC Res Notes. 2019;12(1):22. doi: 10.1186/s13104-019-4068-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Varga C, Rajić A, McFall ME, Reid-Smith RJ, Deckert AE, Pearl DL, et al. Comparison of antimicrobial resistance in generic Escherichia coli and Salmonella spp. cultured from identical fecal samples in finishing swine. Can J Vet Res. 2008;72(2):181–187. [PMC free article] [PubMed] [Google Scholar]
  • 37.Touati M, Hadjadj L, Berrazeg M, Baron SA, Rolain JM. Emergence of Escherichia coli harbouring mcr-1 and mcr-3 genes in North West Algerian farmlands. J Glob Antimicrob Resist. 2020;21:132–137. doi: 10.1016/j.jgar.2019.10.001. [DOI] [PubMed] [Google Scholar]
  • 38.Mulvey MR, Bharat A, Boyd DA, Irwin RJ, Wylie J. Characterization of a colistin-resistant Salmonella enterica 4,[5],12:i:- harbouring mcr-3.2 on a variant IncHI-2 plasmid identified in Canada. J Med Microbiol. 2018;67(12):1673–1675. doi: 10.1099/jmm.0.000854. [DOI] [PubMed] [Google Scholar]
  • 39.Wise MG, Estabrook MA, Sahm DF, Stone GG, Kazmierczak KM. Prevalence of mcr-type genes among colistin-resistant Enterobacteriaceae collected in 2014-2016 as part of the INFORM global surveillance program. PLoS One. 2018;13(4):e0195281. doi: 10.1371/journal.pone.0195281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yin W, Li H, Shen Y, Liu Z, Wang S, Shen Z, et al. Novel Plasmid-Mediated Colistin Resistance Gene mcr-3 in Escherichia coli . MBio. 2017;8(3):e00543-17. doi: 10.1128/mBio.00543-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Liu L, Feng Y, Zhang X, McNally A, Zong Z. New variant of mcr-3 in an extensively drug-resistant Escherichia coli clinical isolate carrying mcr-1 and bla NDM-5 . Antimicrob Agents Chemother. 2017;61(12):e01757-17. doi: 10.1128/AAC.01757-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Khine NO, Lugsomya K, Kaewgun B, Honhanrob L, Pairojrit P, Jermprasert S, et al. Multidrug resistance and virulence factors of Escherichia coli harboring plasmid-mediated colistin resistance: mcr-1 and mcr-3 genes in contracted pig farms in Thailand. Front Vet Sci. 2020;7:582899. doi: 10.3389/fvets.2020.582899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jin L, Wang R, Wang X, Wang Q, Zhang Y, Yin Y, et al. Emergence of mcr-1 and carbapenemase genes in hospital sewage water in Beijing, China. J Antimicrob Chemother. 2018;73(1):84–87. doi: 10.1093/jac/dkx355. [DOI] [PubMed] [Google Scholar]
  • 44.Poirel L, Kieffer N, Brink A, Coetze J, Jayol A, Nordmann P. Genetic features of MCR-1-producing colistin-resistant Escherichia coli isolates in South Africa. Antimicrob Agents Chemother. 2016;60(7):4394–4397. doi: 10.1128/AAC.00444-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Veterinary Science are provided here courtesy of The Korean Society of Veterinary Science

RESOURCES