Skip to main content
Microorganisms logoLink to Microorganisms
. 2021 Aug 31;9(9):1843. doi: 10.3390/microorganisms9091843

Influence of Tall Fescue Epichloë Endophytes on Rhizosphere Soil Microbiome

Kishan Mahmud 1, Kendall Lee 2, Nicholas S Hill 3, Anaas Mergoum 4, Ali Missaoui 1,2,3,*
Editor: Volker Brozel
PMCID: PMC8468716  PMID: 34576739

Abstract

Tall fescue (Lolium arundinaceum (Schreb.) S.J. Darbyshire) often forms a symbiotic relationship with fungal endophytes (Epichloë coenophiala), which provides increased plant performance and greater tolerance to environmental stress compared to endophyte-free tall fescue. Whether this enhanced performance of tall fescue exclusively results from the grass–fungus symbiosis, or this symbiosis additionally results in the recruitment of soil microbes in the rhizosphere that in turn promote plant growth, remain a question. We investigated the soil bacterial and fungal community composition in iron-rich soil in the southeastern USA, and possible community shifts in soil microbial populations based on endophyte infection in tall fescue by analyzing the 16s rRNA gene and ITS specific region. Our data revealed that plant-available phosphorus (P) was significantly (p < 0.05) influenced by endophyte infection in tall fescue. While the prominent soil bacterial phyla were similar, a clear fungal community shift was observed between endophyte-infected (E+) and endophyte-free (E−) tall fescue soil at the phylum level. Moreover, compared to E− soil, E+ soil showed a greater fungal diversity at the genus level. Our results, thus, indicate a possible three-way interaction between tall fescue, fungal endophyte, and soil fungal communities resulting in improved tall fescue performance.

Keywords: tall fescue, endophyte, soil, rhizosphere microbiome, plant-soil interaction

1. Introduction

Grasses cover almost 20% of the total land area on the planet [1] and are widely distributed ecosystems [2]. They offer important ecosystem services, such as providing forage for livestock [3], soil carbon sequestration [4], improved runoff quality [5], erosion control, climate regulation [6], and resistance to invasive species [7]. Many grass species are known to form symbiotic relationships with fungal endophytes [8] that led to eventual plant colonization of terrestrial environments [9]. Tall fescue (Lolium arundinaceum (Schreb.) S.J. Darbyshire), a cool-season perennial grass [10], is cultivated on an estimated 14-million hectares in the United States [11]. Tall fescue often forms an interdependent relationship with a shoot-specific fungal endophyte (Epichloë coenophiala) that produces ergot alkaloids that are toxic to livestock, causing fescue toxicosis or fescue foot [12,13]. To avoid fescue toxicosis, novel endophytes were identified and introduced into different tall fescue cultivars with non-toxic alkaloids such as lolines and peramines [14]. Although detrimental to livestock, tall fescue infected with Epichloë coenophiala has been shown to be persistent, exhibit better plant fitness, and offer improved ecosystem services over other grass species in pastures [15,16]. Endophyte infected tall fescue is a unique model to investigate the potential relationships between above and below-ground microbial communities. This potential relationship between the tall fescue, the endophyte, and the soil microbial communities might provide important insights to explore and clarify the plant’s resilience against environmental stress and climate change, different soil biogeochemical processes that influence soil health, and vital ecosystem services. It is well documented that soil microbial communities impart significant benefits in soil nutrient cycling, soil fertility status, and soil carbon sequestration that influences plant fitness and survival in varying terrestrial ecosystems [17,18,19].

The soil microbiome composition is at the forefront of evolutionary ecology where the primary focus is on the identification of the beneficial microbial communities and comprehending the extent of influence on plant performance and soil health [20,21,22]. Soil nutrient status plays a central role in impacting soil bacterial and fungal communities. This is particularly true for phosphorus (P), the least mobile macronutrient, found in the soil of the southeastern USA [23]. Due to its fixation with insoluble mineral-complex with iron (Fe) and aluminum (Al) oxides in acidic soil and with calcium (Ca) in alkaline soil, P is often limitedly released into the soil solution for root uptake [24,25]. Soil microbial communities, especially the phosphorus solubilizing microbial communities can secrete hydrolyzing enzymes, organic acids, protons, and phosphatases that can solubilize the organo-mineral complexes and release P and the associated mineral, eventually leading to the acquisition of unavailable P in soil by plants [26,27,28,29,30]. In return, the plant excreted rhizo-deposits and root architecture contribute significantly in the rhizosphere microbial communities [31]. Endophyte infection in tall fescue may offer a competitive advantage to non-infected fescue by influencing the soil microbial processes and soil microbial communities [32,33,34]. Additionally, the quantity and type of root exudates and rhizo-deposits change with different stages of plant development [35,36,37], thus, creating a resource partitioning in the soil that subsequently leads to niche partitioning [38,39,40]. In turn, given the rhizosphere origin of endophytic microbial populations, soil bacterial and fungal community composition may regulate the plant endophytic diversity and community composition [41]. In earlier studies based on the endophyte infection in tall fescue, shifts in soil microbial (bacterial and fungal) community structure and soil food webs have been reported [42,43]. These plant–fungal associations, especially in grass species, define a significant two-faceted interaction: (i) the collaboration gradient (above-ground) [44]; and (ii) root exudates mediated influence (below-ground) [45]. The first interaction describes how the plant–fungal symbiosis impacts nutrient foraging; promotes plant growth [46]; provides resilience against biotic stress, such as plant pathogens [47]; and abiotic stress, such as drought and salt tolerance [48]. The second interaction highlights the fungal communities associated with the rhizosphere communities, facilitates soil nutrient cycling and nutrient acquisition [49], organic matter decomposition [50,51], synthesis of phytohormones for root utilization [52], resistance against nematodes [53], and protection against pathogens [54]. Thus, determining the endophyte-facilitated soil microbial processes and the subsequent soil microbial response contributing to increased plant production and stress tolerance may carry significant economic and ecological importance for sustainable agricultural practices [55]. Our objective was to explore the diversity of the soil bacterial and fungal communities associated with tall fescue rhizosphere and investigate whether the bacterial and fungal populations differ based on the presence of endophyte in tall fescue.

2. Materials and Methods

2.1. Site Description

The study site was in the southeastern region of the USA at the J. Phil Campbell (JPC) Research and Education Center (33°52′ N, 83°27′ W) and Iron Horse Farm (IHF) (33°72′ N, 83°30′ W) in Watkinsville, Georgia. The soil at JPC is a fine kaolinitic, thermic Typic Kanhapludults in the Cecil sandy loam series with a 2% to 6% slope. The soil at IHF is Pacolet sandy clay loam, with a 6% to 10% slope [56]. The region has 123 cm average annual rainfall and an average minimum and maximum temperature of 10.4 °C and 22.5 °C, respectively. Soil sampling for this study was completed in October 2019, following a summer that according to the National Oceanic and Atmospheric Administration had the hottest July on record, since the late 1800s. The research plots were established in the fall of 2014 with 750 different tall fescue accessions. Each tall fescue accession was planted in 1.5 m single row: 0.75 m space between plots within the range and 1.5 m between ranges. Since its establishment, the plots were fertilized with inorganic fertilizers (N-P-K) in October 2014 and regular clippings of the grass were performed every spring.

Table 1 shows the average atmospheric temperature, soil temperature, and average rainfall between 2014 to 2019.

Table 1.

Average maximum, minimum, and daily atmospheric temperature (°C), average soil temperature (0–15 cm) (°C), and average rainfall (mm) during summer months (June, July, and August) from 2015 to 2019.

Season Maximum
Atmospheric
Temperature (°C)
Minimum
Atmospheric
Temperature (°C)
Daily Atmospheric Temperature (°C) Daily Soil
Temperature (°C) at 15 cm Depth
Average Rainfall (mm)
Summer 2015 32 21 26 28 391
Summer 2016 33 21 27 30 295
Summer 2017 30 20 25 28 517
Summer 2018 31 20 25 28 392
Summer 2019 31 20 25 29 304

2.2. Soil Sampling and Tall Fescue Plants

We sampled soil from 48 different tall fescue accessions’ rhizospheres with a hand soil probe (2.5 cm diameter) to a depth of 0–15 cm. All soil samples were kept refrigerated at 4 °C. The soils were then air-dried, ground, and passed through a 2 mm sieve for soil nutrient analysis. Out of 48 tall fescue ranges, 43 ranges were planted at JPC and five were planted at the IHF site. We selected nine tall fescue cultivars with no endophytes (E−) and 35 cultivars with endophyte infection (E+), among which 21 were infected with novel-endophytes and 14 with wild-type, toxic endophytes. At the time of soil sampling, for the purpose of microbial analysis, soil samples were immediately separated and kept at −20 °C until the soil genomic DNA was extracted (see below Section 2.3).

2.3. DNA Extraction, PCR Amplification, and 16S rRNA Gene and ITS Gene Sequencing

DNA Extraction, PCR Amplification, and 16S rRNA Gene and ITS Gene Sequencing from homogenized and frozen soil (0.25 g), soil DNA was extracted using QIAGEN DNeasy PowerSoil Kit (DNeasy PowerSoil Kit Handbook, May 2017, Qiagen, Valencia, CA, USA). Soil DNA quality and concentration were assessed by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Extracts were stored at −20 °C until further analysis. A bacterial sequencing library targeting the bacterial 16S rRNA genes was prepared using primer sets from PacBio 16S protocol (V1-V9 regions) [57]; 27F27F (AGRGTTYGATYMTGGCTCAG)/14292R (RGYTACCTTGTTACGACTT). For the fungal sequencing library, we targeted the ITS region and used ITS1-F Forward (CTTGGTCATTTAGAGGAAGTAA)/ITS2-R Reverse (GCTGCGTTCTTCATCGATGC) to amplify the ITS region. The sequencing workflow was as follows: (i) Multiplexing with PacBio Barcoded Universal Primers; (ii) AMPure PB bead purification; (iii) Pooling Barcoded Amplicons; (iv) SMRTbell Library Construction; (v) Purification of SMRTbell Templates; (vi) Anneal and Bind SMRTbell Templates; and (vii) Sequencing on PacBio Sequel II System. The first-round amplification PCR conditions were 95 °C for 180 s, followed by 20 cycles of 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 60 s with universal primer-tailed 16S primers and ITS1 primers. The second-round amplification PCR conditions were 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 60 s for 20 cycles with PacBio Barcoded Universal Primers. SMRTbell libraries were prepared by using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing. Then, PacBio’s single-molecule circular consensus sequencing (CCS) reads were generated for full-length 16S rRNA genes and ITS gene (accuracy of 99%). The CCS reads were de-multiplexed using the software “lima” in SMRT Analysis software version 2.3.0. To generate bam files followed by a conversion to Fastq files via bam2fastq.

2.4. Data Analysis

The CCS reads were processed with DADA2 software packages (16S rRNA gene and ITS specific workflow) (version 1.8) [58], and analyzed with phyloseq for alpha and beta diversity (version 1.25.2) [59]. For 16s rRNA gene CCS data, the DADA2 workflow follows primer trimming, quality filtering, and de-replication. Amplicon sequence variants (ASVs) were inferred after learning the error rates. Afterward, the “removeBimeraDenovo” command was used to remove chimeras. Finally, we used the SILVA nr v132 train set to assign taxonomy. For the fungal data analysis, we followed the ITS-specific variation of the DADA2 package. In the fungal DADA2 workflow, after orienting the primers, we used a specialized primer/adapter removal tool “cutadapt” [60]. After primer removal, the next steps consist of quality filtering, de-replication, inferring ASVs after error learning, and finally removing chimeras. We used UNITE ITS database for taxonomic assignments [61]. The ASV tables from DADA2 pipelines were imported into phyloseq to make phyloseq objects and to calculate alpha and beta diversity. Sigma Plot 11 was used to generate figures depicting percentage of bacterial and fungal populations in soil.

2.5. Statistical Analysis

Analysis of variance with JMP PRO 15 software (JMP®, Version 15. SAS Institute Inc., Cary, NC, USA, 1989–2019) was used to determine differences in soil pH, inorganic nitrogen, nitrate content, calcium, potassium, magnesium, phosphorus, and zinc, between endophyte-free fescue soil, non-toxic endophyte-infected fescue soil, and toxic endophyte-infected fescue soil samples (p < 0.05). Comparisons between multiple means of different soil nutrient content were completed with Tukey’s HSD (p < 0.05).

3. Results

3.1. Soil Chemical Properties

There were no significant differences in soil pH and soil nutrient content between E− and E+ tall fescue soil, except for plant-available phosphorus in soil (Table 2). The E+ tall fescue soil had higher plant-available P compared to the E− tall fescue soil. Between endophyte-free, non-toxic, and toxic endophyte-infected tall fescue soil, non-toxic endophyte-infected soil had significantly greater plant-available P compared to the rest (Table 2). Although, Zn content in soil was not statistically significant between the E− and E+ tall fescue soil, three endophyte-infected tall fescue soil samples, accession 1062, 1064, and Bar Optima had higher soil Zn content.

Table 2.

Mean soil nitrogen (N), calcium (Ca), potassium (K), magnesium (Mg), manganese (Mn), phosphorus (P), and zinc (Zn) (mg/kg) content.

pH NH4+- N NO3 N Ca K Mg Mn P Zn
Endophyte-Free Soil 6.53 a 3 a 244 a 801 a 40 a 105 a 17 a 26 b 1.0 a
Endophyte-Infected Soil (Toxic) 6.59 a 2 a 270 a 681 a 43 a 93 a 17 a 38 a 1.17 a
Endophyte-Infected Soil (Non-toxic) 6.59 a 3 a 245 a 731 a 45 a 99 a 16 a 33 ab 1.07 a

Different lower-case letters indicate a significant difference between endophyte-free soil, toxic endophyte-infected soil, and non-toxic endophyte-infected soil (p < 0.05).

3.2. Soil Bacterial Abundance, Diversity, and Community Composition

We identified 1212 and 3411 bacterial amplicon sequence variants (ASVs) in the E− and E+ tall fescue soil collected from the tall fescue plots, respectively. We identified 18 phyla, 29 classes, 72 orders, 111 families, and 151 bacterial genera in E+ tall fescue soil. In E− tall fescue soil, we identified 14 phyla, 29 classes, 45 orders, 88 families, and 97 bacterial genera. The Shannon diversity index (SDI) highlights the species’ richness and evenness among the entire community; the higher number indicates higher diversity. The mean bacterial Shannon diversity index was lower overall and not statistically significant between the E− (mean H′ = 4.5) and E+ (mean H′ = 4.0) soil. Additionally, bacterial beta-diversity presented with principal coordinate analysis (PCoA) based on Bray–Curtis dissimilarities showed no significant differences between soil microbial communities based on the presence of endophyte in tall fescue. The prominent bacterial phylum in both E− and E+ tall fescue soil was Planctomycetes (Figure 1a,b). In E+ tall fescue soil, the abundance of phyla from greatest to lowest was as follows: Planctomycetes (28%) > Proteobacteria (20%) > Acidobacteria (12%) > Bacteroidetes (9%) > Firmicutes (6%) > Verrucomicrobia, Chloroflexi and Actinobacteria (5%) > Gemmatimonadetes and Nitrospira (2%) (Figure 1a). For E− tall fescue soil, from greatest to lowest abundance of the prominent bacterial phyla was as follows: Planctomycetes (30%) > Proteobacteria (18%) > Acidobacteria (7%) > Bacteroidetes (10%) > Firmicutes, Verrucomicrobia, Chloroflexi (6%) > Actinobacteria (4%) > Gemmatimonadetes and Nitrospira (2%) (Figure 1b).

Figure 1.

Figure 1

(a,b) Prominent bacterial phyla in soil based on endophyte presence in tall fescue.

Prominent bacterial families between E− and E+ soil was Planctomycetaceae, Balstocatellaceae_(subgroup_4), Chitinophagaceae, and Bacillaceae (Figure 2). Moreover, we found several characteristics including: nitrogen-utilizing, phosphorus solubilizing, bio-controller, chitin degrading, nitrate reducers, drought and salt tolerant, and other nutrient solubilizing bacterial families, for instance, Planctomycetaceae, Xanthobacteraceae, Flavobacteriaceae, Bradyrhizobiaceae, Acidobacteriaceae_(Subgroup_1), DA101_soil_group, Anaerolineaceae, Nitrosomonadaceae, Tepidisphaeraceae, Gemmatimonadaceae, Cytophagaceae, Burkholderiaceae, and Comamonadaceae (Figure 2 and Supplemental Material S1). Endophyte-free tall fescue soil had higher Planctomycetaceae (31% of Planctomycetes) and Chitinophagaceae (10% of Bacteroidetes) compared to the E+ soil, where the Balstocatellaceae_(subgroup_4) (7% of Acidobacteria) and Bacillaceae (5% of Firmicutes) were higher (Figure 2).

Figure 2.

Figure 2

Relative percent abundance of bacterial families in tall fescue soil.

3.3. Soil Fungal Abundance, Diversity, and Community Composition

We identified 71 and 652 fungal ASVs in the E− and E+ tall fescue soil collected from the tall fescue plots, respectively. In E+ tall fescue soil, we identified 6 phyla, 24 classes, 43 orders, 76 families, and 112 bacterial genera. We identified 3 phyla, 6 classes, 10 orders, 18 families, and only 19 bacterial genera in E− tall fescue soil. In both E− and E+ tall fescue soil, the dominant fungal phyla consisted of Basidiomycota and Ascomycota, respectively (Figure 3a,b). The mean fungal Shannon diversity index was lower overall and was not statistically significant between the E− (mean H′ = 1.21) and E+ (mean H′ = 1.27) soil. Fungal beta diversity presented with principal coordinate analysis (PCoA) based on Bray–Curtis dissimilarities also showed no significant differences. Interestingly, however, we did observe a fungal community shift between E− and E+ tall fescue soil. While Basidiomycota (70%) dominated E− soil, E+ soil had Ascomycota as the prominent phylum (Figure 3a,b). Based on the toxicity status of the endophyte presence in the tall fescue, E+ soil showed a similar percent abundance at phyla level where both toxic and non-toxic infected tall fescue soil had Ascomycota as the prominent phylum (Figure 4). Arbuscular mycorrhizal fungi (AMF) belonging to Glomeromycota phylum (1% of the total fungal abundance) were identified in only E+ fescue soil (Figure 3a). In the case of fungal genera, while E+ soil had no such genus that exceeded more than 5% of the total abundance, the most prominent genus in E− soil belonged to Cortinarius (59% of Basidiomycota) (Figure 5). Interestingly, we measured greater diversity at the genus level in E+ soil (111 genera) compared to E− soil (19 genera). These different fungal genera have been shown to contribute to: plant growth promotion, plant-pathogen suppression, lignin degradation, nitrogen utilization, phosphorus solubilization, biodegradation, phytohormone production, and provides resistance against abiotic stresses such as drought, salt intrusion, and cold tolerance, etc. (Figure 5 and Supplemental Material S2).

Figure 3.

Figure 3

(a,b) Distribution of major fungal phyla in soil based on endophyte presence in tall fescue.

Figure 4.

Figure 4

Prominent fungal phyla in soil based on endophyte toxicity in tall fescue.

Figure 5.

Figure 5

Relative percent abundance of fungal genres in tall fescue soil.

4. Discussion

Despite the intricate nature of soil microbial populations, we found common patterns in bacterial community responses in the soil to the endophyte presence in tall fescue and our results from soil bacterial analysis indicate that the endophyte presence in tall fescue might have had a subtle effect on the bacterial community composition. Contrasting results, however, have been reported on the impact of the endophyte presence in grass species on soil microbial community composition and microbial functions [62]. For instance, soil microbial communities may alter microbial functions due to above-ground endophyte infection of grass species, such as microbial carbon and nitrogen mineralization [32,63,64,65]. Furthermore, endophyte infection of above-ground plant material stimulated below-ground microbial functions primarily due to endophyte-induced rhizodeposition [66]. In our study, the lack of bacterial diversity in community composition perhaps can be speculated to the soil micro-niche effect [67]. Due to the size of bacteria, they are expected to be in direct contact with their immediate surroundings, but often these micro-niches have a different composition from the soil matrix [68]; thus, plant roots may never come into direct contact with the bacterial communities living in these niches and perhaps never influence the community composition of the bacteria living in soils [69].

In our study, Planctomycetes were the dominant oligotrophic phylum (r-strategists) found in both E+ and E− tall fescue rhizosphere soils and they are well suited for nutrient-poor soil indicated by lower soil carbon and phosphorus [70,71,72,73]. They are thought to be crucial in soil organic carbon and complex carbon turnover, nitrogen cycling, and subsequently for soil nutrient availability [74,75,76]. The second dominant bacterial phylum for both E+ and E− tall fescue soil was a versatile group of copiotroph, known as Proteobacteria, that responds to readily available carbon in soil [75,77]. Additionally, these Proteobacteria follow a fast growth pattern in the soil, which consequently may act as a plant growth promoter by releasing soil macro and micro-nutrients from organo-mineral complexes [78,79], especially under copiotroph environments [80]. It is well documented that by producing metabolites of fungal-origin, E+ tall fescue has a competitive advantage over E− grasses, particularly against climatic and edaphic stress, protection against herbivores, enhanced nutrient acquisition, for instance soluble P in nutrient-poor soils [81,82,83]. In our study, another oligotroph microbial taxa, Acidobacter, was found in greater relative percent abundance in E+ tall fescue rhizosphere soil, like Planctomycetes, offers efficient carbon and nitrogen cycling from soil organic matter that can consequently be used as a readily available nutrient source for the E+ plants [75,84]. The Proteobacteria to Acidobacteria (P/A) ratio may serve as a general indicator of soil nutrient status; a low P/A ratio indicates oligotrophic soil environment and a high P/A ratio suggests nutrient richness [85]. In our study, the percent abundance ratio of Proteobacteria/Acidobacteria (P/A) was lower in E+ tall fescue rhizosphere soil (1.66) compared to E− tall fescue rhizosphere soil (2.57). In general, E− tall fescue performs poorer in overall plant fitness and persistence [86], despite the higher soil nutrient status (indicated by high P/A), compared to E+ infected fescue, possibly due to the lower percent abundance of the Acidobacter phylum. Additionally, known copiotrophs, such as Bacteroidetes and Verrucomicrobia, were also present in relatively lower abundance, possibly, due to the overall lower nutrient concentration of the study site [87,88].

In the case of fungal community composition in soil, endophyte presence in tall fescue showed a clear shift in fungal phyla in the rhizosphere. In agroecosystems, strong evidence of multilateral interactions between plant population, soil fungi, and soil solution composition has been discovered [69,89,90,91]. The complex fungal community structure and greater diversity enable enhanced organic matter decomposition, thereby promoting higher nutrient absorption by plants and accelerated soil nutrient cycling [92,93,94]. The plants act as the energy source for the soil fungal population by releasing photosynthetic carbon and secondary metabolites in soil [95,96,97,98,99], thus creating a feedback loop. Thus, soil fungal diversity has a remarkable influence on the fitness of the plant population, soil nutrient composition, and is vastly influenced by the presence of endophytes in plants [100,101,102]. The three prominent fungal phyla in soil are the Ascomycota, Zygomycota, and Basidiomycota [89], and our study site was dominated by either Ascomycota or Basidiomycota depending on the presence of endophytes in tall fescue (not the type of endophytes; toxic or non-toxic). The lower SDI measured for the fungal population in the soil, both E+ and E−, may have been due to the overall higher soil pH of the study site; fungi generally grow better in acidic conditions [103], whereas, our study site had an average soil pH of 6.5. The greater relative abundance of Ascomycota and Basidiomycota in E+ and E− tall fescue rhizosphere soil, respectively, suggests that the presence of endophyte in tall fescue affects the rhizosphere fungal community structure, possibly through a combination of: (i) alkaloids such as loline or peramine excretion in the host grass [104,105]; (ii) production of VOCs and other biochemical induced by the tall fescue [106,107]; and finally, (iii) higher rhizodeposition [108], all of which finally contribute to increased resource availability for soil fungi. This, therefore, is an indication of a three-way relationship between the plant (tall fescue), fescue-dwelling fungal endophytes, and the soil fungal communities [109]. Furthermore, significantly greater plant-available P in E+ soil compared to E− soil (Table 2), particularly in non-toxic E+ soil, suggests the unique contribution of a less studied novel endophyte-host associations to plant nutrition under limited soil plant-available P [110]. This plant-available P in conjunction with the combined presence of Ascomycota, Basidiomycota, and Glomeromycota in E+ tall fescue soil in the rhizosphere is likely to contribute to plant and soil microbial communities’ growth [111]. A highly diverse soil microbial community can withstand the changing environment, show greater resilience, and may bring stability in ecosystem functioning [112,113,114,115]. The observed higher diversity of fungal genera in E+ tall fescue soil is particularly important under a stressed environment because of their impact on plant growth and higher stress amelioration [20,116]. Often, carbon acquisition can be strictly limited under abiotic stress, such as drought, and the plant-associated microbial communities lacks the necessary resources to sustain [117]. However, soil fungal communities may indirectly stimulate photosynthesis in plants by providing necessary nutrients [118]. Thus, the presence of a complex fungal assemblage at genus level in E+ tall fescue soil suggests (Figure 5) that root excreted rhizo-deposits from E+ tall fescue into the soil may have enhanced the mobilization or recruitment of beneficial rhizosphere fungal communities, and in turn, these different soil fungal communities possibly could provide greater fitness and resilience to the plant [119,120,121]. In addition, a greater number of fungal genera in the soil is also important in offering higher functional redundancy for both “basic” and “rare” soil functions [121], particularly under disturbed environments, hence, the greater distribution of different functional groups is a clear indicator of greater functional redundancy [78] in E+ soil compared to E− soil.

5. Conclusions

Our study suggests that a three-way mutualistic relationship exists between tall fescue, fungal endophyte, and the soil rhizosphere communities, particularly the soil fungal community. This study reveals that while there was a subtle change in the soil bacterial population based on endophyte presence in above-ground tall fescue, prominent changes were observed in the fungal community at the genus level compared to the endophyte-free soil. These results point to the possibility that the different soil nutrient acquisition and environmental stress tolerance imparted by endophytes on tall fescue is probably the result of mobilization or recruiting of beneficial rhizosphere microorganisms; however, further field trials of different endophytes in common plant genetic backgrounds are needed to confirm this.

Acknowledgments

The authors are grateful to Savin Khadka, Agricultural Economics, University of Georgia for his initial support with R-Studio software. The authors also acknowledge Jonathan Markham for his help with soil sampling.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/microorganisms9091843/s1, Supplemental Material S1: Prominent bacterial families (%) present in endophyte infected and endophyte free tall fescue soil, Supplemental Material S2: Prominent fungal genres (%) present in endophyte infected and endophyte free tall fescue soil.

Author Contributions

Conceptualization, K.M.; Formal analysis, K.M.; Funding acquisition, A.M. (Ali Missaoui); Investigation, K.M. and A.M. (Ali Missaoui); Methodology, K.M., K.L., and A.M. (Ali Missaoui); Project administration, A.M. (Ali Missaoui); Resources, A.M. (Ali Missaoui); Supervision, A.M. (Ali Missaoui); Validation, N.S.H. and A.M. (Ali Missaoui); Visualization, K.M.; Writing—original draft, K.M. and K.L.; Writing—review and editing, N.S.H., A.M. (Anaas Mergoum), and A.M. (Ali Missaoui). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The Center for Bioenergy Innovation, US Department of Energy Research Center supported by the Office of Biological and Environmental Research in the DOE Office of Science.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets during and/or analyzed during the current study is available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Shantz H. The place of grasslands in the Earth’s cover. Ecology. 1954;35:143–145. doi: 10.2307/1931110. [DOI] [Google Scholar]
  • 2.Dixon A., Faber-Langendoen D., Josse C., Morrison J., Loucks C. Distribution mapping of world grassland types. J. Biogeogr. 2014;41:2003–2019. doi: 10.1111/jbi.12381. [DOI] [Google Scholar]
  • 3.Wedin W.F. Grassland: Quietness and Strength for a New American Agriculture. Volume 142 ASA-CSSA-SSSA; Madison, WI, USA: 2009. [Google Scholar]
  • 4.Deng L., Shangguan Z.-P., Sweeney S. “Grain for Green” driven land use change and carbon sequestration on the Loess Plateau, China. Sci. Rep. 2014;4:7039. doi: 10.1038/srep07039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Endale D., Schomberg H., Franzluebbers A., Seman D., Franklin D., Stuedemann J. Runoff nutrient losses from tall fescue pastures varying in endophyte association, fertilization, and harvest management. J. Soil Water Conserv. 2021;76:25–38. doi: 10.2489/jswc.2021.00164. [DOI] [Google Scholar]
  • 6.Sala O.E., Yahdjian L., Havstad K., Aguiar M.R. Rangeland Systems. Springer; Cham, Switzerland: 2017. Rangeland ecosystem services: Nature’s supply and humans’ demand; pp. 467–489. [Google Scholar]
  • 7.Zhao Y., Liu Z., Wu J. Grassland ecosystem services: A systematic review of research advances and future directions. Landsc. Ecol. 2020;35:1–22. doi: 10.1007/s10980-020-00980-3. [DOI] [Google Scholar]
  • 8.Leuchtmann A. Systematics, distribution, and host specificity of grass endophytes. Nat. Toxins. 1993;1:150–162. doi: 10.1002/nt.2620010303. [DOI] [PubMed] [Google Scholar]
  • 9.Field K.J., Pressel S., Duckett J.G., Rimington W.R., Bidartondo M.I. Symbiotic options for the conquest of land. Trends Ecol. Evol. 2015;30:477–486. doi: 10.1016/j.tree.2015.05.007. [DOI] [PubMed] [Google Scholar]
  • 10.Bouton J., Gates R., Belesky D., Owsley M. Yield and persistence of tall fescue in the southeastern coastal plain after removal of its endophyte. Agron. J. 1993;85:52–55. doi: 10.2134/agronj1993.00021962008500010011x. [DOI] [Google Scholar]
  • 11.Young C.A., Charlton N.D., Takach J.E., Swoboda G.A., Trammell M.A., Huhman D.V., Hopkins A.A. Characterization of Epichloë coenophiala within the US: Are all tall fescue endophytes created equal? Front. Chem. 2014;2:95. doi: 10.3389/fchem.2014.00095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hoveland C.S. Importance and economic significance of the Acremonium endophytes to performance of animals and grass plant. Agric. Ecosyst. Environ. 1993;44:3–12. doi: 10.1016/0167-8809(93)90036-O. [DOI] [Google Scholar]
  • 13.Stuedemann J.A., Hoveland C.S. Fescue endophyte: History and impact on animal agriculture. J. Prod. Agric. 1988;1:39–44. doi: 10.2134/jpa1988.0039. [DOI] [Google Scholar]
  • 14.Hunt M.G., Newman J.A. Reduced herbivore resistance from a novel grass–endophyte association. J. Appl. Ecol. 2005;42:762–769. doi: 10.1111/j.1365-2664.2005.01061.x. [DOI] [Google Scholar]
  • 15.Parish J., McCann M., Watson R., Paiva N., Hoveland C., Parks A., Upchurch B., Hill N., Bouton J. Use of nonergot alkaloid-producing endophytes for alleviating tall fescue toxicosis in stocker cattle. J. Anim. Sci. 2003;81:2856–2868. doi: 10.2527/2003.81112856x. [DOI] [PubMed] [Google Scholar]
  • 16.Hill N., Bouton J., Hiatt E., Kittle B. Seed maturity, germination, and endophyte relationships in tall fescue. Crop Sci. 2005;45:859–863. doi: 10.2135/cropsci2004.0057. [DOI] [Google Scholar]
  • 17.Wang H., Wang S., Wang R., Wang X., Li J. Conservation tillage increased soil bacterial diversity and improved soil nutrient status on the Loess Plateau in China. Arch. Agron. Soil Sci. 2020;66:1509–1519. doi: 10.1080/03650340.2019.1677892. [DOI] [Google Scholar]
  • 18.Koyama A., Wallenstein M.D., Simpson R.T., Moore J.C. Soil bacterial community composition altered by increased nutrient availability in Arctic tundra soils. Front. Microbiol. 2014;5:516. doi: 10.3389/fmicb.2014.00516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lehman R.M., Acosta-Martinez V., Buyer J.S., Cambardella C.A., Collins H.P., Ducey T.F., Halvorson J.J., Jin V.L., Johnson J.M., Kremer R.J. Soil biology for resilient, healthy soil. J. Soil Water Conserv. 2015;70:12A–18A. doi: 10.2489/jswc.70.1.12A. [DOI] [Google Scholar]
  • 20.Porter S.S., Bantay R., Friel C.A., Garoutte A., Gdanetz K., Ibarreta K., Moore B.M., Shetty P., Siler E., Friesen M.L. Beneficial microbes ameliorate abiotic and biotic sources of stress on plants. Funct. Ecol. 2020;34:2075–2086. doi: 10.1111/1365-2435.13499. [DOI] [Google Scholar]
  • 21.Busby P.E., Soman C., Wagner M.R., Friesen M.L., Kremer J., Bennett A., Morsy M., Eisen J.A., Leach J.E., Dangl J.L. Research priorities for harnessing plant microbiomes in sustainable agriculture. PLoS Biol. 2017;15:e2001793. doi: 10.1371/journal.pbio.2001793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mahmud K., Missaoui A., Lee K.C., Ghimire B., Presley H.W., Makaju S. Rhizosphere Microbiome Manipulation for Sustainable Crop Production. Curr. Plant Biol. 2021;27:100210. doi: 10.1016/j.cpb.2021.100210. [DOI] [Google Scholar]
  • 23.Hinsinger P. Bioavailability of soil inorganic P in the rhizosphere as affected by root-induced chemical changes: A review. Plant Soil. 2001;237:173–195. doi: 10.1023/A:1013351617532. [DOI] [Google Scholar]
  • 24.Akhtar M.S., Oki Y., Adachi T. Mobilization and Acquisition of Sparingly Soluble P-Sources by Brassica Cultivars under P-Starved Environment II. Rhizospheric pH changes, Redesigned Root Architecture and Pi-Uptake Kinetics. J. Integr. Plant Biol. 2009;51:1024–1039. doi: 10.1111/j.1744-7909.2009.00873.x. [DOI] [PubMed] [Google Scholar]
  • 25.Bertrand I., Holloway R., Armstrong R., McLaughlin M. Chemical characteristics of phosphorus in alkaline soils from southern Australia. Soil Res. 2003;41:61–76. doi: 10.1071/SR02021. [DOI] [Google Scholar]
  • 26.Yang X.J., Finnegan P.M. Regulation of phosphate starvation responses in higher plants. Ann. Bot. 2010;105:513–526. doi: 10.1093/aob/mcq015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gu M., Chen A., Sun S., Xu G. Complex regulation of plant phosphate transporters and the gap between molecular mechanisms and practical application: What is missing? Mol. Plant. 2016;9:396–416. doi: 10.1016/j.molp.2015.12.012. [DOI] [PubMed] [Google Scholar]
  • 28.Aslam M.M., Akhtar K., Karanja J.K., Haider F.U. Plant Stress Physiology. IntechOpen; London, UK: 2020. Understanding the Adaptive Mechanisms of Plant in Low Phosphorous Soil. [Google Scholar]
  • 29.Batool S., Iqbal A. Phosphate solubilizing rhizobacteria as alternative of chemical fertilizer for growth and yield of Triticum aestivum (Var. Galaxy 2013) Saudi J. Biol. Sci. 2019;26:1400–1410. doi: 10.1016/j.sjbs.2018.05.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Suleman M., Yasmin S., Rasul M., Yahya M., Atta B.M., Mirza M.S. Phosphate solubilizing bacteria with glucose dehydrogenase gene for phosphorus uptake and beneficial effects on wheat. PLoS ONE. 2018;13:e0204408. doi: 10.1371/journal.pone.0204408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hernández I., Munné-Bosch S. Linking phosphorus availability with photo-oxidative stress in plants. J. Exp. Bot. 2015;66:2889–2900. doi: 10.1093/jxb/erv056. [DOI] [PubMed] [Google Scholar]
  • 32.Buyer J.S., Zuberer D.A., Nichols K.A., Franzluebbers A.J. Soil microbial community function, structure, and glomalin in response to tall fescue endophyte infection. Plant Soil. 2011;339:401–412. doi: 10.1007/s11104-010-0592-y. [DOI] [Google Scholar]
  • 33.Iqbal J., Siegrist J.A., Nelson J.A., McCulley R.L. Fungal endophyte infection increases carbon sequestration potential of southeastern USA tall fescue stands. Soil Biol. Biochem. 2012;44:81–92. doi: 10.1016/j.soilbio.2011.09.010. [DOI] [Google Scholar]
  • 34.Matthews J.W., Clay K. Influence of fungal endophyte infection on plant–soil feedback and community interactions. Ecology. 2001;82:500–509. [Google Scholar]
  • 35.Berg G., Smalla K.J.F.m.e. Plant species and soil type cooperatively shape the structure and function of microbial communities in the rhizosphere. FEMS Microbiol. Ecol. 2009;68:1–13. doi: 10.1111/j.1574-6941.2009.00654.x. [DOI] [PubMed] [Google Scholar]
  • 36.Rovira A.J.P. Root excretions in relation to the rhizosphere effect. Plant Soil. 1959;11:53–64. doi: 10.1007/BF01394753. [DOI] [Google Scholar]
  • 37.Warembourg F., Paul E.J.P. The use of C14O2 canopy techniques for measuring carbon transfer through the plant-soil system. Plant Soil. 1973;38:331–345. doi: 10.1007/BF00779017. [DOI] [Google Scholar]
  • 38.Jones D.L., Hodge A., Kuzyakov Y.J.N.P. Plant and mycorrhizal regulation of rhizodeposition. New Phytol. 2004;163:459–480. doi: 10.1111/j.1469-8137.2004.01130.x. [DOI] [PubMed] [Google Scholar]
  • 39.Marschner P., Neumann G., Kania A., Weiskopf L., Lieberei R.J.P. Spatial and temporal dynamics of the microbial community structure in the rhizosphere of cluster roots of white lupin (Lupinus albus L.) Plant Soil. 2002;246:167–174. doi: 10.1023/A:1020663909890. [DOI] [Google Scholar]
  • 40.Shi S., Richardson A.E., O’Callaghan M., DeAngelis K.M., Jones E.E., Stewart A., Firestone M.K., Condron L.M.J.F.m.e. Effects of selected root exudate components on soil bacterial communities. FEMS Microbiol. Ecol. 2011;77:600–610. doi: 10.1111/j.1574-6941.2011.01150.x. [DOI] [PubMed] [Google Scholar]
  • 41.Yang Y., Chen S., Wu X., Syed S.I., Syed I.U.S., Huang B., Guan P., Wang D. Grazing Affects Bacterial and Fungal Diversities and Communities in the Rhizosphere and Endosphere Compartments of Leymus chinensis through Regulating Nutrient and Ion Distribution. Microorganisms. 2021;9:476. doi: 10.3390/microorganisms9030476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rudgers J.A., Clay K. An invasive plant–fungal mutualism reduces arthropod diversity. Ecol. Lett. 2008;11:831–840. doi: 10.1111/j.1461-0248.2008.01201.x. [DOI] [PubMed] [Google Scholar]
  • 43.Bergmann J., Weigelt A., van Der Plas F., Laughlin D.C., Kuyper T.W., Guerrero-Ramirez N., Valverde-Barrantes O.J., Bruelheide H., Freschet G.T., Iversen C.M. The fungal collaboration gradient dominates the root economics space in plants. Sci. Adv. 2020;6:eaba3756. doi: 10.1126/sciadv.aba3756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hu L., Robert C., Cadot S., Zhang X., Ye M., Li B., Manzo D., Chervet N., Steinger T., Van Der Heijden M. Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota. Nat. Commun. 2018;9:2738. doi: 10.1038/s41467-018-05122-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang J., Wang P., Xue K., Hao Y., Wang Y., Cui X. Trait complementarity between fine roots of Stipa purpurea and their associated arbuscular mycorrhizal fungi along a precipitation gradient in Tibetan alpine steppe. J. Mt. Sci. 2019;16:542–547. doi: 10.1007/s11629-018-5311-9. [DOI] [Google Scholar]
  • 46.Waqas M., Khan A.L., Hamayun M., Shahzad R., Kim Y.-H., Choi K.-S., Lee I.-J. Endophytic infection alleviates biotic stress in sunflower through regulation of defence hormones, antioxidants and functional amino acids. Eur. J. Plant Pathol. 2015;141:803–824. doi: 10.1007/s10658-014-0581-8. [DOI] [Google Scholar]
  • 47.Rana K.L., Kour D., Sheikh I., Dhiman A., Yadav N., Yadav A.N., Rastegari A.A., Singh K., Saxena A.K. Recent Advancement in White Biotechnology through Fungi. Springer; Berlin/Heidelberg, Germany: 2019. Endophytic fungi: Biodiversity, ecological significance, and potential industrial applications; pp. 1–62. [Google Scholar]
  • 48.Hacquard S., Kracher B., Hiruma K., Münch P.C., Garrido-Oter R., Thon M.R., Weimann A., Damm U., Dallery J.-F., Hainaut M. Survival trade-offs in plant roots during colonization by closely related beneficial and pathogenic fungi. Nat. Commun. 2016;7:11362. doi: 10.1038/ncomms11362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Frąc M., Hannula S.E., Bełka M., Jędryczka M. Fungal biodiversity and their role in soil health. Front. Microbiol. 2018;9:707. doi: 10.3389/fmicb.2018.00707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Daws S.C., Cline L.A., Rotenberry J., Sadowsky M.J., Staley C., Dalzell B., Kennedy P.G. Do shared traits create the same fates? Examining the link between morphological type and the biogeography of fungal and bacterial communities. Fungal Ecol. 2020;46:100948. doi: 10.1016/j.funeco.2020.100948. [DOI] [Google Scholar]
  • 51.Etesami H., Alikhani H.A., Hosseini H.M. Indole-3-acetic acid (IAA) production trait, a useful screening to select endophytic and rhizosphere competent bacteria for rice growth promoting agents. MethodsX. 2015;2:72–78. doi: 10.1016/j.mex.2015.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Qiu W., Su H., Yan L., Ji K., Liu Q., Jian H. Organic Fertilization Assembles Fungal Communities of Wheat Rhizosphere Soil and Suppresses the Population Growth of Heterodera avenae in the Field. Front. Plant Sci. 2020;11:1225. doi: 10.3389/fpls.2020.01225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kour D., Rana K.L., Yadav N., Yadav A.N., Singh J., Rastegari A.A., Saxena A.K. Recent Advancement in White Biotechnology through Fungi. Springer; Berlin/Heidelberg, Germany: 2019. Agriculturally and industrially important fungi: Current developments and potential biotechnological applications; pp. 1–64. [Google Scholar]
  • 54.Kauppinen M., Saikkonen K., Helander M., Pirttilä A.M., Wäli P.R. Epichloë grass endophytes in sustainable agriculture. Nat. Plants. 2016;2:1–7. doi: 10.1038/nplants.2015.224. [DOI] [PubMed] [Google Scholar]
  • 55.Service N.R.C., Department A. Keys to Soil Taxonomy. Government Printing Office; Washington, DC, USA: 2010. [Google Scholar]
  • 56.Pacific Biosciences . Procedure & Checklist—Amplification of Full-Length 16S Gene with Barcoded Primers for Multiplexed SMRTbell® Library Preparation and Sequencing. Pacific Biosciences; Menlo Park, CA, USA: 2018. [(accessed on 24 June 2021)]. Available online: https://www.pacb.com/wp-content/uploads/Procedure-Checklist-%E2%80%93-Amplification-of-Full-Length-16S-Gene-with-Barcoded-Primers-for-Multiplexed-SMRTbell-Library-Preparation-and-Sequencing.pdf. [Google Scholar]
  • 57.Callahan B.J., McMurdie P.J., Rosen M.J., Han A.W., Johnson A.J.A., Holmes S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods. 2016;13:581–583. doi: 10.1038/nmeth.3869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.McMurdie P.J., Holmes S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE. 2013;8:e61217. doi: 10.1371/journal.pone.0061217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Erdem E., Erdogan H., Oztok U. BIOQUERY-ASP: Querying biomedical ontologies using answer set programming. Proc. RuleML2011@ BRF Chall. 2011:573–578. doi: 10.14806/ej.18.B.551. [DOI] [Google Scholar]
  • 60.Nilsson R.H., Larsson K.-H., Taylor A.F.S., Bengtsson-Palme J., Jeppesen T.S., Schigel D., Kennedy P., Picard K., Glöckner F.O., Tedersoo L. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019;47:D259–D264. doi: 10.1093/nar/gky1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Roberts E.L., Ferraro A. Rhizosphere microbiome selection by Epichloë endophytes of Festuca arundinacea. Plant Soil. 2015;396:229–239. doi: 10.1007/s11104-015-2585-3. [DOI] [Google Scholar]
  • 62.Franzluebbers A., Nazih N., Stuedemann J., Fuhrmann J., Schomberg H., Hartel P. Soil carbon and nitrogen pools under low-and high-endophyte-infected tall fescue. Soil Sci. Soc. Am. J. 1999;63:1687–1694. doi: 10.2136/sssaj1999.6361687x. [DOI] [Google Scholar]
  • 63.Franzluebbers A., Hill N. Soil carbon, nitrogen, and ergot alkaloids with short-and long-term exposure to endophyte-infected and endophyte-free tall fescue. Soil Sci. Soc. Am. J. 2005;69:404–412. doi: 10.2136/sssaj2005.0404. [DOI] [Google Scholar]
  • 64.Franzluebbers A., Stuedemann J. Soil carbon and nitrogen pools in response to tall fescue endophyte infection, fertilization, and cultivar. Soil Sci. Soc. Am. J. 2005;69:396–403. doi: 10.2136/sssaj2005.0396a. [DOI] [Google Scholar]
  • 65.Van Hecke M.M., Treonis A.M., Kaufman J.R. How does the fungal endophyte Neotyphodium coenophialum affect tall fescue (Festuca arundinacea) rhizodeposition and soil microorganisms? Plant Soil. 2005;275:101–109. doi: 10.1007/s11104-005-0380-2. [DOI] [Google Scholar]
  • 66.Vos M., Wolf A.B., Jennings S.J., Kowalchuk G.A. Micro-scale determinants of bacterial diversity in soil. FEMS Microbiol. Rev. 2013;37:936–954. doi: 10.1111/1574-6976.12023. [DOI] [PubMed] [Google Scholar]
  • 67.Urbanová M., Kopecký J., Valášková V., Ságová-Marečková M., Elhottová D., Kyselková M., Moënne-Loccoz Y., Baldrian P. Development of bacterial community during spontaneous succession on spoil heaps after brown coal mining. FEMS Microbiol. Ecol. 2011;78:59–69. doi: 10.1111/j.1574-6941.2011.01164.x. [DOI] [PubMed] [Google Scholar]
  • 68.Urbanová M., Šnajdr J., Baldrian P. Composition of fungal and bacterial communities in forest litter and soil is largely determined by dominant trees. Soil Biol. Biochem. 2015;84:53–64. doi: 10.1016/j.soilbio.2015.02.011. [DOI] [Google Scholar]
  • 69.Buckley D.H., Huangyutitham V., Nelson T.A., Rumberger A., Thies J.E. Diversity of Planctomycetes in soil in relation to soil history and environmental heterogeneity. Appl. Environ. Microbiol. 2006;72:4522–4531. doi: 10.1128/AEM.00149-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Chaudhry V., Rehman A., Mishra A., Chauhan P.S., Nautiyal C.S. Changes in bacterial community structure of agricultural land due to long-term organic and chemical amendments. Microb. Ecol. 2012;64:450–460. doi: 10.1007/s00248-012-0025-y. [DOI] [PubMed] [Google Scholar]
  • 71.Ditterich F., Poll C., Pronk G.J., Heister K., Chandran A., Rennert T., Kögel-Knabner I., Kandeler E. Succession of soil microbial communities and enzyme activities in artificial soils. Pedobiologia. 2016;59:93–104. doi: 10.1016/j.pedobi.2016.03.002. [DOI] [Google Scholar]
  • 72.Hartmann M., Frey B., Mayer J., Mäder P., Widmer F. Distinct soil microbial diversity under long-term organic and conventional farming. ISME J. 2015;9:1177–1194. doi: 10.1038/ismej.2014.210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Lupatini M., Korthals G.W., de Hollander M., Janssens T.K., Kuramae E.E. Soil microbiome is more heterogeneous in organic than in conventional farming system. Front. Microbiol. 2017;7:2064. doi: 10.3389/fmicb.2016.02064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Fierer N., Bradford M.A., Jackson R.B. Toward an ecological classification of soil bacteria. Ecology. 2007;88:1354–1364. doi: 10.1890/05-1839. [DOI] [PubMed] [Google Scholar]
  • 75.Chen Y., Xin L., Liu J., Yuan M., Liu S., Jiang W., Chen J. Changes in bacterial community of soil induced by long-term straw returning. Sci. Agric. 2017;74:349–356. doi: 10.1590/1678-992x-2016-0025. [DOI] [Google Scholar]
  • 76.Ramirez-Villanueva D.A., Bello-López J.M., Navarro-Noya Y.E., Luna-Guido M., Verhulst N., Govaerts B., Dendooven L. Bacterial community structure in maize residue amended soil with contrasting management practices. Appl. Soil Ecol. 2015;90:49–59. doi: 10.1016/j.apsoil.2015.01.010. [DOI] [Google Scholar]
  • 77.Mahmud K., Franklin D., Ney L., Cabrera M., Habteselassie M., Hancock D., Newcomer Q., Subedi A., Dahal S. Improving inorganic nitrogen in soil and nutrient density of edamame bean in three consecutive summers by utilizing a locally sourced bio-inocula. Org. Agric. 2021;11:1–11. doi: 10.1007/s13165-020-00341-z. [DOI] [Google Scholar]
  • 78.Lugtenberg B., Kamilova F. Plant-growth-promoting rhizobacteria. Annu. Rev. Microbiol. 2009;63:541–556. doi: 10.1146/annurev.micro.62.081307.162918. [DOI] [PubMed] [Google Scholar]
  • 79.Wang Q., Wang C., Yu W., Turak A., Chen D., Huang Y., Ao J., Jiang Y., Huang Z. Effects of nitrogen and phosphorus inputs on soil bacterial abundance, diversity, and community composition in Chinese fir plantations. Front. Microbiol. 2018;9:1543. doi: 10.3389/fmicb.2018.01543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Malinowski D.P., Belesky D.P. Epichloë (formerly Neotyphodium) fungal endophytes increase adaptation of cool-season perennial grasses to environmental stresses. Acta Agrobot. 2019;2:72. doi: 10.5586/aa.1767. [DOI] [Google Scholar]
  • 81.Wang J., Hou W., Christensen M.J., Li X., Xia C., Li C., Nan Z. Role of Epichloë endophytes in improving host grass resistance ability and soil properties. J. Agric. Food Chem. 2020;68:6944–6955. doi: 10.1021/acs.jafc.0c01396. [DOI] [PubMed] [Google Scholar]
  • 82.Malinowski D.P., Belesky D.P. Adaptations of endophyte-infected cool-season grasses to environmental stresses: Mechanisms of drought and mineral stress tolerance. Crop Sci. 2000;40:923–940. doi: 10.2135/cropsci2000.404923x. [DOI] [Google Scholar]
  • 83.Eilers K.G., Lauber C.L., Knight R., Fierer N. Shifts in bacterial community structure associated with inputs of low molecular weight carbon compounds to soil. Soil Biol. Biochem. 2010;42:896–903. doi: 10.1016/j.soilbio.2010.02.003. [DOI] [Google Scholar]
  • 84.Joshi S., Jaggi V., Gangola S., Singh A., Sah V., Sahgal M. Contrasting rhizosphere bacterial communities of healthy and wilted Dalbergia sissoo Roxb. forests. Rhizosphere. 2021;17:100295. doi: 10.1016/j.rhisph.2020.100295. [DOI] [Google Scholar]
  • 85.Waller J.C. Endophyte effects on cattle. Tall Fescue Twenty-First Century. 2009;53:289–310. [Google Scholar]
  • 86.Fierer N., Ladau J., Clemente J.C., Leff J.W., Owens S.M., Pollard K.S., Knight R., Gilbert J.A., McCulley R.L. Reconstructing the microbial diversity and function of pre-agricultural tallgrass prairie soils in the United States. Science. 2013;342:621–624. doi: 10.1126/science.1243768. [DOI] [PubMed] [Google Scholar]
  • 87.Trivedi P., Anderson I.C., Singh B.K. Microbial modulators of soil carbon storage: Integrating genomic and metabolic knowledge for global prediction. Trends Microbiol. 2013;21:641–651. doi: 10.1016/j.tim.2013.09.005. [DOI] [PubMed] [Google Scholar]
  • 88.Ding J., Jiang X., Guan D., Zhao B., Ma M., Zhou B., Cao F., Yang X., Li L., Li J. Influence of inorganic fertilizer and organic manure application on fungal communities in a long-term field experiment of Chinese Mollisols. Appl. Soil Ecol. 2017;111:114–122. doi: 10.1016/j.apsoil.2016.12.003. [DOI] [Google Scholar]
  • 89.Mueller R.C., Paula F.S., Mirza B.S., Rodrigues J.L., Nüsslein K., Bohannan B.J. Links between plant and fungal communities across a deforestation chronosequence in the Amazon rainforest. ISME J. 2014;8:1548–1550. doi: 10.1038/ismej.2013.253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Sun R., Dsouza M., Gilbert J.A., Guo X., Wang D., Guo Z., Ni Y., Chu H. Fungal community composition in soils subjected to long-term chemical fertilization is most influenced by the type of organic matter. Environ. Microbiol. 2016;18:5137–5150. doi: 10.1111/1462-2920.13512. [DOI] [PubMed] [Google Scholar]
  • 91.Hiscox J., Savoury M., Müller C.T., Lindahl B.D., Rogers H.J., Boddy L. Priority effects during fungal community establishment in beech wood. ISME J. 2015;9:2246–2260. doi: 10.1038/ismej.2015.38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Kivlin S.N., Winston G.C., Goulden M.L., Treseder K.K. Environmental filtering affects soil fungal community composition more than dispersal limitation at regional scales. Fungal Ecol. 2014;12:14–25. doi: 10.1016/j.funeco.2014.04.004. [DOI] [Google Scholar]
  • 93.Yao Q., Liu J., Yu Z., Li Y., Jin J., Liu X., Wang G. Changes of bacterial community compositions after three years of biochar application in a black soil of northeast China. Appl. Soil Ecol. 2017;113:11–21. doi: 10.1016/j.apsoil.2017.01.007. [DOI] [Google Scholar]
  • 94.Ponge J.-F. Plant–soil feedbacks mediated by humus forms: A review. Soil Biol. Biochem. 2013;57:1048–1060. doi: 10.1016/j.soilbio.2012.07.019. [DOI] [Google Scholar]
  • 95.Requena N., Jimenez I., Toro M., Barea J. Interactions between plant-growth-promoting rhizobacteria (PGPR), arbuscular mycorrhizal fungi and Rhizobium spp. in the rhizosphere of Anthyllis cytisoides, a model legume for revegetation in mediterranean semi-arid ecosystems. New Phytol. 1997;136:667–677. doi: 10.1046/j.1469-8137.1997.00786.x. [DOI] [PubMed] [Google Scholar]
  • 96.Sláviková E., Košíková B., Mikulášová M. Biotransformation of waste lignin products by the soil-inhabiting yeast Trichosporon pullulans. Can. J. Microbiol. 2002;48:200–203. doi: 10.1139/w02-013. [DOI] [PubMed] [Google Scholar]
  • 97.Van Bruggen A.H., Semenov A.M. In search of biological indicators for soil health and disease suppression. Appl. Soil Ecol. 2000;15:13–24. doi: 10.1016/S0929-1393(00)00068-8. [DOI] [Google Scholar]
  • 98.Vázquez M.M., César S., Azcón R., Barea J.M. Interactions between arbuscular mycorrhizal fungi and other microbial inoculants (Azospirillum, Pseudomonas, Trichoderma) and their effects on microbial population and enzyme activities in the rhizosphere of maize plants. Appl. Soil Ecol. 2000;15:261–272. doi: 10.1016/S0929-1393(00)00075-5. [DOI] [Google Scholar]
  • 99.Rousk J., Bååth E., Brookes P.C., Lauber C.L., Lozupone C., Caporaso J.G., Knight R., Fierer N. Soil bacterial and fungal communities across a pH gradient in an arable soil. ISME J. 2010;4:1340–1351. doi: 10.1038/ismej.2010.58. [DOI] [PubMed] [Google Scholar]
  • 100.Van Der Heijden M.G., De Bruin S., Luckerhoff L., Van Logtestijn R.S., Schlaeppi K. A widespread plant-fungal-bacterial symbiosis promotes plant biodiversity, plant nutrition and seedling recruitment. ISME J. 2016;10:389–399. doi: 10.1038/ismej.2015.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Nissinen R., Helander M., Kumar M., Saikkonen K. Heritable Epichloë symbiosis shapes fungal but not bacterial communities of plant leaves. Sci. Rep. 2019;9:5253. doi: 10.1038/s41598-019-41603-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Dix N.J. Fungal Ecology. Springer Science & Business Media; Berlin/Heidelberg, Germany: 2012. [Google Scholar]
  • 103.Guo J., McCulley R., Phillips T., McNear D., Jr. Fungal endophyte and tall fescue cultivar interact to differentially affect bulk and rhizosphere soil processes governing C and N cycling. Soil Biol. Biochem. 2016;101:165–174. doi: 10.1016/j.soilbio.2016.07.014. [DOI] [Google Scholar]
  • 104.Lugtenberg B.J., Caradus J.R., Johnson L.J. Fungal endophytes for sustainable crop production. FEMS Microbiol. Ecol. 2016;92:fiw194. doi: 10.1093/femsec/fiw194. [DOI] [PubMed] [Google Scholar]
  • 105.Rostás M., Cripps M.G., Silcock P. Aboveground endophyte affects root volatile emission and host plant selection of a belowground insect. Oecologia. 2015;177:487–497. doi: 10.1007/s00442-014-3104-6. [DOI] [PubMed] [Google Scholar]
  • 106.Rasmussen S., Parsons A.J., Fraser K., Xue H., Newman J.A. Metabolic profiles of Lolium perenne are differentially affected by nitrogen supply, carbohydrate content, and fungal endophyte infection. Plant Physiol. 2008;146:1440–1453. doi: 10.1104/pp.107.111898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Guo J., McCulley R.L., McNear D.H., Jr. Tall fescue cultivar and fungal endophyte combinations influence plant growth and root exudate composition. Front. Plant Sci. 2015;6:183. doi: 10.3389/fpls.2015.00183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Rojas X., Guo J., Leff J.W., McNear D.H., Fierer N., McCulley R.L. Infection with a shoot-specific fungal endophyte (Epichloë) alters tall fescue soil microbial communities. Microb. Ecol. 2016;72:197–206. doi: 10.1007/s00248-016-0750-8. [DOI] [PubMed] [Google Scholar]
  • 109.Ding N., Guo H., Kupper J.V., McNear D.H., Jr. Phosphorus source and Epichloë coenophiala strain interact over time to modify tall fescue rhizosphere microbial community structure and function. Soil Biol. Biochem. 2021;154:108125. doi: 10.1016/j.soilbio.2020.108125. [DOI] [Google Scholar]
  • 110.Tedersoo L., Bahram M., Põlme S., Kõljalg U., Yorou N.S., Wijesundera R., Ruiz L.V., Vasco-Palacios A.M., Thu P.Q., Suija A. Global diversity and geography of soil fungi. Science. 2014;346:1256688. doi: 10.1126/science.1256688. [DOI] [PubMed] [Google Scholar]
  • 111.García-García N., Tamames J., Linz A.M., Pedrós-Alió C., Puente-Sánchez F. Microdiversity ensures the maintenance of functional microbial communities under changing environmental conditions. ISME J. 2019;13:2969–2983. doi: 10.1038/s41396-019-0487-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Griffiths B.S., Philippot L. Insights into the resistance and resilience of the soil microbial community. FEMS Microbiol. Rev. 2013;37:112–129. doi: 10.1111/j.1574-6976.2012.00343.x. [DOI] [PubMed] [Google Scholar]
  • 113.Erkus O., De Jager V.C., Spus M., van Alen-Boerrigter I.J., Van Rijswijck I.M., Hazelwood L., Janssen P.W., Van Hijum S.A., Kleerebezem M., Smid E.J. Multifactorial diversity sustains microbial community stability. ISME J. 2013;7:2126–2136. doi: 10.1038/ismej.2013.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Shade A., Read J.S., Youngblut N.D., Fierer N., Knight R., Kratz T.K., Lottig N.R., Roden E.E., Stanley E.H., Stombaugh J. Lake microbial communities are resilient after a whole-ecosystem disturbance. ISME J. 2012;6:2153–2167. doi: 10.1038/ismej.2012.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Rho H., Hsieh M., Kandel S.L., Cantillo J., Doty S.L., Kim S.-H. Do endophytes promote growth of host plants under stress? A meta-analysis on plant stress mitigation by endophytes. Microb. Ecol. 2018;75:407–418. doi: 10.1007/s00248-017-1054-3. [DOI] [PubMed] [Google Scholar]
  • 116.Taylor B.N., Menge D.N. Light regulates tropical symbiotic nitrogen fixation more strongly than soil nitrogen. Nat. Plants. 2018;4:655–661. doi: 10.1038/s41477-018-0231-9. [DOI] [PubMed] [Google Scholar]
  • 117.Kaschuk G., Kuyper T.W., Leffelaar P.A., Hungria M., Giller K.E. Are the rates of photosynthesis stimulated by the carbon sink strength of rhizobial and arbuscular mycorrhizal symbioses? Soil Biol. Biochem. 2009;41:1233–1244. doi: 10.1016/j.soilbio.2009.03.005. [DOI] [Google Scholar]
  • 118.Van Der Putten W.H. Belowground drivers of plant diversity. Science. 2017;355:134–135. doi: 10.1126/science.aal4549. [DOI] [PubMed] [Google Scholar]
  • 119.Bever J.D., Platt T.G., Morton E.R. Microbial population and community dynamics on plant roots and their feedbacks on plant communities. Annu. Rev. Microbiol. 2012;66:265–283. doi: 10.1146/annurev-micro-092611-150107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Lekberg Y., Bever J.D., Bunn R.A., Callaway R.M., Hart M.M., Kivlin S.N., Klironomos J., Larkin B.G., Maron J.L., Reinhart K.O. Relative importance of competition and plant–soil feedback, their synergy, context dependency and implications for coexistence. Ecol. Lett. 2018;21:1268–1281. doi: 10.1111/ele.13093. [DOI] [PubMed] [Google Scholar]
  • 121.Yu J., Whalen J.K. A new perspective on functional redundancy and phylogenetic niche conservatism in soil microbial communities. Pedosphere. 2020;30:18–24. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The datasets during and/or analyzed during the current study is available from the corresponding author on reasonable request.


Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES