Skip to main content
Poultry Science logoLink to Poultry Science
. 2021 Aug 13;100(11):101427. doi: 10.1016/j.psj.2021.101427

Effects of low-crude protein diets supplemented with arginine, glutamine, threonine, and methionine on regulating nutrient absorption, intestinal health, and growth performance of Eimeria-infected chickens

Po-Yun Teng 1, Janghan Choi 1, Sudhir Yadav 1, YH Tompkins 1, Woo Kyun Kim 1,1
PMCID: PMC8463775  PMID: 34551373

Abstract

The study was conducted to evaluate the effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on apparent ileal digestibility of amino acids, intestinal morphology, intestinal permeability, gene expression of nutrient transporters, and tight junction proteins of broiler chickens challenged with mixed Eimeria spp. A total of five hundred seventy-six, 12-day-old male broiler chickens were allocated into 8 treatments, and 6 replicate cages of 12 chickens per cage. This experiment included a nonchallenged control (NC) fed regular corn-soybean meal-based diet (Regular diet, 19% crude protein), an Eimeria-challenged control (CC) fed Regular diet, an Eimeria challenge group fed low-crude protein diet (LCP, 16% crude protein), 4 Eimeria challenge groups fed low-crude protein diet supplemented with 0.75% arginine, glutamine, methionine, and threonine, respectively (ARG, GLN, MET, and THR), and an Eimeria challenge group fed low-crude protein diet with 0.75% supplemented arginine, glutamine, methionine, and threonine collectively as a combination group (COMB). On d 14, birds in the challenge groups were gavaged with a mixed Eimeria spp. solution containing 12,500 oocysts of E. maxima, 12,500 oocysts of E. tenella, and 62,500 oocysts of E. acervulina. The results showed that the Eimeria challenge reduced overall growth performance, but the LCP had no adverse impacts on intestinal health and growth of Eimeria-infected birds compared to the CC. Additionally, supplementation of crystalline arginine, glutamine, methionine, and threonine improved the apparent ileal digestibility of these specific amino acids on 6 dpi. Moreover, the THR treatment increased villus height in the duodenum. The ARG treatment decreased intestinal permeability and gene expression of amino acid transporters, whereas the GLN and THR treatments both reversed adverse effects of coccidiosis on gene expression of tight junction protein (claudin 1). However, the MET and COMB treatments exacerbated infection severity of coccidiosis. In summary, adding 0.75% of arginine, glutamine, or threonine in a low crude protein diet can improve the intestinal health of birds challenged with a mild coccidia infection.

Key words: low crude protein diets, coccidiosis, arginine, glutamine, threonine, methionine

INTRODUCTION

Attempts to reduce crude protein levels in diets have successfully offered several advantages in the poultry industry, such as reducing feed cost, enhancing nutrient utilization, and improving animal welfare. The commercially available crystalline amino acids improve the cost-effective formulation to meet the nutrient requirements for broiler chickens. It has been reported that decreasing dietary crude protein contents up to 3% would not affect the growth performance and meat quality of chickens (Belloir et al., 2017; Badawi et al., 2019). Furthermore, reduced crude protein diets could enhance animal welfare by promoting litter quality and limiting ammonia production (Greenhalgh et al., 2020). Dietary crude protein cutback decreases water intakes of chickens coupled with a reduction in litter moisture (Alleman and Leclercq, 1997). Better control of litter quality further reduces the incidence of foot-pad dermatitis, thereby improving animal welfare (Lemme et al., 2019; van Harn et al., 2019).

In addition, the reduced dietary crude protein also enhances nitrogen utilization of chickens (Aletor et al., 2000; Belloir et al., 2017). Because of the limited nutrients in the lower intestine, proliferation of pathogens, such as C. perfringens, would be suppressed in the birds fed low crude protein diets (Low-CP diet) (Drew et al., 2004). Furthermore, a previous study indicated that reducing dietary crude protein levels from 24 to 16% suppressed mortality from 40 to 27.5% (Sharma et al., 1973); Overall, the Low-CP diet not only enhances nutrient digestibility but also reduces the incidence of coccidiosis and necrotic enteritis (Drew et al., 2004).

Coccidiosis, a common poultry disease infected by genus Eimeria, causes intestinal inflammation, sloughing cells, hemorrhage, maldigestion, morbidity, and even high mortality in some severe cases (Allen and Fetterer, 2002; Chapman, 2014). It has been estimated that the annual economic loss due to coccidiosis is up to 12.5 billion in the global poultry industry (Blake et al., 2020).

Nutritional strategies, such as formulating Low-CP diet and the addition of crystalline amino acids, are promising to improve the antioxidant capacity and immunity of host against coccidiosis in the modern “Antibiotic-Free” and “No Antibiotics Ever” production systems. Supplementing specific amino acids, such as arginine, glutamine, methionine, and threonine, in diets has shown profound benefits in regulating the intestinal health of animals (Bortoluzzi et al., 2018). Arginine, an essential amino acid for chickens, has been shown to be involved in protein synthesis, nitrite oxide production, and maintenance of oxidative capacity (Castro and Kim, 2020). Increasing arginine levels in the broiler diets could regulate immune responses and attenuate adverse effects of Eimeria on growth performance and intestinal morphology (Tan et al., 2014; Laika and Jahanian, 2017).

Being one of the main sources of energy for enterocytes, glutamine has been considered a curial amino acid to maintain intestinal cell linings (Rao and Samak, 2012). Furthermore, glutamine is the precursor for the synthesis of glutathione, a powerful antioxidant that attenuates oxidative stress by combating free radicals (Yu et al., 1999); thus, glutamine plays an essential role in maintaining the intestinal health in broiler chickens. Previous studies have reported that the application of glutamine enhanced growth performance, regulated immune responses, altered tight junction protein expression, and reduced intestinal permeability of animals (Luquetti et al., 2016; Oxford and Selvaraj, 2019).

Serving as precursors for synthesizing muscle and feather protein, methionine is the first limiting essential amino acid in corn-soybean meal-based diets for broiler chickens (Vieira et al., 2004). Increasing dietary methionine supplementation has shown positive outcomes on growth performance, antioxidant parameters, and intestinal immunity of birds challenged with Eimeria (Lai et al., 2018; Ren et al., 2020). On the other hand, threonine, another limiting amino acid, is a crucial nutrient that regulates mucosal integrity (Mao et al., 2011; Bortoluzzi et al., 2018). A previous study suggested to formulate feed with a higher ratio of threonine to lysine for improving growth performance and intestinal health against pathogen infections (Star et al., 2012). However, the feasibility of adding amino acids in a Low-CP diet to ameliorate intestinal injury of Eimeria-infected chickens has not been revealed in previous researches.

We hypothesized that the birds challenged with Eimeria does not require a high concentration of dietary crude protein but needs specific amino acids for accelerating tissue recovery during the acute infection (0–6 dpi) and the early recovery (6–9 dpi) phases. In other words, the requirement of crude protein for birds susceptible to coccidiosis could be reduced if specific amino acids were supplemented in the diet. We further hypothesized that stronger intestinal ecosystem constructed during the acute infection and early recovery phases could subsequently enhance the compensatory growth, even though treatment diets are replaced by the regular grower diet during the late recovery phase from 9 to 14 dpi. To confirm the hypothesis, the current study investigated the effects of reduced crude protein diets with supplementing arginine, glutamine, methionine, and threonine, separately or collectively, on nutrient digestibility, gene expressions of tight junction proteins, and nutrient transporters of chickens infected with mixed Eimeria spp.

MATERIALS AND METHODS

The current study was conducted under the approval of the Institutional Animal Care and Use Committee of the University of Georgia, Athens, GA.

Experimental Design

A total of 576, twelve-day-old male broiler chickens (Cobb 500, Cobb-Vantress, Cleveland, GA) were randomly allocated to 48 battery cages. The completely randomized design was used in the study, with 8 treatments and 6 replicate cages of 12 chickens per cage. The environment and temperature programs followed the Cobb 500 Broiler Management Guide (Cobb-Vantress, 2018). Chickens were provided ad libitum access to feed and water through the whole experiment.

The 8 treatments included a nonchallenged control (NC) fed regular corn-soybean meal-based diet (Regular diet) that meets the recommended nutritional levels from Cobb's guideline (Table 1, 19% crude protein), an Eimeria-challenged control (CC) fed Regular Diet, an Eimeria challenge group fed Low-CP diet (LCP) (Table 1, 16% crude protein), four Eimeria challenge groups fed Low-CP diet supplemented with 0.75% (0.75 g per 100 g of the diet) arginine, glutamine, methionine, and threonine, respectively (ARG, GLN, MET, and THR), and an Eimeria challenge group fed Low-CP diet with arginine, glutamine, methionine, and threonine collectively as a combination group (COMB). The minimum requirements of digestible amino acids for the LCP diet were set at 84% of the regular diet to reduce the total crude protein levels from 19 to 16 (84% reduction). Chickens were fed a regular starter diet (21% crude protein, 2,975 Kcal/kg) before the trial, and fed treatment diets (Table 1) from d 12 to d 23. On d 14, chickens, except the NC group, were challenged with mixed Eimeria spp. The challenge dose was selected based on our previous study, which would not cause significant mortality but reduce growth performance and damage intestinal epithelium as a mild coccidia infection (Teng et al., 2020). The birds were gavaged with a solution containing 12,500 sporulated oocysts of E. maxima, 12,500 sporulated oocysts of E. tenella, and 62,500 sporulated oocysts of E. acervulina. In contrast, the NC group orally received 1 mL water. After d 23, birds were fed the Regular diet to the end of the experiment (d 28). Growth performance was recorded and calculated for 3 periods, the acute infection phase (d 12–d 20; −2 to 6 dpi), the early recovery phase (d 20–d 23; 6–9 dpi), and the late recovery phase (d 23–d 28; 9–14 dpi).

Table 1.

Diet formulation according to the treatments (% diet).

Items NC/CC3 LCP3 ARG3 GLN3 MET3 THR3 COMB3
Corn 62.38 66.94 66.94 66.94 66.94 66.94 66.94
Soybean Meal 31.90 24.81 24.81 24.81 24.81 24.81 24.81
Soybean oil 1.49 1.71 1.71 1.71 1.71 1.71 1.71
Limestone 0.71 0.81 0.81 0.81 0.81 0.81 0.81
Defluorinated phosphate 1.44 1.37 1.37 1.37 1.37 1.37 1.37
Sodium chloride 0.30 0.30 0.30 0.30 0.30 0.30 0.30
Vitamin premix1 0.25 0.25 0.25 0.25 0.25 0.25 0.25
Mineral premix2 0.08 0.08 0.08 0.08 0.08 0.08 0.08
Methionine 0.27 0.21 0.21 0.21 0.96 0.21 0.96
Lysine HCl 0.17 0.19 0.19 0.19 0.19 0.19 0.19
Threonine 0.02 0.02 0.02 0.02 0.02 0.77 0.77
Arginine 0.00 0.00 0.75 0.00 0.00 0.00 0.75
Glutamine 0.00 0.00 0.00 0.75 0.00 0.00 0.75
Sand 0.70 3.00 2.25 2.25 2.25 2.25 0.00
Titanium oxide 0.30 0.30 0.30 0.30 0.30 0.30 0.30

Calculated value
M.E. (kcal/kg) 3.03 3.03 3.05 3.05 3.05 3.05 3.13
CP (%) 19.00 16.00 17.51 16.9 16.43 16.54 19.37
Calcium (%) 0.84 0.84 0.84 0.84 0.84 0.84 0.84
Available P(%) 0.42 0.42 0.42 0.42 0.42 0.42 0.42
Dig Lys (%) 1.12 0.95 0.95 0.95 0.95 0.95 0.95
Dig Met (%) 0.57 0.48 0.48 0.48 1.23 0.48 1.23
Dig Thr (%) 0.74 0.62 0.62 0.62 0.62 1.37 1.37
Dig Arg (%) 1.31 1.07 1.82 1.07 1.07 1.07 1.82
Dig Gly (%) 0.86 0.73 0.73 0.73 0.73 0.73 0.73
Dig TSAA (%) 0.85 0.72 0.72 0.72 1.47 0.72 1.47
Dig Ser (%) 1.02 0.86 0.86 0.86 0.86 0.86 0.86
Dig Tyr (%) 0.75 0.64 0.64 0.64 0.64 0.64 0.64
Dig Val (%) 1.09 0.92 0.92 0.92 0.92 0.92 0.92
Dig Trp (%) 0.26 0.21 0.21 0.21 0.21 0.21 0.21

Analyzed value
Total amino acids (%) 18.67 16.51 17.16 17.17 17.42 17.03 19.7
Arginine (%) 1.25 1.05 1.75 1.10 1.00 1.06 1.75
Glutamine (%) 3.38 2.96 2.93 3.56 2.89 2.90 3.65
Methionine (%) 0.58 0.46 0.46 0.42 1.49 0.45 1.56
Threonine (%) 0.72 0.63 0.59 0.72 0.52 1.27 1.41
1

Provided per kg of DSM Vitamin premix: Vit. A 2,204,586 IU, Vit. D3 200,000 ICU, Vit. E 2,000 IU, Vit. B12 2 mg, Biotin 20 mg, Menadione 200 mg, Thiamine 400 mg, Riboflavin 800 mg, d-Pantothenic Acid 2,000 mg, Vit. B6 400 mg, Niacin 8,000 mg, Folic Acid 100 mg, Choline 34,720 mg.

2

Provided per kg of Mineral premix: Ca 0.72 g, Mn 3.04 g, Zn 2.43 g, Mg 0.61 g, Fe 0.59 g, Cu 22.68 g, I 22.68 g, Se 9.07 g.

3

NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

Sample Collections

On 6 days postinfection (dpi), 5 chickens per cage were euthanized by cervical dislocation. Duodenum, jejunum, and jejunal mucosa were removed from one of 5 sampled chickens. On 9 dpi, one more bird per cage was killed for collecting intestinal tissue. The intestinal tissue was rinsed with phosphate-buffered saline and fixed with 10% formalin immediately, whereas the mucosa was collected in a tube and snap-frozen in liquid nitrogen. The frozen samples were stored at −80°C until further analyses. On 6 dpi, ileal digesta samples collected from 5 birds per cage were flushed out from the ileum with deionized water. The samples were further pooled within the cage, stored in a container and frozen at −20°C.

Intestinal Morphology

The duodenum and jejunum tissues were removed from the 10% formalin, carefully cut into short sections, stored in cassettes, and finally embedded in paraffin. Afterward, the approximately 4-μm-sliced samples were stained with hematoxylin and eosin. The intestinal morphology of each sample was observed and captured under a light microscope with 2X magnification (BZ-X800, Keyence Inc, Itasca, IL). Five villi and crypts per sample were randomly picked to determine the length of villus and crypt. The Image J (Image Processing and Analysis in Java–ImageJ 1.50i, National Institutes of Health, Bethesda, MD) was used to measure the villus height and crypt depth, whereas the ratio of villi height to crypt depth was further calculated from the averaged villi height and crypt depth of each sample (Teng et al., 2020).

Apparent Ileal Digestibility of Amino Acids

To measure the apparent ileal digestibility (AID) of amino acids, 0.3% titanium oxide was formulated in the treatment diets as an indigestible marker. The concentrations of maker and amino acids in feed and digesta were used to calculate AID, as the formula shown below (Stein et al., 2007).

AIDofaminoacid(%)=[1(Tii/Tio)×No/Ni]×100

Where Tii means the determined concentration of titanium oxide in the diets; Tio represents the titanium oxide in the digesta samples; Ni indicates the value of crude protein or amino acids in the treatment diets; and No represents the concentration of the nutrients in the ileal digesta.

The frozen digesta samples were lyophilized and ground by a coffee grinder (KitchenAid, Benton Harbor, MI). Titanium oxide concentration in the diets and digesta samples were measured according to the description by Short et al. (1996). In addition, the amino acids levels were analyzed by the University of Missouri Agricultural Experiment Station Chemical Laboratory [method 982.30 E (a, b, c), AOAC, 2006].

Oocyst Shedding

Fresh excreta from 6 to 9 dpi were pooled thoroughly, and approximately 500 g of the fecal materials were collected from each cage in a sample bag. Five grams of sample were weighted and mixed with 45 mL of water and the homogenized solution was serially diluted to a countable level for determining oocysts shedding. Five milliliters of diluted samples were mixed with 45 mL of saturated salt solution in a centrifuge tube. After appropriate mixing, the samples were loaded in a Mcmaster chamber (Jorgensen Laboratories, Loveland, CO) and observed under a microscope (FEC Source, Grand Ronde, OR). The total oocyst shedding was counted and presented as oocysts per gram in the result.

Gastrointestinal Permeability

Gastrointestinal permeability was measured by fluorescein isothiocyanate dextran (FITC-d; 2.2 mg/mL, MW 4000; Sigma-Aldrich, Canada) on 5 dpi (Liu et al., 2021). One chicken randomly selected from each cage was gavaged with 1 mL of FITC-d. After 2 h postinoculation, chickens were killed by cervical dislocation, and blood was collected from the heart immediately. The clotted blood samples were centrifuged at 1,000 × g for 15 min to obtain at least 200 μL serum. About 100 μL serum was later transferred to a dark 96-well microplate with duplicates per sample. Standard solutions were prepared with the pool of serum from 10 additional chickens that were not used in the experiment but raised in the same house, following the recommendations described by Teng et al. (2020). The FITC-d concentration in the serum samples was determined by a microplate reader (Spectramax M5, Molecular Devices, San Jose, CA), where the excitation wavelength was set at 485 nm and the emission wavelength at 528. The transportation, processing, and analysis of samples were carefully carried in a container and performed under a dark environment to protect samples from light exposure.

Real-Time PCR

Total RNA of jejunal mucosa was extracted by QIAzol Lysis Reagents (Qiagen, Germantown, MD) and homogenized with a bead beater (MiniBeadBeater-16, Biospec Products Inc, Bartlesville, OK). The RNA quantity was determined by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Afterward, the total RNA was diluted to 200 ng/μL and reverse-transcribed to cDNA by the High Capacity cDNA synthesis kits (Applied BioSystems, Life Technologies, Waltham, CA). The cDNA samples were diluted 1:5 for real-time PCR analysis performed on the Step One thermo-cycler (Applied Biosystem, Foster City, CA). The cDNA was mixed with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA) and reverse and forward primers for real-time PCR analysis. Samples were run in duplicates, and the 2−ΔΔCt method was used to determine target gene expressions comparing to housekeeping genes (Livak and Schmittgen, 2001). The geometric average of 2 genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-actin, was used as the reference Ct value. The forward and reverse primer sequences of tight junction proteins and amino acid transporters are listed in Table 2. For tight junction proteins, claudin 1 (CLDN1), occludin (OCLDN), zonula occludens 1 (ZO1), and junctional adhesion molecule 2 (JAM2) were tested and for amino acid transporters, gene expression of Na+-dependent amino acid transporter (B0AT), Na+-independent amino acid transporter (B0+AT), excitatory amino acid transporter (EAAT), cationic amino acid transporter (CAT1), L-type amino acid transporter (LAT1), and Na+-dependent neutral/cationic amino acid transporter (LAT2) was analyzed in the current study.

Table 2.

List of primers used for qPCR.

Gene symbol1 Accession number Forward primer Reverse primer
GAPDH2 NM_204305.1 CCTCTCTGGCAAAGTCCAAG GGTCACGCTCCTGGAAGATA
Beta-actin2 NM_205518.1 CAACACAGTGCTGTCTGGTGGTA ATCGTACTCCTGCTTGCTGATCC
CLDN13 NM_001013611.2 TGGAGGATGACCAGGTGAAGA CGAGCCACTCTGTTGCCATA
OCLDN3 NM_205128.1 ACGGCAGCACCTACCTCAA GGCGAAGAAGCAGATGAG
ZO13 XM_015278981.2 CAACTGGTGTGGGTTTCTGAA TCACTACCAGGAGCTGAGAGGTAA
JAM23 NM_001006257.1 AGCCTCAAATGGGATTGGATT CATCAACTTGCATTCGCTTCA
B0AT (SLC6A19)4 XM_419056.6 GGGTTTTGTGTTGGCTTAGGAA TCCATGGCTCTGGCAGAGAT
B0+AT (SLC7A9)4 NM_001199133.1 CAGTAGTGAATTCTCTGAGTGTGAAGCT GCAATGATTGCCACAACTACCA
EAAT (SLC1A1)4 XM_424930.6 TGCTGCTTTGGATTCCAGTGT AGCAATGACTGTAGTGCAGAAGTAATATATG
CAT1 (SLC7A1)4 XM_015277945.2 CCAAGCACGCTGATAAAG TACTCACAATAGGAAGAAGGG
LAT2 (SLC7A6)4 XM_025154295.1 TCAGCTTCAGTTACTGGTT GCACAACCACGAGAAATAC
LAT1 (SLC7A5)4 NM_001030579.2 GATTGCAACGGGTGATGTGA CCCCACACCCACTTTTGTTT
1

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CLDN1, Claudin 1 (Shao et al., 2013); OCLDN, Occludin (Liu et al., 2012); ZO1, Zonula occludens 1 (Metzler-Zebeli et al., 2018); JAM2, Junctional adhesion molecule 2 (Chen et al., 2015) B0AT; Na+-dependent amino acid transporter; B0+AT, Na+-independent amino acid transporter; EAAT, excitatory amino acid transporter; CAT1, Cationic amino acid transporter; LAT2, Na+-dependent neutral/cationic amino acid transporter; LAT1, L-type amino acid transporter 1.

2

Housekeeping gene.

3

Tight junction proteins.

4

Nutrient transporters (Gilbert et al., 2007).

Statistical Analyses

All data were analyzed in the PROC GLM program of SAS software (SAS Institute Inc., Cary, NC). Duncan's multiple range test was used as the post hoc analysis to separate means with significance levels at P ≤ 0.05 or a trend at P ≤ 0.1. The experimental unit is cage in the current study.

RESULTS

Growth Performance and Mortality

Growth performance results are present in Table 3. During d 12 to 20, Eimeria infection significantly reduced body weight (BW) and body weight gain of birds (BWG) compared to the NC group (P < 0.05). The nonchallenged chickens had the lowest feed conversion rate (FCR), whereas the MET group had the highest FCR among all treatments (P < 0.05). Reducing crude protein levels did not cause any significant differences in BW, BWG, FI, and FCR of Eimeria-challenged chickens. However, chickens in the MET and COMB treatments had less BW and BWG than the other treatments (P < 0.05). Feed intake (FI) in the COMB was significantly less than the other treatments, except the CC and MET treatments (P < 0.05).

Table 3.

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on growth performance in chickens challenged with mixed Eimeria spp.

Items1 NC CC LCP ARG GLN MET THR COMB SEM P-value
d 12–20
 BW (g) 721a 623b 624b 634b 625b 572c 633b 597c 6.35 <0.001
 BWG (g) 447a 351b 352b 362b 352b 301d 362b 324c 6.26 <0.001
 FI (g) 665a 612bcd 641abc 657ab 642abc 598cd 629abc 571d 6.79 0.003
 FCR (g/g) 1.49c 1.75b 1.82b 1.82b 1.82b 2.00a 1.74b 1.77b 0.03 <0.001
d 20–23
 BW 941a 819b 823b 865b 842b 713c 844b 748c 10.94 <0.001
 BWG 211a 199b 185b 201ab 183b 124c 188b 140c 4.75 <0.001
 FI 336a 336a 332a 332a 310a 269b 321a 277b 5.12 <0.001
 FCR 1.59c 1.69c 1.80bc 1.66c 1.71c 2.20a 1.72c 1.98b 0.03 <0.001
d 23–28
 BW 1,369a 1,210bc 1,221b 1,275b 1,279b 1,125c 1,239b 1,125c 14.65 <0.001
 BWG 413 375 383 402 401 392 395 380 6.01 0.798
 FI 659ab 635ab 653ab 665ab 695a 623b 678ab 640ab 7.33 0.243
 FCR 1.61 1.70 1.72 1.66 1.74 1.60 1.73 1.69 0.02 0.417
d 12–28
 BWG 1071a 925b 921b 965b 936b 816c 945b 843c 12.67 <0.001
 FI 1,660a 1,583ab 1,625a 1,653a 1,647a 1,490b 1,628a 1,488ab 15.02 0.002
 FCR 1.55c 1.71b 1.77ab 1.71b 1.76ab 1.84a 1.72ab 1.77ab 0.02 0.001
1

BW, body weight; BWG, body weight gain; FI, feed intake; FCR, feed conversion rate; NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

a-d

Means followed by superscript letters are different within the same row; N = 6.

During the early recovery phase (d 20–23; 6–9 dpi), the CC and ARG groups showed no significant difference in BWG compared to the NC treatment, but the MET and COMB groups had lower BWG and FI than the other treatments. Additionally, there were no significant differences in FI and FCR among the NC, CC, LCP, ARG, GLN, and THR from 6 to 9 dpi. During the late recovery phase (d 23–28; 9–14 dpi), the NC showed higher BW than the Eimeria-infected groups (P < 0.05). However, chickens fed the MET had less FI than those fed with GLN (P < 0.05).

The results of overall growth performance (d 12–28) indicated that mild Eimeria infection significantly reduced BWG and increased FCR (P < 0.05) compared with the NC treatment. Furthermore, supplementing 0.75% methionine resulted in the worse growth performance among all treatments (P < 0.05). The current results also demonstrated that LCP did not cause negative impacts on the growth performance of birds infected with coccidiosis. The Eimeria-challenged chickens fed the Low-CP diet had numerically higher BW on 6 and 9 dpi than those provided the Regular diet.

The NC, CC, GLN, MET, and COMB treatments had 0% mortality; the LCP and THR groups had 0.5% mortality; and the ARG treatment had 1% mortality. No significant difference in mortality among the treatments was found in the current study.

Total Oocyst Shedding and Gastrointestinal Permeability

Oocyst was not observed in the NC. The LCP treatment did not cause significant effects on total oocyst shedding compared to the CC control (Figure 1). However, chicken fed the MET diet had significantly higher oocysts counts in the excreta than the others (Figure 1, P < 0.05). Except for the MET, supplementing ARG, GLN or THR in Low-CP diet had no significant impacts on Eimeria oocysts shedding. On the other hand, the gastrointestinal permeability was significantly increased by coccidia infection (Figure 2, P < 0.05). The ARG had significantly lower gastrointestinal permeability than the LCP group (Figure 2, P < 0.05), but there was no significant difference between the CC and LCP treatments.

Figure 1.

Figure 1

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on oocysts shedding in chickens challenged with mixed Eimeria spp. Birds were challenged with mixed Eimeria spp. on d 14. Excreta was collected from 6 to 9 dpi. Oocyst was not observed in the non-challenged control. CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge. a,bMeans followed by superscript letters are different by Duncan's test. The error bars represent the SD values. N = 6.

Figure 2.

Figure 2

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on gastrointestinal permeability in chickens challenged with mixed Eimeria spp. Birds were challenged with mixed Eimeria spp. on d 14. Gastrointestinal permeability was determined by fluorescein isothiocyanate dextran on 5 dpi. NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge. a,bMeans followed by superscript letters are different by Duncan's test. The error bars represent the SD values. N = 6.

Intestinal Morphology

Results of intestinal morphology are shown in Table 4. On 6 dpi, the Eimeria-challenged chickens fed additional 0.75% threonine had a significant higher villus height of the duodenum than the CC, GLN, MET, and COMB groups (P < 0.05), whereas the LCP and ARG numerically increased the villus height from 1,912 μm (CC) to 2,090 μm and 2,295 μm, respectively. Moreover, the nonchallenged birds had the highest ratio of villus height to crypt depth in the duodenum (P < 0.05), but there was no significant difference between the CC and LCP in the morphology results. The COMB treatment had the longest crypt depth and the lowest ratio of villus height to crypt depth compared to the other groups (P < 0.05).

Table 4.

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on intestinal morphology in chickens challenged with mixed Eimeria spp.

Items1 NC CC LCP ARG GLN MET THR COMB SEM P-value
6 dpi
Duodenum
 VH 2,255abc 1,912bcd 2,090abcd 2,295ab 1,901cd 1,761d 2,368a 1,920bcd 50 0.009
 CD 119b 183b 165b 179b 175b 179b 173b 249a 8 0.013
 Ratio 19.5a 10.9bc 13.1b 14.1b 11.3bc 10.6bc 14.3b 8.0c 0.67 <0.001
Jejunum
 VH 1,119 1,135 1,182 1,212 1,065 1,141 1,274 1,176 29 0.810
 CD 146 156 161 145 149 150 158 146 4 0.939
 Ratio 7.7 7.5 7.4 8.4 7.3 7.7 8.3 8.3 0.23 0.882

9 dpi
Duodenum
 VH 2,425 2,350 2,509 2,461 2,467 2,217 2,431 2,203 45 0.522
 CD 116 148 155 141 163 135 145 147 4 0.465
 Ratio 21.04 16.01 16.46 17.51 16.00 17.25 17.26 15.29 0.52 0.418
Jejunum
 VH 1,310 1,403 1,365 1,368 1,405 1,216 1,473 1,166 33 0.295
 CD 107 152 136 135 106 135 137 129 5 0.121
 Ratio 12.15 9.69 10.14 10.39 11.18 9.14 10.80 9.06 0.29 0.258
1

VH, villus height; CD, crypt depth; Ratio, villus height: crypt depth; NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

a-d

Means followed by superscript letters are different within the same row; Unit: μm; N = 6.

On 9 dpi, although the ARG treatment showed positive outcomes in the duodenum morphology with numerically higher villus height to crypt depth ratio than the other Eimeria-challenged groups, there were no significant differences of the villus height, crypt depth, and the ratios in the duodenum among all treatments during the early recovery phase. It is noteworthy that the MET and COMB groups had numerically shorter villus height in the jejunum, whereas the non-challenged chickens had the numerically higher ratio than the challenged birds on 9 dpi.

Apparent Ileal Digestibility of Amino Acids

The results of the AID of amino acids are present in Table 5. The COMB treatment significantly increased the AID of arginine, methionine, threonine, glutamine, and total amino acids compared to the CC group (P < 0.05). Supplementation of 0.75% threonine significantly increased the AID of threonine on 6 dpi (P < 0.05), whereas ARG treatment increased the AID of arginine from 85 to 90% but decreased the AID of methionine from 90% to 88% (P < 0.05). Moreover, GLN treatment also reduced the AID of methionine (P < 0.05). On the contrary, Eimeria-infected birds fed additional methionine significantly increased methionine digestibility but reduced the AID of isoleucine, arginine, aspartic acid, and glutamine (P < 0.05). Furthermore, there were trends showing that the AID of leucine and glycine were reduced by the MET treatment (P < 0.1).

Table 5.

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on apparent ileal digestibility amino acids in chickens challenged with mixed Eimeria spp. (6 dpi).

Items1 NC CC LCP ARG GLN MET THR COMB SEM P-value
Arginine 85b 85b 85b 89a 84bc 81c 84bc 91a 0.55 <0.001
Histidine 80 79 79 75 77 75 77 80 0.62 0.083
Isoleucine 75ab 76ab 79a 74ab 75ab 73b 75ab 79a 1.04 <0.001
Leucine 79 80 81 77 78 78 78 81 0.51 0.384
Lysine 80*a 80*ab 81*a 77*ab 79*ab 75*b 78*ab 82*a 0.62 0.082
Methionine 91b 91b 90b 88c 88c 96a 91b 97a 0.51 <0.001
Phenylalanine 78 79 80 76 77 76 77 81 0.54 0.193
Threonine 69b 69b 68bc 64bc 67bc 61c 81a 85a 1.31 <0.001
Tryptophan 77 81 78 78 75 79 78 80 0.56 0.223
Valine 74 74 74 70 72 69 71 76 0.71 0.159
Alanine 78 77 79 74 76 74 75 79 0.62 0.367
Aspartic acid 76abc 77ab 78ab 74bc 76abc 71c 75abc 80a 0.59 0.014
Cysteine 63 63 68 62 61 61 66 69 0.88 0.108
Glutamine 84bcd 85bcd 86abc 83cd 86ab 82d 84bcd 89a 0.45 0.001
Glycine 72*ab 73*ab 74*a 69*ab 71*ab 67*b 71*ab 75*a 0.70 0.082
Proline 78 79 79 76 77 76 77 80 0.52 0.607
Serine 76 76 75 73 74 70 73 77 0.66 0.197
Total 78b 79b 79ab 77b 78b 76b 78b 83a 0.56 0.048
1

NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

a-d

Means followed by superscript letters are different within the same row.

Trend, P < 0.1; Unit: %; N = 6.

Gene Expression of Tight Junction Proteins and Nutrient Transporters

The gene expression of tight junction proteins is present in Table 6. Eimeria challenge significantly increased gene expression of CLDN1 (P < 0.05). The challenge control and the LCP showed 4.33- and 4.38-fold increases of the CLDN1 on 6 dpi, respectively (P < 0.05). However, the GLN, THR, and COMB had significantly lower gene expression of CLDN than the LCP (P < 0.05), and there was no significant difference among the GLN, THR, COMB, and NC groups. The gene expression of the other tight junction proteins, including OCLDN, ZO1, and JAM2, was neither regulated by coccidia challenge nor dietary treatments on 6 dpi.

Table 6.

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on gene expression of tight junction proteins in chickens challenged with mixed Eimeria spp.

Items1 NC CC LCP ARG GLN MET THR COMB SEM P-value
6 dpi
CLDN1 1.00d 4.33ab 4.38a 4.10abc 1.66cd 3.10abcd 1.72bcd 1.75bcd 0.33 0.015
OCLDN 1.00 1.56 1.23 1.23 1.32 1.38 1.30 1.34 0.05 0.197
ZO1 1.00 0.82 0.86 0.86 0.80 0.89 0.80 0.87 0.02 0.442
JAM2 1.00 1.19 1.08 1.43 0.96 1.46 0.89 1.24 0.07 0.419

9 dpi
CLDN1 1.00 1.00 0.72 0.82 0.71 0.72 0.83 0.84 0.04 0.355
OCLDN 1.00 1.00 1.09 1.01 0.98 1.02 0.83 0.98 0.03 0.799
ZO1 1.00 0.85 0.88 1.10 0.85 0.94 0.94 1.01 0.02 0.150
JAM2 1.00*ab 0.61*b 0.66*b 0.74*ab 0.46*b 0.73*ab 1.22*a 0.86*ab 0.06 0.078
1

CLDN1, Claudin 1; OCLDN, Occludin; ZO1, Zonula occludens 1; JAM2, Junctional adhesion molecule 2; NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

a-d

Means followed by superscript letters are different within the same row;

Trend, P < 0.1; Unit: fold change (2−ΔΔCt); N = 6.

The gene expression of amino acid transporters is shown in Table 7. Coccidia infections resulted in a significant increase in LAT1 (P < 0.05). The challenge also caused numerical downregulation of b0+at on 6 dpi (P < 0.1). Moreover, the ARG, MET, and COMB treatments upregulated expression of LAT1 compared to the NC (P < 0.05). Nevertheless, the B0AT, EAAT, and LAT2 gene expression was not regulated by the Eimeria challenge and diet treatments on 6 dpi.

Table 7.

Effects of low crude protein diets supplemented with arginine, glutamine, methionine, and/or threonine on gene expression of amino acid transporters in chickens challenged with mixed Eimeria spp.

Items1 NC CC LCP ARG GLN MET THR COMB SEM P-value
6 dpi
B0AT 1.00 0.80 0.90 0.81 1.01 0.96 0.83 0.89 0.04 0.914
B0+AT 1.00*a 0.54*b 0.58*b 0.52*b 0.66ab 0.64*b 0.66ab 0.75ab 0.04 0.091
EAAT 1.00 0.74 0.74 0.77 0.90 0.78 0.75 0.85 0.04 0.578
Cat1 1.00*c 1.86abc 1.74abc 2.19*a 1.17*bc 1.73abc 1.27abc 1.99ab 0.11 0.054
LAT1 1.00c 9.94ab 7.66bc 16.65a 5.45bc 12.56ab 6.29bc 13.13ab 1.11 0.004
LAT2 1.00 0.68 0.78 0.73 0.88 0.93 0.80 0.84 0.03 0.239

9 dpi
B0AT 1.00 1.31 1.48 1.68 1.41 1.38 1.03 1.26 0.06 0.130
B0+AT 1.00 1.02 1.34 1.60 1.27 1.17 1.04 1.29 0.06 0.118
EAAT 1.00 0.83 1.20 1.12 1.10 0.96 0.91 1.04 0.04 0.333
Cat1 1.00 1.53 0.94 1.30 1.23 1.13 1.16 1.14 0.08 0.787
LAT1 1.00ab 0.69*b 0.81*b 0.91*ab 0.67*b 1.06ab 1.19ab 1.46*a 0.07 0.080
LAT2 1.00ab 0.93b 0.97b 1.25a 0.96b 0.79b 0.88b 0.90b 0.03 0.045
1

B0AT; Na+-dependent amino acid transporter; B0+AT, Na+-independent amino acid transporter; EAAT, excitatory amino acid transporter; CAT1, cationic amino acid transporter; LAT2, Na+-dependent neutral/cationic amino acid transporter; LAT1, L-type amino acid transporter 1; NC, nonchallenged control; CC, Eimeria-challenged control; LCP, birds fed the low crude protein diet and received Eimeria challenge; ARG, birds fed the low crude protein diet adding 0.75% arginine and received Eimeria challenge; GLN, birds fed the low crude protein diet adding 0.75% glutamine and received Eimeria challenge; MET, birds fed the low crude protein diet adding 0.75% methionine and received Eimeria challenge; THR, birds fed low crude protein diet adding 0.75% threonine and received Eimeria challenge; COMB, birds fed the low crude protein diet adding arginine, glutamine, methionine, and threonine, and received Eimeria challenge.

a-c

Means followed by superscript letters are different by Duncan's test.

Trend, P < 0.1; Unit: fold change (2−ΔΔCt); N = 6.

On 9 dpi, chickens fed the Low-CP diet with arginine supplementation had higher expression of LAT2 compared to the other challenged groups (P < 0.05). Furthermore, there was a trend showing that gene expression of LAT1 was higher in the COMB than the CC and LCP on 9 dpi (P < 0.1). However, no significant differences were observed for the other amino acid transporters during the early recovery phase.

DISCUSSION

In the current study, the mild Eimeria infection reduced BWG and increased FCR, but the Low-CP diet did not impact the overall growth performance of infected birds. Previous research on the investigation of different crude protein levels to alleviate adverse effects of coccidiosis has yielded inconsistent results. Some reports demonstrated that increasing dietary crude protein levels linearly enhanced growth performance during the acute phase of Eimeria infection (Sharma et al., 1973; Rochell et al., 2017). Sharma et al. (1973) also demonstrated that birds fed a 24% crude protein diet had superior compensatory growth during the late recovery phase (8–14 dpi). Nonetheless, the authors reported higher mortality rates and oocysts shedding of birds fed the 24% crude protein treatment (Sharma et al., 1973). It is possible that increasing crude protein levels simulates trypsin secretion of the host, facilitating excystation of parasites’ sporozoites from the sporocysts and leading to severe coccidia infection (Britton et al., 1964; Chapman, 1978).

On the contrary, a recent study claimed that growth performance and oocysts shedding of the Eimeria-infected birds were not influenced by dietary crude protein levels (Arczewska-Włosek et al., 2017). Similar to the previous finding, Eimeria-infected birds fed the reduced crude protein diet had no adverse effects on BWG compared to those infected birds fed the regular diet in the present study. Based on the unaffected performance of birds fed the Low-CP diet, it is unlikely that the mild Eimeria-infected birds required high dietary amino acid levels to optimize growth and feed efficiency. Nevertheless, adjusting amino acids levels in low crude protein diets could impact the growth performance of birds. Rochell et al. (2016) indicated a massive reduction of BWG in response to low crude protein diets with individual reduction of several amino acids. Similarly, but with an opposite experimental design, the current study evaluated the effects of the Low-CP diet with “addition” of individual amino acids on birds infected with coccidiosis. In the current study, treatment diets were tested from 2 d prior to Eimeria challenge through 9 dpi to evaluate the effects of specific amino acids supplementation in the low-crude protein diet on growth performance of birds. The results showed that the ARG and THR treatments had numerically higher BWG than CC groups during the acute infection phase (CC: 351 g; ARG: 362 g; THR: 362 g).

According to our previous findings, the intestinal tissue can be fully recovered from a severe Eimeria infection within 9 d (Teng et al., 2020). The intestinal epithelium is supposed to be healed and ready to digest and absorb as many nutrients as it could to support compensatory growth during the late recovery phase (9–14 dpi); thus, the current study was designed to replace treatment diets by a regular grower diet on 9 dpi. Even though the diet treatments were only applied in the first and second phases of the experiment (from 2 d prior Eimeria challenge to 9 dpi), numerically higher BWG were found in the ARG and THR groups compared to the CC treatment during the late recovery phase (CC: 375 g; ARG: 402 g; THR: 395 g). The current findings indicated that Low-CP diets adding 0.75% arginine or threonine are promising nutritional strategies to reduce the feed cost, enhance growth performance, and improve animal health against pathogens infection.

However, the MET and COMB exacerbated negative effects of coccidiosis on growth performance in the current study. Both groups had lower BWG and higher FCR than the CC and LCP treatments. Furthermore, the birds fed the diet with additional methionine had greater oocysts shedding than the other challenged groups. Although methionine is the first limiting amino acid in the corn-soybean meal-based diets, supplementation of methionine in excess has been reported to cause growth depression in poultry (Han and Baker, 1993; Xie et al., 2007). Increasing methionine intake elevates homocysteine, an intermediate produced from the transformation of methionine to cysteine, in the circulation of animals (Perna et al., 2003). The excess homocysteine accumulation will result in a metabolic disorder known as hyperhomocysteinemia, which is associated with several human diseases, such as cardiovascular disease, Parkinson's disease, osteoporosis, end-stage renal disease, and gastrointestinal disorders (Kumar et al., 2017). It has been reported that hyperhomocysteinemia could generate reactive oxygen species and cause considerable toxicity for endothelium (Perna et al., 2003). It is likely that supplementing 0.75% methionine in the Low-CP diets, whether combined with other amino acids or not, might have induced hyperhomocysteinemia, causing endothelial dysfunction and damaging intestinal integrity along with coccidiosis. In the current study, the MET treatment significantly reduced villi height in the duodenum, whereas the COMB treatment had the lowest ratio of villus height to crypt depth on 6 dpi. The intestinal destructions in these two treatments were even worse than those in the CC treatment. Apart from damaging the endothelium, homocysteine might facilitate the parasite's development by inducing gametocytogenesis (Beri et al., 2017). This mode of action possibly contributes to the current finding of the increased oocysts shedding in the MET treatment. We speculated that the accumulation of homocysteine, due to the excess methionine supplementation, impaired intestinal epithelium of host and induced Eimeria gametocytogenesis, consequently leading to the increase of oocysts production and growth depression of birds.

Eimeria spp. impairs the intestinal integrity of the chicken in a short period of time. The coccidiosis-induced damage has been reported to escalate from 3 dpi and reach the peak of intestinal leakage and lesions on 6 dpi (Schneiders et al., 2019; Teng et al., 2020). In complement to previous findings, the current results showed the increased intestinal permeability and reduced ratio of villus height to crypt depth in the duodenum of Eimeria-challenged birds. Interestingly, for chickens fed the ARG treatment, a significant reduction of intestinal permeability was observed. Oral arginine supplementation has been known as one of nutritional approaches to preserve intestinal barrier integrity, ameliorate intestinal epithelium injury, and accelerate intestinal recovery in animals (Sukhotnik et al., 2005; Viana et al., 2010; Costa et al., 2014; Zhang et al., 2017). Castro et al. (2020) demonstrated that increasing dietary arginine levels from 1.04 to 1.34% improved the intestinal health of Eimeria-challenged chickens. As arginine is an important immune-modulator in response to Eimeria infection, increasing dietary arginine level has been shown to regulate the biosynthesis of nitric oxide and reduced oocysts shedding in Eimeria-infected chickens (Allen, 1999).

Although coccidiosis causes enormous intestinal necrosis within a week, the injury can be recuperated shortly due to the rapid turnover rate of intestinal epithelial cells (Cliffe et al., 2005; Teng et al., 2020). The acute inflammation caused by coccidiosis stimulates stem cell proliferation at the crypt base, which accelerates the cellular renewal in the intestine of chicken (Sun et al., 2016). The increase of enterocyte turnover has been considered as a mucosal defensive mechanism to expulse parasites from the intestinal epithelium of hosts (Cliffe et al., 2005). Previous studies have reported that the intestine recovery from coccidia infection is supposed to be less than 9 d (Schneiders et al., 2019; Teng et al., 2020). Similar to previous findings, a significant difference of intestinal morphology between challenged and nonchallenged birds was only observed on 6 dpi but not on 9 dpi in the current study, suggesting damaged intestinal cell linings had been rapidly recovered during the early recovery phase.

The tight junction complex, a protein structure located between enterocytes, serves as the first defensive barrier controlling paracellular translocation in the intestine of animals (Schneeberger and Lynch, 2004). The proteins constituting the tight junction complex can be categorized into 2 major groups: 1) the integral proteins, such as claudin, occludin, and JAM families, which attach on cell membrane forming a bridge that links 2 cells together and builds up protective barriers and 2) the plaque proteins, like the ZO family, which strengthen the construction of tight junction complex by connecting integral proteins to the cytoskeleton in the cytoplasm (Schneeberger and Lynch, 2004; Aijaz et al., 2006). Previous studies have reported that increasing the severity of Eimeria infection would linearly regulate gene expression of tight junction proteins (Teng et al., 2020, 2021). The current study also indicated an upregulation of CLDN1 in response to coccidia infection. Interestingly, the adverse effects of coccidiosis on tight junction protein were reversed by application of the THR and GLN treatments. Supplementation of glutamine and threonine reduced gene expression of CLDN1 from 4.38 (LCP) to 1.66- and 1.72-fold, respectively. A review article has emphasized the importance of threonine and glutamine in modulating intestinal health of chickens (Bortoluzzi et al., 2018). Glutamine is an essential amino acid for enterocytes proliferation, maintenance of intestinal barriers, and regulation of inflammatory pathways, whereas threonine plays important roles in mucin production and modulation of intestinal immune responses (Mao et al., 2011; Rao and Samak, 2012; Kim and Kim, 2017). Both glutamine and threonine can downregulate proinflammatory cytokines, such as interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) in broiler chickens (Chen et al., 2017; Chen et al., 2018; Oxford and Selvaraj, 2019). It has been reported that IFN-γ and TNF-α are strongly associated with CLDN1 expression during inflammatory intestine diseases (Utech et al., 2005; Poritz et al., 2011). It is likely that increase of IFN-γ and TNF-α production in birds infected with coccidiosis (Yun et al., 2000; Allen and Fetterer, 2002) induced CLDN1 gene expression in the current study, but dietary threonine or glutamine supplementation could reverse the expression of CLDN1 probably by attenuating the proinflammatory immune responses.

It is noteworthy that birds fed additional arginine, glutamine, methionine, and threonine showed increased AID of these amino acids, respectively, in the current study. Supplementation of highly digestible crystalline amino acids has been reported to improve nutrient digestibility of chickens (Hilliar et al., 2020). These findings suggested that supplementing a crystalline amino acid would facilitate the absorption of that particular one and strengthen its role in improving the intestinal health against pathogens infection. However, the inclusion of a particular amino acid in excess might interfere the digestibility of other amino acids. In the current study, the MET treatment enhanced the AID of methionine but suppressed absorption of isoleucine, threonine, aspartic acid, and glutamine. This difference in AID of methionine may be attributed to the high efficiency of methionine uptake in the jejunum and ileum, where brush border nutrient transporters, such as B0AT, have a greater affinity for methionine over other amino acids (Broer and Fairweather, 2018).

Six amino acid transporters were determined in the current study. Three of them (B0AT, B0+AT, and EAAT) are present on the brush border membrane, while the others (CAT1, LAT1, LAT2) attach to the basolateral membrane of the intestinal epithelial cells (Fetterer et al., 2014; Broer and Fairweather, 2018). The B0AT is a Na+- dependent nutrient transporter that accepts almost all neutral amino acids, including methionine, cysteine, glutamine, threonine, etc., whereas EAAT, another Na+- dependent transporter, carries anionic amino acids, such as aspartate and glutamate, across the brush border membrane (Broer and Fairweather, 2018). Heteromeric amino acid exchangers, including rBAT and B0+AT, are responsible for transporting cationic amino acids while exchanging neutral amino acids across the apical membrane of enterocytes. On the other side of the cell, CAT1 and LAT2 transport cationic amino acids, such as histidine, lysine, and arginine, across the basolateral membrane (Broer and Fairweather, 2018). Apart from moving cationic amino acids, LAT2, a Na+- dependent transporter, also accepts neutral amino acids, whereas LAT1, a Na+- independent transporter, is known for carrying large types of neutral amino acids, such as tryptophan, phenylalanine, leucine, methionine, and histidine (Broer and Fairweather, 2018). In the current study, Eimeria infection led to a significant increase of LAT1 and numerical reductions of B0AT, B0+AT, and EAAT. The trends showing upregulation of nutrient transporters located on basolateral membrane and downregulation of those on brush borders were in agreement with previous studies (Su et al., 2015; Teng et al., 2021). It has been proposed that decreased gene expression of B0AT, B0+AT, and EAAT, coupled with increased CAT1, LAT1, and LAT2 might stimulate apoptosis of enterocytes to accelerate cell renewals (Su et al., 2015). Interestingly, in the current study, the ARG treatment had the highest LAT1 and LAT2 expression among all treatments on 6 dpi and 9 dpi, respectively. Inclusion of arginine in the diet may have strengthened the action of apoptosis in the Eimeria-challenged chickens because arginine is the substrate for the formation of nitric oxide, which can induce apoptosis of epithelial cells directly (Allen, 1999; Chokshi et al., 2008). However, future research is still needed to understand how arginine modulates apoptosis and the expression of amino acid transporters in the intestinal epithelial cells of chickens infected with Eimeria spp.

In conclusion, application of the Low-CP diet showed no adverse impacts on intestinal health and growth of Eimeria-infected birds; thus, formulating low crude protein diets for birds infected with mild coccidiosis is a promising strategy to reduce feed cost and maintain performance. Additionally, supplementation of crystalline amino acids in the Low-CP diet could improve the apparent ileal digestibility of these target nutrients in the intestine of birds. The increase of absorption in threonine, arginine, and glutamine was able to ameliorate gut damage induced by coccidiosis; 1) threonine supplementation increased villus height in the duodenum; 2) the ARG treatment decreased intestinal permeability and gene expression of amino acid transporters; and 3) both the GLN and THR reversed adverse effects of coccidiosis on gene expression of tight junction protein. However, the MET and COMB treatments exacerbated infection severity of coccidiosis. Based on the current findings, adding 0.75% of arginine, glutamine, or threonine in a low crude protein diet can improve the intestinal health of birds infected with mixed Eimeria spp.

ACKNOWLEDGMENTS

This study was financed in part by a cooperative agreement 58-6040-8-034 from United States Department of Agriculture-Agricultural Research Service. We express our special thanks to Dr. Fuller and all members in Dr. Kim's research group.

DISCLOSURES

There is no conflict of interest.

REFERENCES

  1. Aijaz S., Balda M.S., Matter K. Tight junctions: molecular architecture and function. Int. Rev. Cytol. 2006;248:261–298. doi: 10.1016/S0074-7696(06)48005-0. [DOI] [PubMed] [Google Scholar]
  2. Aletor V., Hamid I., Nieß E., Pfeffer E. Low-protein amino acid-supplemented diets in broiler chickens: effects on performance, carcass characteristics, whole-body composition and efficiencies of nutrient utilisation. J. Sci. Food Agric. 2000;80:547–554. [Google Scholar]
  3. Alleman F., Leclercq B. Effect of dietary protein and environmental temperature on growth performance and water consumption of male broiler chickens. Br. Poult. Sci. 1997;38:607–610. doi: 10.1080/00071669708418044. [DOI] [PubMed] [Google Scholar]
  4. Allen P.C. Effects of daily oral doses of L-arginine on coccidiosis infections in chickens. Poult. Sci. 1999;78:1506–1509. doi: 10.1093/ps/78.11.1506. [DOI] [PubMed] [Google Scholar]
  5. Allen P.C., Fetterer R.H. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of infection with these coccidian parasites of poultry. Clin. Microbiol. Rev. 2002;15:58–65. doi: 10.1128/CMR.15.1.58-65.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. AOAC . AOAC International Official Methods of Analysis. 18th ed. AOAC Int.; Gaithersburg, MD: 2006. [Google Scholar]
  7. Arczewska-Włosek A., Świątkiewicz S., Kowal J., Józefiak D., Długosz J. The effect of increased crude protein level and/or dietary supplementation with herbal extract blend on the performance of chickens vaccinated against coccidiosis. Anim. Feed Sci. Tech. 2017;229:65–72. [Google Scholar]
  8. Badawi M.E.-S., Ali A.H., El-Razik W.M.A., Soliman M.H. Influence of low crude protein diets on broiler chickens performance. Adv. Anim. Vet. Sci. 2019;7:26–33. [Google Scholar]
  9. Belloir P., Meda B., Lambert W., Corrent E., Juin H., Lessire M., Tesseraud S. Reducing the CP content in broiler feeds: impact on animal performance, meat quality and nitrogen utilization. Animal. 2017;11:1881–1889. doi: 10.1017/S1751731117000660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Beri D., Balan B., Chaubey S., Subramaniam S., Surendra B., Tatu U. A disrupted transsulphuration pathway results in accumulation of redox metabolites and induction of gametocytogenesis in malaria. Sci. Rep. 2017;7:40213. doi: 10.1038/srep40213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Blake D.P., Knox J., Dehaeck B., Huntington B., Rathinam T., Ravipati V., Ayoade S., Gilbert W., Adebambo A.O., Jatau I.D., Raman M., Parker D., Rushton J., Tomley F.M. Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020;51:115. doi: 10.1186/s13567-020-00837-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bortoluzzi C., Rochell S.J., Applegate T.J. Threonine, arginine, and glutamine: influences on intestinal physiology, immunology, and microbiology in broilers. Poult. Sci. 2018;97:937–945. doi: 10.3382/ps/pex394. [DOI] [PubMed] [Google Scholar]
  13. Britton W.M., Hill C.H., Barber C.W. A mechanism of interaction between dietary protein levels and coccidiosis in chicks. J. Nutr. 1964;82:306–310. doi: 10.1093/jn/82.3.306. [DOI] [PubMed] [Google Scholar]
  14. Broer S., Fairweather S.J. Amino acid transport across the mammalian intestine. Compr. Physiol. 2018;9:343–373. doi: 10.1002/cphy.c170041. [DOI] [PubMed] [Google Scholar]
  15. Castro F.L.S., Kim W.K. Secondary functions of arginine and sulfur amino acids in poultry health: review. Animals. 2020;10 doi: 10.3390/ani10112106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Castro F.L.S., Teng P.Y., Yadav S., Gould R.L., Craig S., Pazdro R., Kim W.K. The effects of L-arginine supplementation on growth performance and intestinal health of broiler chickens challenged with Eimeria spp. Poult. Sci. 2020;99:5844–5857. doi: 10.1016/j.psj.2020.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chapman H.D. Studies on the excystation of different species of Eimeria in vitro. Z. Parasitenkd. 1978;56:115–121. doi: 10.1007/BF00930742. [DOI] [PubMed] [Google Scholar]
  18. Chapman H.D. Milestones in avian coccidiosis research: a review. Poult. Sci. 2014;93:501–511. doi: 10.3382/ps.2013-03634. [DOI] [PubMed] [Google Scholar]
  19. Chen J., Tellez G., Richards J.D., Escobar J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front. Vet. Sci. 2015;2:14. doi: 10.3389/fvets.2015.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chen Y., Zhang H., Cheng Y., Li Y., Wen C., Zhou Y. Dietary l-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 2018;119:1254–1262. doi: 10.1017/S0007114518000740. [DOI] [PubMed] [Google Scholar]
  21. Chen Y.P., Cheng Y.F., Li X.H., Yang W.L., Wen C., Zhuang S., Zhou Y.M. Effects of threonine supplementation on the growth performance, immunity, oxidative status, intestinal integrity, and barrier function of broilers at the early age. Poult. Sci. 2017;96:405–413. doi: 10.3382/ps/pew240. [DOI] [PubMed] [Google Scholar]
  22. Chokshi N.K., Guner Y.S., Hunter C.J., Upperman J.S., Grishin A., Ford H.R. The role of nitric oxide in intestinal epithelial injury and restitution in neonatal necrotizing enterocolitis. Semin. Perinatol. 2008;32:92–99. doi: 10.1053/j.semperi.2008.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Cliffe L.J., Humphreys N.E., Lane T.E., Potten C.S., Booth C., Grencis R.K. Accelerated intestinal epithelial cell turnover: a new mechanism of parasite expulsion. Science. 2005;308:1463–1465. doi: 10.1126/science.1108661. [DOI] [PubMed] [Google Scholar]
  24. Cobb-Vantress. 2018. Cobb broiler management guide. Accessed April 2021. http://cobbsa.co.za/wp-content/uploads/2018/03/BROILER-GUIDE-ENG-2018.pdf.
  25. Costa K.A., Soares A.D., Wanner S.P., Santos R., Fernandes S.O., Martins Fdos S., Nicoli J.R., Coimbra C.C., Cardoso V.N. L-arginine supplementation prevents increases in intestinal permeability and bacterial translocation in male Swiss mice subjected to physical exercise under environmental heat stress. J. Nutr. 2014;144:218–223. doi: 10.3945/jn.113.183186. [DOI] [PubMed] [Google Scholar]
  26. Drew M.D., Syed N.A., Goldade B.G., Laarveld B., Van Kessel A.G. Effects of dietary protein source and level on intestinal populations of Clostridium perfringens in broiler chickens. Poult. Sci. 2004;83:414–420. doi: 10.1093/ps/83.3.414. [DOI] [PubMed] [Google Scholar]
  27. Fetterer R.H., Miska K.B., Jenkins M.C., Wong E.A. Expression of nutrient transporters in duodenum, jejunum, and ileum of Eimeria maxima-infected broiler chickens. Parasitol. Res. 2014;113:3891–3894. doi: 10.1007/s00436-014-4114-3. [DOI] [PubMed] [Google Scholar]
  28. Gilbert E.R., Li H., Emmerson D.A., Webb K.E., Jr., Wong E.A. Developmental regulation of nutrient transporter and enzyme mRNA abundance in the small intestine of broilers. Poult. Sci. 2007;86:1739–1753. doi: 10.1093/ps/86.8.1739. [DOI] [PubMed] [Google Scholar]
  29. Greenhalgh S., Chrystal P.V., Selle P.H., Liu S.Y. Reduced-crude protein diets in chicken-meat production: justification for an imperative. Worlds Poult. Sci. J. 2020;76:537–548. doi: 10.1016/j.aninu.2020.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Han Y., Baker D.H. Effects of excess methionine or lysine for broilers fed a corn-soybean meal diet. Poult. Sci. 1993;72:1070–1074. doi: 10.3382/ps.0721070. [DOI] [PubMed] [Google Scholar]
  31. Hilliar M., Hargreave G., Girish C.K., Barekatain R., Wu S.B., Swick R.A. Using crystalline amino acids to supplement broiler chicken requirements in reduced protein diets. Poult. Sci. 2020;99:1551–1563. doi: 10.1016/j.psj.2019.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kim M.H., Kim H. The roles of glutamine in the intestine and its implication in intestinal diseases. Int. J. Mol. Sci. 2017;18 doi: 10.3390/ijms18051051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kumar A., Palfrey H.A., Pathak R., Kadowitz P.J., Gettys T.W., Murthy S.N. The metabolism and significance of homocysteine in nutrition and health. Nutr. Metab. 2017;14:78. doi: 10.1186/s12986-017-0233-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lai A., Dong G., Song D., Yang T., Zhang X. Responses to dietary levels of methionine in broilers medicated or vaccinated against coccidia under Eimeria tenella-challenged condition. BMC Vet. Res. 2018;14:140. doi: 10.1186/s12917-018-1470-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Laika M., Jahanian R. Increase in dietary arginine level could ameliorate detrimental impacts of coccidial infection in broiler chickens. Livest. Sci. 2017;195:38–44. [Google Scholar]
  36. Lemme A., Hiller P., Klahsen M., Taube V., Stegemann J., Simon I. Reduction of dietary protein in broiler diets not only reduces n-emissions but is also accompanied by several further benefits. J. Appl. Poult. Res. 2019;28:867–880. [Google Scholar]
  37. Liu D., Guo S., Guo Y. Xylanase supplementation to a wheat-based diet alleviated the intestinal mucosal barrier impairment of broiler chickens challenged by Clostridium perfringens. Avian Pathol. 2012;41:291–298. doi: 10.1080/03079457.2012.684089. [DOI] [PubMed] [Google Scholar]
  38. Liu J., Teng P.-Y., Kim W.K., Applegate T.J. Assay considerations for fluorescein isothiocyanate-dextran (FITC-d): an indicator of intestinal permeability in broiler chickens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  40. Luquetti B.C., Alarcon M.F.F., Lunedo R., Campos D.M.B., Furlan R.L., Macari M. Effects of glutamine on performance and intestinal mucosa morphometry of broiler chickens vaccinated against coccidiosis. Sci. Agric. 2016;73:322–327. [Google Scholar]
  41. Mao X., Zeng X., Qiao S., Wu G., Li D. Specific roles of threonine in intestinal mucosal integrity and barrier function. Front. Biosci. 2011;3:1192–1200. doi: 10.2741/e322. [DOI] [PubMed] [Google Scholar]
  42. Metzler-Zebeli B.U., Magowan E., Hollmann M., Ball M.E.E., Molnar A., Witter K., Ertl R., Hawken R.J., Lawlor P.G., O'Connell N.E., Aschenbach J., Zebeli Q. Differences in intestinal size, structure, and function contributing to feed efficiency in broiler chickens reared at geographically distant locations. Poult. Sci. 2018;97:578–591. doi: 10.3382/ps/pex332. [DOI] [PubMed] [Google Scholar]
  43. Oxford J.H., Selvaraj R.K. Effects of glutamine supplementation on broiler performance and intestinal immune parameters during an experimental coccidiosis infection. J. Appl. Poul. Res. 2019;28:1279–1287. [Google Scholar]
  44. Perna A.F., Ingrosso D., Lombardi C., Acanfora F., Satta E., Cesare C.M., Violetti E., Romano M.M., De Santo N.G. Possible mechanisms of homocysteine toxicity. Kidney Int. 2003;84:S137–S140. doi: 10.1046/j.1523-1755.63.s84.33.x. [DOI] [PubMed] [Google Scholar]
  45. Poritz L.S., Harris L.R., 3rd, Kelly A.A., Koltun W.A. Increase in the tight junction protein claudin-1 in intestinal inflammation. Dig. Dis. Sci. 2011;56:2802–2809. doi: 10.1007/s10620-011-1688-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rao R., Samak G. Role of glutamine in protection of intestinal epithelial tight junctions. J. Epithel. Biol. Pharmacol. 2012;5:47–54. doi: 10.2174/1875044301205010047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ren Z., Butz D.E., Whelan R., Naranjo V., Arendt M.K., Ramuta M.D., Yang X., Crenshaw T.D., Cook M.E. Effects of dietary methionine plus cysteine levels on growth performance and intestinal antibody production in broilers during Eimeria challenge. Poult. Sci. 2020;99:374–384. doi: 10.3382/ps/pez503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rochell S.J., Helmbrecht A., Parsons C.M., Dilger R.N. Influence of dietary amino acid reductions and Eimeria acervulina infection on growth performance and intestinal cytokine responses of broilers fed low crude protein diets. Poult. Sci. 2016;95:2602–2614. doi: 10.3382/ps/pew153. [DOI] [PubMed] [Google Scholar]
  49. Rochell S.J., Usry J.L., Parr T.M., Parsons C.M., Dilger R.N. Effects of dietary copper and amino acid density on growth performance, apparent metabolizable energy, and nutrient digestibility in Eimeria acervulina-challenged broilers. Poult. Sci. 2017;96:602–610. doi: 10.3382/ps/pew276. [DOI] [PubMed] [Google Scholar]
  50. Schneeberger E.E., Lynch R.D. The tight junction: a multifunctional complex. Am. J. Physiol. Cell Physiol. 2004;286:C1213–C1228. doi: 10.1152/ajpcell.00558.2003. [DOI] [PubMed] [Google Scholar]
  51. Schneiders G.H., Foutz J.C., Milfort M.C., Ghareeb A.F.A., Sorhue U.G., Richter J.N., Fuller A.L., Williams S.M., Rekaya R., Aggrey S.E. Ontogeny of intestinal permeability in chickens infected with Eimeria maxima: implications for intestinal health. J. Adv. Parasitol. 2019;6:41–50. [Google Scholar]
  52. Shao Y., Guo Y., Wang Z. beta-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Poult. Sci. 2013;92:1764–1773. doi: 10.3382/ps.2013-03029. [DOI] [PubMed] [Google Scholar]
  53. Sharma V.D., Fernando M.A., Summers J.D. The effect of dietary crude protein level on intestinal and cecal coccidiosis in chicken. Can. J. Comp. Med. 1973;37:195–199. [PMC free article] [PubMed] [Google Scholar]
  54. Short F.J., Gorton P., Wiseman J., Boorman K.N. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Tech. 1996;59:215–221. [Google Scholar]
  55. Star L., Rovers M., Corrent E., van der Klis J.D. Threonine requirement of broiler chickens during subclinical intestinal Clostridium infection. Poult. Sci. 2012;91:643–652. doi: 10.3382/ps.2011-01923. [DOI] [PubMed] [Google Scholar]
  56. Stein H.H., Fuller M.F., Moughan P.J., Sève B., Mosenthin R., Jansman A.J.M., Fernández J.A., de Lange C.F.M. Definition of apparent, true, and standardized ileal digestibility of amino acids in pigs. Livest. Sci. 2007;109:282–285. [Google Scholar]
  57. Su S., Miska K.B., Fetterer R.H., Jenkins M.C., Wong E.A. Expression of digestive enzymes and nutrient transporters in Eimeria-challenged broilers. Exp. Parasitol. 2015;150:13–21. doi: 10.1016/j.exppara.2015.01.003. [DOI] [PubMed] [Google Scholar]
  58. Sukhotnik I., Helou H., Mogilner J., Lurie M., Bernsteyn A., Coran A.G., Shiloni E. Oral arginine improves intestinal recovery following ischemia-reperfusion injury in rat. Pediatr. Surg. Int. 2005;21:191–196. doi: 10.1007/s00383-004-1318-0. [DOI] [PubMed] [Google Scholar]
  59. Sun L., Dong H., Zhang Z., Liu J., Hu Y., Ni Y., Grossmann R., Zhao R. Activation of epithelial proliferation induced by Eimeria acervulina infection in the duodenum may be associated with cholesterol metabolism. Oncotarget. 2016;7:27627–27640. doi: 10.18632/oncotarget.8490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tan J., Applegate T.J., Liu S., Guo Y., Eicher S.D. Supplemental dietary L-arginine attenuates intestinal mucosal disruption during a coccidial vaccine challenge in broiler chickens. Br. J. Nutr. 2014;112:1098–1109. doi: 10.1017/S0007114514001846. [DOI] [PubMed] [Google Scholar]
  61. Teng P.-Y., Choi J., Tompkins Y.H., Lillehoj H.S., Kim W.K. Impacts of increasing challenge with Eimeria maxima on the growth performance and the gene expression of biomarkers associated with intestinal integrity and nutrient transporters. Vet. Res. 2021;52 doi: 10.1186/s13567-021-00949-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Teng P.Y., Yadav S., Castro F.L.S., Tompkins Y.H., Fuller A.L., Kim W.K. Graded Eimeria challenge linearly regulated growth performance, dynamic change of gastrointestinal permeability, apparent ileal digestibility, intestinal morphology, and tight junctions of broiler chickens. Poult. Sci. 2020;99:4203–4216. doi: 10.1016/j.psj.2020.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Utech M., Ivanov A.I., Samarin S.N., Bruewer M., Turner J.R., Mrsny R.J., Parkos C.A., Nusrat A. Mechanism of IFN-gamma-induced endocytosis of tight junction proteins: myosin II-dependent vacuolarization of the apical plasma membrane. Mol. Biol. Cell. 2005;16:5040–5052. doi: 10.1091/mbc.E05-03-0193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. van Harn J., Dijkslag M.A., van Krimpen M.M. Effect of low protein diets supplemented with free amino acids on growth performance, slaughter yield, litter quality, and footpad lesions of male broilers. Poult. Sci. 2019;98:4868–4877. doi: 10.3382/ps/pez229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Viana M.L., Santos R.G., Generoso S.V., Arantes R.M., Correia M.I., Cardoso V.N. Pretreatment with arginine preserves intestinal barrier integrity and reduces bacterial translocation in mice. Nutrition. 2010;26:218–223. doi: 10.1016/j.nut.2009.04.005. [DOI] [PubMed] [Google Scholar]
  66. Vieira S.L., Lemme A., Goldenberg D.B., Brugalli I. Responses of growing broilers to diets with increased sulfur amino acids to lysine ratios at two dietary protein levels. Poult. Sci. 2004;83:1307–1313. doi: 10.1093/ps/83.8.1307. [DOI] [PubMed] [Google Scholar]
  67. Xie M., Hou S.S., Huang W., Fan H.P. Effect of excess methionine and methionine hydroxy analogue on growth performance and plasma homocysteine of growing Pekin ducks. Poult. Sci. 2007;86:1995–1999. doi: 10.1093/ps/86.9.1995. [DOI] [PubMed] [Google Scholar]
  68. Yu J.C., Jiang Z.M., Li D.M. Glutamine: a precursor of glutathione and its effect on liver. World J. Gastroenterol. 1999;5:143–146. doi: 10.3748/wjg.v5.i2.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Yun C.H., Lillehoj H.S., Lillehoj E.P. Intestinal immune responses to coccidiosis. Dev. Comp. Immunol. 2000;24:303–324. doi: 10.1016/s0145-305x(99)00080-4. [DOI] [PubMed] [Google Scholar]
  70. Zhang B., Lv Z., Li H., Guo S., Liu D., Guo Y. Dietary l-arginine inhibits intestinal Clostridium perfringens colonisation and attenuates intestinal mucosal injury in broiler chickens. Br. J. Nutr. 2017;118:321–332. doi: 10.1017/S0007114517002094. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES