Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2021 May 6;7(5):1575–1586. doi: 10.1002/vms3.490

Trial for use nanoselenium particle with different dietary regime in Oreochromis niloticus and Mugil cephalus polyculture ponds: Growth efficiency, haematological, antioxidant, immunity and transcriptional analysis

Eman M Moustafa 1,✉, Marwa F Abd El‐Kader 2, Montaser M Hassan 3, Ahmed F Fath El‐Bab 4, Amira Omar 1, Foad Farrag 5, Ahmed G Gewida 6, Mohamed F Abd‐Elghany 6, Mustafa Shukry 7, Rasha A Alwakeel 7
PMCID: PMC8464258  PMID: 33955189

Abstract

Background

Fish farming is one of the most productive economies in the world. One of the essential goals in fish production is to minimize processing costs while maintaining and increasing the vital functions, weight and immunity of fish.

Objective

We conducted this study to explore nanoselenium (Nano‐Se) particles in various feeding schemes.

Material and Method

Nano‐Se particles incorporated in the basal diet at (0.5 mg/kg diet), and the fish was divided into six groups after adaptation as the follows: The first group was feed daily with a diet containing Nano‐Se (0.5 mg/kg diet); the second group was exposed to a feeding programme in which it has day feeding followed by day of starvation with a diet containing Nano‐Se (0.5 mg/kg diet); the third group was day feeding followed by 2 days of starvation; the fourth group served as a negative control group in which this group was continuous feeding with a basal diet without Nano‐Se; the fifth group was day feeding with the basal diet followed by a day of starvation; and the sixth group was day feeding with basal diet followed by 2 days of starvation.

Result

Our result revealed that Group 2 showed significant improvement in haematological parameters, red blood cells and haemoglobin with a substantial increase in total protein (p < 0.05) as well as lysosomal and phagocytic activity with considerable upregulation of growth hormone and insulin growth factor 1 in addition to markedly increase in the pro‐inflammatory cytokines. Finally, this study offers the first‐time dietary regime with Nano‐Se supplementation that saves the feeding cost and increases fish welfare and growth.

Keywords: cytokines, growth markers genes, Mugil cephalus, Nano‐Se, Oreochromis niloticus, performance

Nanoselenium (Nano‐Se) supplementation with dietary regime that feeding the fish one day followed by one day starvation and soon has the tendency to potentiate the growth efficiency and immunity as well as improvement the growth hormone, insulin growth factors and pro‐inflammatory cytokines. These finding for the first time supported our hypothesis that confirm the Nano‐Se supplementation to the diet of fish with special dietary regime could be useful for aquatic life and economy in decreasing the feeding cost as well as increasing the fish health welfare and growth.

graphic file with name VMS3-7-1575-g001.jpg

1. INTRODUCTION

Understanding and implementing appropriate feeding strategies for nutrients can reduce waste and increase profit. In general, feed quality is essential for livestock farming. The feeding frequency dictates the time (feeding interval) between meals. The effects of interval feeding in fish depend on the species, sex, age and capacity. For compensatory growth and deposition of fat, for optimizing development and increasing feed performance, feeding intervals in favour of optimum digestibility and protein, tilapia were fed at intervals of 2–3 hr eat more than its volume of the stomach, so that some feed passes through the stomach without being digested (Riche, Oetker, et al., 2004). A feeding rate of one meal every 4–5 hr (three times a day) delivers optimal results (Riche, Haley, et al., 2004). Restricted feeding has lower costs, increased feeding performance, reduced carcass fat build‐up and better water quality.

Several studies have been used to boost feed quality, such as gastric evacuation time that enriches the fish appetite and refeeding after starvation, enhancing feed utilization and development (Chan et al., 2008; Riche, Haley, et al., 2004). Feeding intervals have a precise impact on the water quality, fish well‐being and immunity (Garcia & Villarroel, 2009; Lee et al., 2000). There was an optimum feeding frequency of twice daily for the larvae and juveniles of hybrid tilapia (Qiang et al., 2009) at the same time as six times per day has been described for juveniles (Tung & Shiau, 1991). The mixed‐sex juveniles Nile tilapia have gained optimum growth when fed four times a day in brackish water (Daudpota et al., 2016) while providing six times per day was optimum for male juveniles a freshwater pond (Pouomogne & Ombredane, 2001). This dispute's outcomes are based on variations in experimental fish genetic origins, nutrition, age and culture conditions. The growth output of sex‐reversed Nile tilapia has been affected by different feeding frequencies. Different feeding frequencies had a significant effect on the growth performance of sex‐reversed Nile tilapia. Fish fed twice and three times a day showed higher growth rate due to the increased Chymotrypsin and other digestive enzymes (Thongprajukaew et al., 2017).

Tilapia is well suited to many environments and feeding plans (Byamungu et al., 2001), although increased feeding rates seem to confer more excellent disease resistance (Garcia et al., 2009). Grey mullets (Mugilidae family) play an essential role in the fish cultures globally, South East Asia, primarily the Mediterranean (Crosetti, 2015). Although mullets are the main significant farmed fish in many countries, no different feeds are offered (Crosetti, 2015). Mullets are very popular as food in Egypt. They have been the cornerstone of fish farming for centuries because their fries are different seasons of the year, available in millions in fresh and brackish water (Wassef et al., 2001).

Nanotechnologies in aquaculture provide a wide variety of applications, ranging from sterilizing pools, water treatment, identification and management of aquatic conditions, adequate supplies of nutrients and medicines (including hormones and vaccine, Huang et al., 2015). The interest in using nano‐trace elements as animal feed supplements has recently increased due to increased bioavailability concerning inorganic salts. However, the use of high amounts of inorganic Se has posed environmental issues due to the high volume of faecal Se excretion (Dawood, Koshio, Zaineldin, Van Doan, Moustafa, et al., 2019). Nanoparticles are more accessible to the biological system in small quantities, decreasing feeding costs (Naderi et al., 2019). Trace minerals are essential in the nutrition and metabolism of many living species. Selenium (Se) is one of those constituencies. It plays a crucial part in antioxidant and disease resistance and growth (Suttle, 2010).

Selenium deficiency in the diet of fish led to an increase in the chance of disease, retardation of development and declined immunity (Jobling, 2012). Today, nanotechnology is used in aquaculture for many purposes due to its ability to increase feed absorption (El Basuini et al., 2017). Nanoselenium (Nano‐Se) has recently been bioavailable in fish diets to improve the immune and antioxidant response (Saffari et al., 2018). Nanoparticles with a particular smaller dimension than a hundred nm give a more significant proportion of surface ions and physicochemical shifts. Nanoparticles may enter the body through gastrointestinal tract or another different way; inside the body, these nanoparticles will contact immune cells (Cupaioli et al., 2014). Selenium is a vital microelement essential for developing fish efficiency and health (Pacitti et al., 2016). Selenium nanoparticle has been utilized due to its high‐level bioavailability and low malignancy when fed to fish in adequate quantities (Dawood, Koshio, Zaineldin, Van Doan, Moustafa, et al., 2019). The Nano‐Se application had beneficial effects on many fish species' efficiency and wellness (Saffari et al., 2017). The current study aimed to assess the influence of feeding Nano‐Se particles with different feeding and starvation regime in Oreochromis niloticus and Mugil cephalus growth performance, liver function and antioxidant activity (superoxide dismutase [SOD], catalase [CAT], and glutathione peroxidase [GPx]). Besides, evaluate their effect on the haematological markers, phagocytic activity and lysozyme activity as well as the impact of Selenium nanoparticles on growth markers gene and cytokines gene expression.

2. MATERIAL AND METHODS

2.1. Experimental design

Fish were raised in standard concrete ponds (2 × 1 × 1 m) on a private farm located in Dakahlia, Egypt, eight O. niloticus fish and seven M. cephalus in 1 m with initial weight 27 ± 0.5 and 25 ± 1 g/fish, respectively. The fish were acclimated for 14 days before beginning the experiment; after that, the fish were distributed randomly into six groups (two replicates for each group). The first group was fed daily with a diet containing Nano‐Se (0.5 mg/kg diet); the second group was exposed to a feeding programme in which it has day feeding followed by day of starvation with a diet containing Nano‐Se (0.5 mg/kg diet) according to (Abd El‐Kader et al., 2020); the third group was day feeding followed by 2 days of starvation; the fourth group served as a negative control group in which this group was continuous feeding with a basal diet without Nano‐Se; the fifth group was day feeding with the basal diet followed by a day of starvation; and the sixth group was day feeding with basal diet followed by 2 days of starvation (see Figure S1).

Groups Diet Number of replicates Feeding programme
Group 1 Basal diet + Nano‐Se (0.5 mg/kg diet) 2 Continuous feeding
Group 2 Basal diet + Nano‐Se (0.5 mg/kg diet) 2 Day feeding followed by day of starvation
Group 3 Basal diet + Nano‐Se (0.5 mg/kg diet) 2 Day feeding followed by 2 days of starvation
Group 4 Basal diet only 2 Continuous feeding
Group 5 Basal diet only 2 Day feeding followed by day of starvation
Group 6 Basal diet only 2 Day feeding followed by 2 days of starvation
Open in a new tab

The fish in all the groups were fed at a rate of 3% of body weight‐adjusted weekly according to weight. Each diet (29% protein) was provided to its respective pond according to the feeding programme for 12 weeks. After diet formation, the selenium ratio will be 0.06 mg/kg diet and a 0.58 mg/kg diet for the control and Nano‐Se group. All fish have been carefully weighed in bulk weekly for growth and health tests. The water quality parameters were not significantly differentiated during the experimental period. The water's average temperature was 24.1 ± 0.3°C and dissolved O2 6.2 ± 0.42 mg/L; pH was 7.24–7.46, ammonia concentration 0.22–0.23 mg/L as assayed by DREL/2 HACH kits (Hach Co.) (see Table S1).

2.2. Growth parameter

The following equations were used to calculate the weight gain (WG), specific growth rate (SGR) and feed conversion ratio (FCR) after fasting the fish for 24 hr. WG (WG %) = 100 × [final body weight (FBW, g) − initial body weight (IBW, g)]/IBW (g). Daily weight gain (DWG) = (mean final weigh − tcmean initial weight)/(days). SGR (%/day) = 100 × [ln FBW (g) − ln IBW (g)]/days. FCR = total dry feed intake (g)/[FBW (g) − IBW (g)].

2.3. Sampling

All fish were anesthetically screened using MS222 150 mg/L (Argent Laboratories) at zero‐days and at the end of the 12‐week feeding experiment.

Each fish's weight was individually assessed. Blood samples were obtained using an anticoagulant syringe and without‐anticoagulant syringe from four fish caudal blood vessels per pond, and serum obtained using 1968 g /15 min at 4°C centrifuges. The serum was kept at −20°C until further analysis.

2.4. Haematology and biochemical parameters

After dissolution with Natt and Herrick's solution, a haemocytometer was used immediately with red blood cells (RBCs) as well as white blood cells (WBCs) (Houston, 1990). For WBCs and differential count were assayed according to (Jain, 1986; Lucky & Lucký, 1977), Hb concentration analysis following (Blaxhall & Daisley, 1973). Total protein, albumin, globulin, ALT and AST assessed using ready‐made chemicals (kits) supplied by Spinreact Co., according to the manufacturer's instructions with an RA‐50 chemistry analyzer (Bayer). Phagocytic activity is determined according to Kawahara et al. (1991). Phagocytic activity = macrophages containing yeast/total number of macrophages × 100; phagocytic index = number of cells phagocytized/number of phagocytic cells. The lysozyme activity was determined according to Parry et al. (1965).

2.5. Antioxidants markers analysis

In the fish serum, the levels of SOD, CAT, GPx and malondialdehyde (MDA) were assessed using diagnostic reagent kits following the procedure for the manufacturer (Cusabio Biotech Co., Ltd).

2.6. Gene expression

Analysis of mRNA expression for different genes (real‐time polymerase chain reaction [RT‐PCR]) and β‐actin (an internal guide for normalizing data on gene expression) was performed using the primers shown in Table 1. Following the manufacturer's protocol, the total RNA was extracted from the liver samples using Trizol reagents Trizol (iNtRON Biotechnologie). With 2% agarose electrophoresis, the content of the extracted RNA was confirmed. Nanodrop (Quawell) determined the RNA concentration; 2 μg of total RNA was reverse transcribed using the manufacturer's cDNA synthesis kit (Bioline) as a guide. In 20‐μl reaction mixtures containing 2 μl of cDNA, gene‐specific primers (0.5 μM each) and SYBR 10 μl, real‐time PCR amplifications were performed using the SensiFast SYBR Lo‐Rox kit (Bioline). Thermal cycling conditions were initial denaturation at 95°C for 10 min, then 40 cycles at 95°C for 15 s and 60°C for 1 min. They double‐checked the genes using (2−ΔΔCT) (Livak & Schmittgen, 2001).

TABLE 1.

Gene primer for real‐time PCR

Target gene Forward Reverse Accession number
β‐actin (Oreochromis niloticus) GTGCCCATCTACGAGGGTTA CTCCTTAATGTCACGCACGA Pang et al. (2013)
β‐actin (Mugil) TGCAGTCAACATCTGGAATC ATTTTTGGCGCTTGACTCAG Abdel‐Mageid et al. (2020)
IL‐1β (O. niloticus) CTTCCCATAGACTCTGAGTAGCG AAGGATGACGACAAGCCAAC KF747686.1
IL‐1β (Mugil) GAGGAGCTTGGTGCAGAACA CTTTGTTCGTCACCTCCTCCA Abdel‐Mageid et al. (2020)
IGF‐1 (O. niloticus) CACCCTCTCACTACTGCTGT CACAGTACATCTCAAGGCGC EU272149.1
IGF‐1 (Mugil) ACCTGATGAGTGGGAAGTGG GCATCTCCGGCTCATCTTTG AY772256.1
GH (O. niloticus) CTGGTTGAGTCCTGGGAGTT CAGGTGGTTAGTCGCATTGG KT387598.1
GH (Mugil) TGCTTCAAAAAGGACATGCA GATGTTTGCAGGTTGAG AC AF134605
Open in a new tab

Abbreviation: PCR, polymerase chain reaction; IL‐1β, Interleukin 1 Beta; IGF‐1, Insulin growth factor 1; GH, Growth hormone.

2.7. Data analysis

The tests of Shapiro–Wilk and Levene confirmed that the variance was normal distribution and homogeneous. All statistical differences were measured by the one‐way analysis of variance (ANOVA) research (SPSS version 23; SPSS Inc.) and by Duncan as a post hoc test. Where there were differences between groups of study, they were accepted at p < 0.05. All data are displayed as of mean ± SE. Two‐way ANOVA was used for gene expression analysis.

3. RESULTS

3.1. Effect of Nano‐Se on the haematological and biochemical parameter

There was no significant difference in haematological and biochemical parameters and no variation in protein content, liver enzymes, phagocytic index and lysosomal activity between different treated groups in day zero treatment in O. niloticus fish and Mugil fish, as shown in Tables 2 and 3.

TABLE 2.

Haematological and biochemical parameters of Oreochromis niloticus at zero day of experiment

G1 G2 G3 G4 G5 G6 SE p value
RBCs 2.125 2.11 2.065 2.085 2.055 2.025 0.04 0.351
Hb 6.33 6.32 6.255 6.315 6.235 6.265 0.05 0.524
PCV 20 20 19.5 20 19 19 0.64 0.424
MCV 94.13 94.75 94.435 95.94 92.475 93.84 2.5 0.84
MCH 29.79 29.955 30.305 30.29 30.34 30.94 0.39 0.209
MCHC 31.65 31.665 32.09 31.575 32.815 32.975 0.85 0.465
WBCs 10.24 9.67 10.11 10.22 10.20 10.22 0.21 0.319
Heterophil 1.44 1.16 1.42 1.33 1.23 1.38 1.9 0.413
Lymphocyte 7.83 7.78 7.84 7.92 8.16 7.87 1.4 0.124
Monocyte 0.82 0.68 0.76 0.72 0.72 0.77 0.4 0.212
Eosinophil 0.10 0.00 0.05 0.10 0.00 0.05 0.4 0.158
Basophil 0.05 0.05 0.05 0.16 0.10 0.16 0.64 0.424
Lysozyme 8.895 8.895 9.04 8.955 9.005 8.975 0.05 0.216
Phagocytic activity 9.985 10.025 10.005 9.44 9.795 9.94 0.29 0.423
Phagocytic index 0.84 0.935 0.97 0.89 0.98 0.855 0.03 0.15
Total protein 3.755 3.585 3.685 3.665 3.64 3.65 0.05 0.149
Albumin 1.53 1.465 1.54 1.51 1.51 1.52 0.02 0.273
Globulin 2.225 2.12 2.145 2.155 2.13 2.13 0.06 0.592
AST 29.2 28.87 28.57 28.82 28.535 28.88 0.41 0.631
ALT 26.995 26.52 26.8 27.425 27.035 26.755 0.64 0.795
MDA 18.57 20.46 19.205 19.17 19.325 19.075 0.58 0.176
GPx 12.985 13.41 13.515 13.61 13.215 13.59 0.19 0.99
CAT 10.615 10.475 10.57 10.665 10.475 10.505 0.04 0.226
SOD 10.19 10.225 10.295 10.3 10.36 10.3 0.09 0.554
Open in a new tab

Values are expressed as means ± SE.

Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; CAT, catalase; GPx, glutathione peroxidase; Hb, haemoglobin; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; MDA, malondialdehyde; PCV, packed cell volume; RBCs, red blood cells; SOD, superoxide dismutase; WBCs, white blood cells.

TABLE 3.

Haematological and biochemical parameters of Mugil cephalus at zero day of experiment

G1 G2 G3 G4 G5 G6 SE p value
RBCs 3.08 3.075 3.165 3.12 3.09 3.095 0.04 0.394
Hb 9.41 9.455 9.595 9.4 9.525 9.495 0.08 0.352
PCV 29.5 29 30.5 30.5 29.5 30 0.57 0.182
MCV 95.78 94.31 96.36 97.75 95.465 96.93 1.02 0.126
MCH 30.555 30.75 30.32 30.13 30.825 30.675 0.26 0.2
MCHC 31.9 32.605 31.465 30.825 32.295 31.65 0.47 0.08
WBCs 12.5 11.9 11.8 12.1 11.9 12.0 0.3 0.519
Heterophil 1.9 1.8 1.8 1.9 1.8 2.1 1.6 0.673
Lymphocyte 9.5 9.0 9.0 9.1 9.2 8.6 2.04 0.323
Monocyte 1.0 0.8 0.8 1.0 0.8 1.0 0.707 0.158
Eosinophil 0.0 0.1 0.1 0.1 0.1 0.1 0.4 0.212
Basophil 0.1 0.1 0.1 0.2 0.1 0.1 0.7 0.833
Lysozyme 9.945 10.01 10.055 9.995 10.025 10.01 0.14 0.982
Phagocytic activity 10.89 11.01 10.97 11.19 10.96 11.1 0.08 0.08
Phagocytic index 0.925 1.06 0.985 1.065 0.835 1.035 0.06 0.048
Total protein 4.01 4.085 4.135 4.065 4.085 4.105 0.014 0.24
Albumin 1.74 1.7 1.745 1.735 1.705 1.775 0.035 0.394
Globulin 2.27 2.385 2.39 2.33 2.28 2.33 0.04 0.136
AST 20.085 19.775 20.06 19.71 19.795 19.975 0.127 0.098
ALT 22.97 23.125 22.92 23.12 23.305 22.935 0.19 0.44
MDA 21.52 22.045 21.725 22.45 21.795 22.16 0.19 0.129
GPx 13.825 13.935 14.005 14.055 13.925 14.04 0.11 0.396
CAT 9.94 9.95 9.965 9.9 9.9 9.895 0.08 0.921
SOD 9.93 10.09 10.06 10.095 10.01 10 0.06 0.223
Open in a new tab

Values are expressed as means ± SE.

Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; CAT, catalase; GPx, glutathione peroxidase; Hb, haemoglobin; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; MDA, malondialdehyde; PCV, packed cell volume; RBCs, red blood cells; SOD, superoxide dismutase; WBCs, white blood cells.

After 12 weeks of treatment, our result showed that Group 2 (Nano‐Se + day feed + day starvation), as well as Group 1 (continuous Nano‐Se feeding), was significantly increased in packed cell volume and RBCs (Table 4) as well as lysosomal activity and total leukocytic count with decreased heterophile % concerning other treated groups of O. niloticus fish. In the same way, there was a markedly increase in lysosomal, phagocytic activity and index, as well as there was a significant increase in globulin and total protein concentration with a markedly decrease in MDA level with a substantial rise in GPx, CAT and SOD concerning other treated groups.

TABLE 4.

Effect of Nano‐SE particles on the haematological and biochemical parameters of Oreochromis niloticus after 12 weeks of experiment

G1 G2 G3 G4 G5 G6 SE p value
RBCs 8.62a 9.025a 6.925c 6.825c 7.835b 6.8c 0.058 0
Hb 2.125 2.11 2.065 2.085 2.055 2.025 0.04 0.351
PCV 27a 28a 22c 22c 25b 20.5c 0.64 0
MCV 96.92 97.225 96.28 98.215 97.095 93.385 2.05 0.374
MCH 31.975 32.235 31.48 31.025 31.34 33.19 0.89 0.314
MCHC 30.955 31.335 30.305 30.47 30.425 30.975 0.36 0.149
WBCs 12.535b 14.01a 10.48d 10.41d 11.91c 10.445d 0.3 0
Heterophil 9.5e 9.5e 15b 16a 11d 13.5c 1.3 0.01
Lymphocyte 80.5a 81.5a 76.5b 75c 80.5a 78b 1.6 0.038
Monocyte 9 8 7.5 6.5 7.5 7 0.5 0.062
Eosinophil 0 0.5 1 1.5 0.5 1 0.5 0.182
Basophil 1 0.5 0 1 0.5 0.5 0.5 0.434
Lysozyme 11.655b 12.115a 9.745c 9.335d 9.915c 8.995e 0.25 0
Phagocytic activity 11.875b 12.01a 10.34c 10.23c 10.42c 10.065d 0.07 0
Phagocytic index 1.27a 1.235a 0.995c 0.925c 1.165b 0.815d 0.04 0
Total protein 4.075b 4.19a 3.77c 3.715c 3.815c 3.72c 0.04 0
Albumin 1.55 1.55 1.61 1.58 1.555 1.575 0.03 0.62
Globulin 2.525b 2.64a 2.16c 2.135c 2.26c 2.145c 0.03 0
AST 28.78b 28.28b 28.4b 28.915a 27.595c 29.08a 0.6 0.289
ALT 26.07b 25.315b 26.82b 27.36a 26.87a 26.82a 0.78 0.264
MDA 18.42d 18.215d 21.22c 23.32b 20.655c 25.805a 1.2 0.006
GPx 14.705b 15.39a 13.905d 13.88d 14.17c 13.78d 0.2 0.001
CAT 11.33b 11.575a 10.91c 10.835c 11.22b 10.56d 0.15 0.005
SOD 11.31b 11.745a 10.845c 10.77d 10.925c 10.73d 0.16d 0.006
Open in a new tab

Values are expressed as means ± SE. Different superscript letters indicate significant differences in the same column.

Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; CAT, catalase; GPx, glutathione peroxidase; Hb, haemoglobin; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; MDA, malondialdehyde; Nano‐SE, nanoselenium; PCV, packed cell volume; RBCs, red blood cells; SOD, superoxide dismutase; WBCs, white blood cells.

From the previous result, it is evident that the feeding regime of Nano‐Se + day feed + day starvation revealed a marked improvement in either haematological, biochemical or antioxidant activity followed by continuous Nano‐Se feeding regime. In the same context, Mugil fish Group 2 (Nano‐Se + day feed + day starvation), as well as Group 1 (continuous Nano‐Se feeding), significantly showed significant improvement in haematological and immunity (lysosomal, phagocytic activity, and index) concerning other treated groups which strength our obtained result concerning O. niloticus fish as shown in Table 5 with the significant increase in total protein and globulin with markedly decreased AST level.

TABLE 5.

Effect of Nano‐SE particles on the haematological and biochemical parameters of Mugil cephalus after 12 weeks of experiment

G1 G2 G3 G4 G5 G6 SE p value
RBCs 3.76a 3.92a 3.50b 3.28c 3.58b 3.17c 0.04 0.00
Hb 11.34b 11.90a 10.52c 10.10d 10.78c 10.02d 0.15 0.00
PCV 37.00b 38.50a 34.50c 32.00d 35.00c 31.00e 0.70 0.00
MCV 98.39 98.21 98.57 97.57 97.77 97.95 1.02 0.91
MCH 30.16 30.35 30.05 30.80 30.11 30.65 0.15 0.06
MCHC 30.66 30.90 30.48 31.56 30.80 31.31 0.29 0.06
WBCs 14.21 14.83 12.32 12.69 13.59 12.16 1.10 0.57
Heterophil 1.42 1.34 1.67 1.78 1.29 1.89 2.09 0.85
Lymphocyte 11.58 12.23 9.67 9.90 11.01 9.00 3.09 0.80
Monocyte 1.07b 1.18a 0.86c 0.88c 1.15c 0.91ab 0.95 0.02
Eosinophil 0.07 0.08 0.06 0.07 0.07 0.18 0.64 0.42
Basophil 0.07 0.00 0.06 0.07 0.07 0.18 0.57 0.70
Lysozyme 13.26b 13.81a 10.46c 10.32c 11.11c 10.24c 0.10 0.00
Phagocytic activity 13.05b 14.15a 11.49c 11.34d 11.58c 11.26d 0.09 0.00
Phagocytic index 1.29b 1.38a 1.07e 1.16d 1.29c 1.03e 0.06 0.01
Total protein 4.71b 4.81a 4.30c 4.13d 4.22d 4.15d 0.03 0.00
Albumin 1.73 1.72 1.78 1.75 1.72 1.80 0.03 0.30
Globulin 2.98b 3.09a 2.53c 2.39d 2.50c 2.35d 0.03 0.00
AST 18.14c 18.11c 20.00a 19.81a 18.49b 20.04a 0.21 0.00
ALT 21.62c 21.82c 22.98b 23.00a 21.25c 23.09a 0.64 0.09
MDA 18.15d 17.63d 22.37c 24.09a 20.28b 24.39a 0.29 0.00
GPx 17.17b 17.45a 16.24c 15.30d 16.69c 14.35e 0.22 0.00
CAT 11.32b 11.67a 10.54c 10.33cd 11.01c 10.00d 0.06 0.00
SOD 11.11b 11.26a 10.89c 10.57c 10.82c 10.32d 0.08 0.00
Open in a new tab

Values are expressed as means ± SE. Different superscript letters indicate significant differences in the same column.

Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; CAT, catalase; GPx, glutathione peroxidase; Hb, haemoglobin; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; MDA, malondialdehyde; Nano‐SE, nanoselenium; PCV, packed cell volume; RBCs, red blood cells; SOD, superoxide dismutase; WBCs, white blood cells.

3.2. Effect of Nano‐Se particles on the antioxidant activity

The antioxidants' profile in our result, as shown in Tables 2 and 3, revealed that there are no significant changes in the MDA level between different treated groups, O. niloticus and M. cephalus. In the same line, there is no significant alteration in the serum GPX, CAT and SOD levels between different treated groups at zero days of the experiment. After 12 weeks of treatment, MDA concentration was markedly decreased with significant elevation in the GPX, SOD and CAT levels in Nano‐Se treated groups concerning other groups of O. niloticus and M. cephalus fish.

3.3. Effect of Nano‐Se particles on the gene expression analysis

Our obtained data showed in Figures 1 and 2 that there was a significant increase in IL1B, IL8, GH and IGF‐1 in Group 2 (Nano‐Se + day feed + day starvation) concerning other treated groups as well as between day zero and 12 weeks of treatment; in the same context, there was a significant improvement in gene expression of IL1B, IL8, GH and IGF‐1 in Group 1 (continuous Nano‐Se feeding) in comparison with the control groups regime and (Nano‐Se + day feed + 2‐day starvation). Groups 5 (control + day feed + day starvation) and 3 (Nano‐Se + day feed + 2‐day starvation) showed significant improvement in IL1B, IL8, GH and IGF‐1 concerning day zero gene expression analysis in both O. niloticus and M. cephalus fish.

FIGURE 1.

FIGURE 1

Open in a new tab

Effect of feeding Nano‐Se particles on the mRNA expression genes on O. niloticus fish. Values are expressed as means ± standard error. Means within a column not sharing a common superscript significantly differ from each other. P < 0.05

FIGURE 2.

FIGURE 2

Open in a new tab

Effect of feeding Nano‐Se particles on the mRNA expression genes on M. cephalus fish. Values are expressed as means ± standard error. Means within a column not sharing a common superscript significantly differ from each other. P < 0.05

3.4. Effect of Nano‐Se particles on the growth parameters performance

As shown in Tables 6 and 7, there was a markedly increase in FBW, WG and daily WG and SGR in Group 2 treated fish (O. niloticus and M. cephalus fish) (Nano‐Se + day feed + 1‐day starvation) concerning other treated groups followed by improvement in growth parameters in Group 1, first feeding regime (continuous Nano‐Se feeding) than Group 5 (control + day feed +day starvation) concerning other feeding regimes.

TABLE 6.

Effect of Nano‐SE particles on the growth weight parameters of Oreochromis niloticus after 12 weeks of experiment

G1 G2 G3 G4 G5 G6 p value SE
IW 25.4850 25.0650 25.3900 26.1250 24.7800 25.6350 0.4140 0.2100
FW 97.03b 107.26a 80.575d 78.945e 92.75c 71.49f 0.0000 3.5800
WG 71.545b 82.195a 55.18d 52.82d 67.97c 45.855e 0.0000 1.9400
DWG 0.85b 0.98a 0.655d 0.625e 0.81c 0.545f 0.0000 0.0200
SGR 1.595b 1.73a 1.375d 1.32e 1.57c 1.22f 0.0000 0.0500
Open in a new tab

Values are expressed as means ± SE. Different superscript letters indicate significant differences in the same column.

Abbreviations: DWG, daily weight gain; FW, final body weight; IW, initial body weight; Nano‐SE, nanoselenium; SGR, specific growth rate; WG, weight gain.

TABLE 7.

Effect of Nano‐SE particles on the growth weight parameters of Mugil cephalus after 12 weeks of experiment

G1 G2 G3 G4 G5 G6 p value SE
IW 30.92 30.07 30.515 31.005 30.91 30.68 0.0000 0.3
FW 100.41b 105.16a 88.48c 82.535d 93.705c 80.67d 0.0000 2.8000
WG 69.49b 75.09a 57.965d 51.53e 62.795c 49.99e 0.0000 1.9000
DWG 0.825b 0.895a 0.69d 0.61e 0.745c 0.595e 0.0000 0.02
SGR 1.41b 1.46a 1.4400 1.4500 1.3900 1.4300 0.0000 0.0100
Open in a new tab

Values are expressed as means ± SE. Different superscript letters indicate significant differences in the same column.

Abbreviations: DWG, daily weight gain; FW, final body weight; IW, initial body weight; Nano‐SE, nanoselenium; SGR, specific growth rate; WG, weight gain.

From the previously obtained result, our data revealed that the second feeding regime (Nano‐Se + day feed + 1‐day starvation) gives the best feeding regime, which reflects a marked improvement in all measured parameters concerning growth, haematology immunity, antioxidant and gene expression analysis.

4. DISCUSSION

Fish farming is one of the most important economies of the world, and one of the essential goals in fish research is to reduce production costs while preserving and improving the vital functions, weight and immunity of fish, so we conducted this study to investigate the Nano‐Se particle in different feeding regime.

Our result revealed that the addition of Nano‐Se particles to the diet of fish with feeding regime of feeding day followed by a day of starvation significantly showed significant improvement in haematological picture and leukocytes as shown in Tables 3 and 4 in O. niloticus and M. cephalus fish concerning other treated groups; this result was inconsistent with Neamat‐Allah et al. (2019); they reported that selenium nanoparticles denote leukocytosis in Nile tilapia fish due to the protecting effect of Nano‐Se that avoids the erythrocyte from hemolysis either by influential antioxidant impact (Qiang et al., 2017). Our result concerning growth efficiency revealed that the FBW, WG and specific growth weight of both O. niloticus and M. cephalus fish were significantly improved in Group 2 (Nano‐Se + day feed + 1‐day starvation), and these data usually agreed with earlier research that assesses the role on Nano‐Se particles in various species of fish (Ashouri et al., 2015; Dawood, Koshio, Zaineldin, Van Doan, Ahmed, et al., 2019; Lin et al., 2010). The level of selenium needed to achieve optimum growth efficiency may vary based on the type of selenium, the time of administration and the experimental technique, as well as the fish and fish species (Lee et al., 2008).

Growth and feed efficiency improvements in Nano‐Se treated groups are due to stimulating growth hormone development, selenoprotein synthesis, activation of intestinal protease enzymes and increased intracellular protein content (Khan et al., 2017). Besides, selenium acts as an aco‐enzyme in the stimulation of protease and lipase (Shenkin, 2006) and improves the digestibility and use of proteins by increasing the number of intestinal microbes number and operating digestive proteases (Chaudhary et al., 2010; Shi et al., 2011). Our result revealed that the (Nano‐Se + day feed + 1‐day starvation) showed a significant markedly increase in total protein in line with substantial improvement in lysosomal and phagocytic activity; this result was inconsistent with (Dawood et al., 2020). They focused on the importance of selenium as an immunostimulant through its role in activating lysosomal and phagocytic activity (Harikrishnan et al., 2011).

Our result revealed that Nano‐Se treated group (Nano‐Se + day feed + 1‐day starvation) showed markedly decreased MDA with a consequent increase in GPx, CAT and superoxide activity; this result was in harmony with Dawood et al. (2020). Selenium acts as an antioxidant in that it forms “selenocysteine,” a component of GPX 's active core (Terova et al., 2018) and to the antioxidant activity of selenium (Saffari et al., 2017). SOD, CAT and GPX activities as essential antioxidant enzymes can be considered markers of oxidative injury (Dawood, Koshio, Zaineldin, Van Doan, Moustafa, et al., 2019). Nevertheless, MDA is a highly toxic material formed by the decomposition of lipid peroxides, which can cause hurt to the body (Yao et al., 2010). The increase in antioxidant parameters in fish after Nano‐Se utilization may be due to Se's involvement in the formation of selenocysteine in the active centre of the GPX enzyme (Köhrle et al., 2000).

Our result revealed the upregulation of mRNA expression of GH and IGF‐1 in the Nano‐Se treated group, especially Groups 2 (Nano‐Se + day feed + 1‐day starvation) and 1 (continuous feeding of Nano‐Se) concerning other groups as shown in Figures 1 and 2. This result was in line with Cupaioli et al. (2014) in which they confirmed that selenium enhanced the growth hormone. Consequently, the obtained result concerning growth hormone and IGF‐1 expression supported our growth efficiency results. Abarike et al. (2019) reported that Nano‐Se upregulates the pro‐inflammatory cytokines, which help our finding in Figures 1 and 2 that showed the marked upregulation of IL1B and IL8 in O. niloticus and M. cephalus fish that previously treated with Nano‐Se particle. IL‐1β is a pro‐inflammatory cytokine that stimulates the lymphocytes and macrophages against disease (Low et al., 2003). Restricted feeding schemes may be practical tools to boost fish output efficiency (Kumar et al., 2017). Our result revealed that 1‐day feeding followed by 1‐day starvation improves all physiological parameters and growth rate efficiency. Two potential causes for the offsetting growth of hyperphagia or a combination of hyperphagia and improved feed quality were reported by (Ye et al., 2016). Our data concerning the immunostimulant activity of Nano‐Se was also supported by Dawood, Zommara, et al., (2019) in which they found that Nano‐Se upregulates pro‐inflammatory cytokines, especially IL‐1β.

5. CONCLUSION

Nano‐Se supplementation with a dietary regime feeding the fish 1 day followed by 1‐day starvation and soon tends to potentiate the growth efficiency and immunity and improve the growth hormone, insulin growth factors and pro‐inflammatory cytokines. For the first time, these findings supported our hypothesis that confirms the Nano‐Se supplementation to the diet of fish with special dietary regime could be useful for aquatic life and economy in decreasing the feeding cost and increasing the fish health welfare and growth.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS

Eman M. Moustafa: Investigation; Visualization; Writing‐original draft; Writing‐review & editing. Foad Farrag: Software. Montaser M. Hassan: Resources; Supervision; Visualization. Amira Omar: Formal analysis. Ahmed G. Gewida: Formal analysis; Funding acquisition; Validation; Visualization. Mohammed F. Abd‐Elghany: Visualization; Writing‐original draft.

ETHICAL APPROVAL

The study's experimental architecture and procedures won approval from the clinical treatment and use of animals Kafrelsheikh University Board, Kafrelsheikh, Egypt.

Peer Review

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.490.

Supporting information

Supplementary Material

Click here for additional data file. (818.1KB, docx)

ACKNOWLEDGEMENT

The authors extend their appreciation to Taif University for funding current work by Taif University Researchers Supporting Project number (TURSP‐2020/119), Taif University, Taif, Saudi Arabia.

Moustafa EM, Abd El‐Kader MF, Hassan MM, et al. Trial for use nanoselenium particle with different dietary regime in Oreochromis niloticus and Mugil cephalus polyculture ponds: Growth efficiency, haematological, antioxidant, immunity and transcriptional analysis. Vet Med Sci. 2021;00:1575–1586. 10.1002/vms3.490

Funding information

The current work was funded by Taif University Researchers Supporting Project number (TURSP‐2020/119), Taif University, Taif, Saudi Arabia.

DATA AVAILABILITY STATEMENT

Data were available upon a request from the corresponding author.

REFERENCES

  1. Abarike, E. D., Kuebutornye, F. K., Jian, J., Tang, J., Lu, Y., & Cai, J. (2019). Influences of immunostimulants on phagocytes in cultured fish: A mini review. Review in Aquaculture, 11, 1219–1227. 10.1111/raq.12288 [DOI] [Google Scholar]
  2. Abd El‐Kader, M. F., Fath El‐Bab, A. F., Abd‐Elghany, M. F., Abdel‐Warith, A.‐W.‐A., Younis, E. M., & Dawood, M. A. O. (2020). Selenium nanoparticles act potentially on the growth performance, hemato‐biochemical indices, antioxidative, and immune‐related genes of european seabass (Dicentrarchus labrax). Biological Trace Element Research. 10.1007/s12011-020-02431-1 [DOI] [PubMed] [Google Scholar]
  3. Abdel‐Mageid, A. D., Zaki, A. G., El Senosi, Y. A., Fahmy, H. A., El Asely, A. M., Abo‐Al‐Ela, H. G., & El‐Kassas, S. J. A. R. (2020). Modulatory effect of lipopolysaccharide on immune‐related gene expression and serum protein fractionation in grey mullet, Mugil cephalus . Aquaculture Research, 51, 1643–1652. [Google Scholar]
  4. Ashouri, S., Keyvanshokooh, S., Salati, A. P., Johari, S. A., & Pasha‐Zanoosi, H. J. A. (2015). Effects of different levels of dietary selenium nanoparticles on growth performance, muscle composition, blood biochemical profiles and antioxidant status of common carp (Cyprinus carpio). Aquaculture, 446, 25–29. 10.1016/j.aquaculture.2015.04.021 [DOI] [Google Scholar]
  5. Blaxhall, P., & Daisley, K. W. (1973). Routine haematological methods for use with fish blood. Journal of Fish Biology, 5(6), 771–781. 10.1111/j.1095-8649.1973.tb04510.x [DOI] [Google Scholar]
  6. Byamungu, N., Darras, V., & Kühn, E. J. A. (2001). Growth of heat‐shock induced triploids of blue tilapia, Oreochromis aureus, reared in tanks and in ponds in Eastern Congo: Feeding regimes and compensatory growth response of triploid females. Aquaculture, 198, 109–122. 10.1016/S0044-8486(00)00605-0 [DOI] [Google Scholar]
  7. Chan, C.‐R., Lee, D.‐N., Cheng, Y.‐H., Hsieh, D.‐J.‐Y., & Weng, C.‐F. (2008). Feed deprivation and re‐feeding on alterations of proteases in tilapia Oreochromis mossambicus . Zoological Studies‐Taipei, 47, 207. [Google Scholar]
  8. Chaudhary, M., Garg, A. K., Mittal, G. K., & Mudgal, V. (2010). Effect of organic selenium supplementation on growth, Se uptake, and nutrient utilization in guinea pigs. Biological Trace Element, 133, 217–226. 10.1007/s12011-009-8420-z [DOI] [PubMed] [Google Scholar]
  9. Crosetti, D. (2015). Current state of grey mullet fisheries and culture. In Crosetti D. & Blaber S. J. (Eds.), Biology, ecology and culture of grey mullets (Mugilidae) (pp. 398‐450). CRC Press. [Google Scholar]
  10. Cupaioli, F. A., Zucca, F. A., Boraschi, D., & Zecca, L. (2014). Engineered nanoparticles. How brain friendly is this new guest? Progress in Neurobiology, 119, 20–38. 10.1016/j.pneurobio.2014.05.002 [DOI] [PubMed] [Google Scholar]
  11. Daudpota, A. M., Abbas, G., Kalhoro, I. B., Shah, S. S. A., Kalhoro, H., Hafeez‐ur‐Rehman, M., & Ghaffar, A. J. (2016). Effect of feeding frequency on growth performance, feed utilization and body composition of juvenile Nile tilapia, Oreochromis niloticus (L.) reared in low salinity water. Pakistan Journal of Zoology, 48, 171–177. [Google Scholar]
  12. Dawood, M. A. O., Koshio, S., Zaineldin, A. I., Van Doan, H., Ahmed, H. A., Elsabagh, M., & Abdel‐Daim, M. M. (2019). An evaluation of dietary selenium nanoparticles for red sea bream (Pagrus major) aquaculture: Growth, tissue bioaccumulation, and antioxidative responses. Environmental Science and Pollution Research, 26(30), 30876–30884. 10.1007/s11356-019-06223-6 [DOI] [PubMed] [Google Scholar]
  13. Dawood, M. A. O., Koshio, S., Zaineldin, A. I., Van Doan, H., Moustafa, E. M., Abdel‐Daim, M. M., Angeles Esteban, M., & Hassaan, M. S. (2019). Dietary supplementation of selenium nanoparticles modulated systemic and mucosal immune status and stress resistance of red sea bream (Pagrus major). Fish Physiology and Biochemistry, 45, 219–230. 10.1007/s10695-018-0556-3 [DOI] [PubMed] [Google Scholar]
  14. Dawood, M. A., Zommara, M., Eweedah, N. M., & Helal, A. I. (2019). Synergistic effects of selenium nanoparticles and vitamin e on growth, immune‐related gene expression, and regulation of antioxidant status of Nile tilapia (Oreochromis niloticus). Biological Trace Element Research, 195(2), 624–635. 10.1007/s12011-019-01857-6 [DOI] [PubMed] [Google Scholar]
  15. Dawood, M. A., Zommara, M., Eweedah, N. M., & Helal, A. I. (2020). The evaluation of growth performance, blood health, oxidative status and immune‐related gene expression in Nile tilapia (Oreochromis niloticus) fed dietary nanoselenium spheres produced by lactic acid bacteria. Aquaculture, 515, 734571. 10.1016/j.aquaculture.2019.734571 [DOI] [Google Scholar]
  16. El Basuini, M., El‐Hais, A., Dawood, M., Abou‐Zeid, A. S., El‐Damrawy, S., Khalafalla, M. S., Koshio, S., Ishikawa, M., & Dossou, S. J. A. N. (2017). Effects of dietary copper nanoparticles and vitamin C supplementations on growth performance, immune response and stress resistance of red sea bream, Pagrus major . Aquaculture Nutrition, 23, 1329–1340. [Google Scholar]
  17. Garcia, J. A., & Villarroel, M. (2009). Effect of feed type and feeding frequency on macrophage functions in tilapia (Oreochromis niloticus L.). Fish & Shellfish Immunology, 27, 325–329. 10.1016/j.fsi.2009.05.018 [DOI] [PubMed] [Google Scholar]
  18. Garcia, J., Villarroel, M. J. F., & Immunology, S. (2009). Effect of feed type and feeding frequency on macrophage functions in tilapia (Oreochromis niloticus L.). Fish & Shellfish Immunology, 27(2), 325–329. 10.1016/j.fsi.2009.05.018 [DOI] [PubMed] [Google Scholar]
  19. Harikrishnan, R., Kim, J.‐S., Kim, M.‐C., Balasundaram, C., & Heo, M.‐S.‐J.‐A. (2011). Prunella vulgaris enhances the non‐specific immune response and disease resistance of Paralichthys olivaceus against Uronema marinum . Aquaculture, 318, 61–66. 10.1016/j.aquaculture.2011.05.020 [DOI] [Google Scholar]
  20. Houston, A. J. (1990). Blood and circulation. In Schreck C. B. & Moyle P. B. (Eds.), Methods for fish biology (pp. 415–488). American Fisheries Society. [Google Scholar]
  21. Huang, S., Wang, L., Liu, L., Hou, Y., & Li, L. (2015). Nanotechnology in agriculture, livestock, and aquaculture in China. A review. Agronomy for Sustainable Development, 35, 369–400. 10.1007/s13593-014-0274-x [DOI] [Google Scholar]
  22. Jain, N. C. (1986). Schalm's veterinary hematology. Lea & Febiger. [Google Scholar]
  23. Jobling, M. (2012). National Research Council (NRC): Nutrient requirements of fish and shrimp. Aquaculture International, 20, 601–602. 10.1007/s10499-011-9480-6 [DOI] [Google Scholar]
  24. Kawahara, E., Ueda, T., & Nomura, S. J. F. P. (1991). In vitro phagocytic activity of white‐spotted char blood cells after injection with Aeromonas salmonicida extracellular products. Fish Pathology, 26(4), 213–214. 10.3147/jsfp.26.213 [DOI] [Google Scholar]
  25. Khan, K. U., Zuberi, A., Nazir, S., Ullah, I., Jamil, Z., & Sarwar, H. J. A. R. (2017). Synergistic effects of dietary nano selenium and vitamin C on growth, feeding, and physiological parameters of mahseer fish (Tor putitora). Aquaculture Reports, 5, 70–75. 10.1016/j.aqrep.2017.01.002 [DOI] [Google Scholar]
  26. Köhrle, J., Brigelius‐Flohé, R., Böck, A., Gärtner, R., Meyer, O., & Flohé, L. (2000). Selenium in biology: Facts and medical perspectives. Biological Chemistry, 381(9–10), 849–864. 10.1515/BC.2000.107 [DOI] [PubMed] [Google Scholar]
  27. Kumar, P., Jain, K. K., MunilKumar, S., & Sudhagar, S. A. J. A. R. (2017). Alternate feeding strategies for optimum nutrient utilization and reducing feed cost for semi‐intensive practices in aquaculture system—A review. Agricultural Reviews, 38(2), 145–151. 10.18805/ag.v38i02.7946 [DOI] [Google Scholar]
  28. Lee, S.‐M., Hwang, U.‐G., & Cho, S. H. (2000). Effects of feeding frequency and dietary moisture content on growth, body composition and gastric evacuation of juvenile Korean rockfish (Sebastes schlegeli). Aquaculture, 187, 399–409. 10.1016/S0044-8486(00)00318-5 [DOI] [Google Scholar]
  29. Lee, S., Lee, J.‐H., & Bai, S. C. (2008). A preliminary study on effects of different dietary selenium (Se) levels on growth performance and toxicity in juvenile black seabream, Acathopagrus schlegeli (Bleeker). Asian‐Australasian Journal of Animal Sciences, 21(12), 1794–1799. 10.5713/ajas.2008.80285 [DOI] [Google Scholar]
  30. Lin, Y.‐H., Shih, C.‐C., Kent, M., & Shiau, S.‐Y.‐J.‐A. (2010). Dietary copper requirement reevaluation for juvenile grouper, Epinephelus malabaricus, with an organic copper source. Aquaculture, 310(1–2), 173–177. 10.1016/j.aquaculture.2010.10.004 [DOI] [Google Scholar]
  31. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2−ΔΔCT method. Methods, 25, 402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  32. Low, C., Wadsworth, S., Burrells, C., & Secombes, C. J. A. (2003). Expression of immune genes in turbot (Scophthalmus maximus) fed a nucleotide‐supplemented diet. Aquaculture, 221, 23–40. 10.1016/S0044-8486(03)00022-X [DOI] [Google Scholar]
  33. Lucky, Z., & Lucký, Z. (1977). Methods for the diagnosis of fish diseases. AGRIS Amerind Pub. [Google Scholar]
  34. Naderi, M., Keyvanshokooh, S., Ghaedi, A., & Salati, A. P. (2019). Interactive effects of dietary Nano selenium and vitamin E on growth, haematology, innate immune responses, antioxidant status and muscle composition of rainbow trout under high rearing density. Aquaculture Nutrition, 25(5), 1156–1168. 10.1111/anu.12931 [DOI] [Google Scholar]
  35. Neamat‐Allah, A. N., Mahmoud, E. A., Abd El Hakim, Y. (2019). Efficacy of dietary Nano‐selenium on growth, immune response, antioxidant, transcriptomic profile and resistance of Nile tilapia, Oreochromis niloticus against Streptococcus iniae infection. Fish & Shellfish Immunology, 94, 280–287. 10.1016/j.fsi.2019.09.019 [DOI] [PubMed] [Google Scholar]
  36. Pacitti, D., Lawan, M., Feldmann, J., Sweetman, J., Wang, T., Martin, S., & Secombes, C. J. (2016). Impact of selenium supplementation on fish antiviral responses: A whole transcriptomic analysis in rainbow trout (Oncorhynchus mykiss) fed supranutritional levels of Sel‐Plex® . BMC Genomics, 17(1). 10.1186/s12864-016-2418-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pang, J.‐C., Gao, F.‐Y., Lu, M.‐X., Ye, X., Zhu, H.‐P., & Ke, X.‐L. (2013). Major histocompatibility complex class IIA and IIB genes of Nile tilapia Oreochromis niloticus: Genomic structure, molecular polymorphism and expression patterns. Fish & Shellfish Immunology, 34, 486–496. 10.1016/j.fsi.2012.11.048 [DOI] [PubMed] [Google Scholar]
  38. ParryJr., R. M., Chandan, R. C., & Shahani, K. M. (1965). A rapid and sensitive assay of muramidase. Biology and Medicine, 119, 384–386. 10.3181/00379727-119-30188 [DOI] [PubMed] [Google Scholar]
  39. Pouomogne, V., & Ombredane, D. J. T. (2001). Effect of feeding frequency on the growth of tilapia (Oreochromis niloticus) in earthen ponds. Tropicultura, 19, 141–146. [Google Scholar]
  40. Qiang, J., Tao, F., He, J., Sun, L., Xu, P., & Bao, W. (2017). Effects of exposure to Streptococcus iniae on microRNA expression in the head kidney of genetically improved farmed tilapia (Oreochromis niloticus). BMC Genomics, 18(1), 10.1186/s12864-017-3591-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Qiang, J., Wang, H., Li, R.‐W., & Peng, J. J. (2009). Effects of feeding frequency on growth, body biochemical composition and digestive enzymes of larvae and juvenile of hybrid tilapia (Oreochromis niloticus× O. aureus). Journal of Guangdong Ocean University, 4. [Google Scholar]
  42. Riche, M., Haley, D., Oetker, M., Garbrecht, S., & Garling, D. J. A. (2004). Effect of feeding frequency on gastric evacuation and the return of appetite in tilapia Oreochromis niloticus (L.). Aquaculture, 234(1‐4), 657–673. 10.1016/j.aquaculture.2003.12.012 [DOI] [Google Scholar]
  43. Riche, M., Oetker, M., Haley, D. I., Smith, T., & Garling, D. L. (2004). Effect of feeding frequency on consumption, growth, and efficiency in juvenile tilapia (Oreochromis niloticus). The Israeli Journal of Aquaculture—Bamidgeh, 56(4), 247–255. [Google Scholar]
  44. Saffari, S., Keyvanshokooh, S., Zakeri, M., Johari, S., & Pasha‐Zanoosi, H. J. A. N. (2017). Effects of different dietary selenium sources (sodium selenite, selenomethionine and nanoselenium) on growth performance, muscle composition, blood enzymes and antioxidant status of common carp (Cyprinus carpio). Aquaculture, 23, 611–617. [Google Scholar]
  45. Saffari, S., Keyvanshokooh, S., Zakeri, M., Johari, S. A., Pasha‐Zanoosi, H., & Mozanzadeh, M. T. (2018). Effects of dietary organic, inorganic, and nanoparticulate selenium sources on growth, hemato‐immunological, and serum biochemical parameters of common carp (Cyprinus carpio). Fish Physiology and Biochemistry, 44(4), 1087–1097. 10.1007/s10695-018-0496-y [DOI] [PubMed] [Google Scholar]
  46. Shenkin, A. (2006). Micronutrients in health and disease. Postgraduate Medical Journal, 82(971), 559–567. 10.1136/pgmj.2006.047670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Shi, L., Xun, W., Yue, W., Zhang, C., Ren, Y., Liu, Q., Wang, Q., & Shi, L. (2011). Effect of elemental nano‐selenium on feed digestibility, rumen fermentation, and purine derivatives in sheep. Animal Feed Science and Technology, 163(2‐4), 136–142. 10.1016/j.anifeedsci.2010.10.016 [DOI] [Google Scholar]
  48. Suttle, N. F. (2010). Mineral nutrition of livestock. CABI. [Google Scholar]
  49. Terova, G., Rimoldi, S., Izquierdo, M., Pirrone, C., Ghrab, W., & Bernardini, G. (2018). Nano‐delivery of trace minerals for marine fish larvae: influence on skeletal ossification, and the expression of genes involved in intestinal transport of minerals, osteoblast differentiation, and oxidative stress response. Fish Physiology and Biochemistry, 44(5), 1375–1391. 10.1007/s10695-018-0528-7 [DOI] [PubMed] [Google Scholar]
  50. Thongprajukaew, K., Kovitvadhi, S., Kovitvadhi, U., & Preprame, P. (2017). Effects of feeding frequency on growth performance and digestive enzyme activity of sex‐reversed Nile tilapia, Oreochromis niloticus (Linnaeus, 1758). Agriculture and Natural Resources, 51, 292–298. 10.1016/j.anres.2017.04.005 [DOI] [Google Scholar]
  51. Tung, P.‐H., & Shiau, S.‐Y. (1991). Effects of meal frequency on growth performance of hybrid tilapia, Oreochromis niloticus × O. aureus, fed different carbohydrate diets. Aquaculture, 92, 343–350. 10.1016/0044-8486(91)90039-A [DOI] [Google Scholar]
  52. Wassef, E., El Masry, M., & Mikhail, F. J. A. R. (2001). Growth enhancement and muscle structure of striped mullet, Mugil cephalus L., fingerlings by feeding algal meal‐based diets. Aquaculture Research 32, 315–322. [Google Scholar]
  53. Yao, J., Wang, J.‐Y., Liu, L., Li, Y.‐X., Xun, A.‐Y., Zeng, W.‐S., Jia, C.‐H., Wei, X.‐X., Feng, J.‐L., Zhao, L. I., & Wang, L.‐S. (2010). Anti‐oxidant effects of resveratrol on mice with DSS‐induced ulcerative colitis. Archives of Medical Research, 41(4), 288–294. 10.1016/j.arcmed.2010.05.002 [DOI] [PubMed] [Google Scholar]
  54. Ye, J. D., Chen, J. C., & Wang, K. J. (2016). Growth performance and body composition in response to dietary protein and lipid levels in Nile tilapia (Oreochromis niloticus Linnaeus, 1758) subjected to normal and temporally restricted feeding regimes. Journal of Applied Ichthyology, 32, 332–338. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Click here for additional data file. (818.1KB, docx)

Data Availability Statement

Data were available upon a request from the corresponding author.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES