Myoblast mechanotransduction and myotube morphology is dependent on BAG3 regulation of YAP and TAZ

Abstract

Skeletal muscle tissue is mechanically dynamic with changes in stiffness influencing function, maintenance, and regeneration. We modeled skeletal muscle mechanical changes in culture with dynamically stiffening hydrogels demonstrating that the chaperone protein BAG3 transduces matrix stiffness by redistributing YAP and TAZ subcellular localization in muscle progenitor cells. BAG3 depletion increases cytoplasmic retention of YAP and TAZ, desensitizing myoblasts to changes in hydrogel elastic moduli. Upon differentiation, muscle progenitors depleted of BAG3 formed enlarged, round myotubes lacking the typical cylindrical morphology. The aberrant morphology is dependent on YAP/TAZ signaling, which was sequestered in the cytoplasm in BAG3-depleted myotubes but predominately nuclear in cylindrical myotubes of control cells. Control progenitor cells induced to differentiate on soft (E’ = 4 and 12 kPa) hydrogels formed circular myotubes similar to those observed in BAG3-depleted cells. Inhibition of the Hippo pathway partially restored myotube morphologies, permitting nuclear translocation of YAP and TAZ in BAG3-depleted myogenic progenitors. Thus, BAG3 is a critical mediator of dynamic stiffness changes in muscle tissue, coupling mechanical alterations to intracellular signals and inducing changes in gene expression that influence muscle progenitor cell morphology and differentiation.

Introduction:

Skeletal muscle is dynamic; changes in muscle stiffness occur following exercise [1,2], injury [3,4], in diseased muscle [5], and during aging [6,7], over timescales ranging from days to years. These changes in muscle mechanical properties can influence resident skeletal muscle stem cells (MuSC) [8,9], which are required for muscle maintenance and repair. During regeneration, MuSCs exit quiescence (activate) and then rapidly proliferate as progenitor cells (myoblasts) [10,11]. The majority of myoblasts differentiate and fuse into damaged myofibers to replace the myonuclei or fuse with each other to generate new myofibers, while a minority reinstate quiescence to replenish MuSCs. In vitro myoblast proliferation and myotube differentiation depends on stiffness of the microenvironment [12,13], yet mechanotransduction machinery enabling muscle progenitors to sense the dynamic mechanical cues remains poorly defined.

Myogenic cells can transduce matrix mechanics into transcriptional changes via the transcriptional coactivators yes-associated protein 1 (YAP) and WW domain-containing transcription regulator protein 1 (wwTR1 or TAZ) [14–16]. In MuSCs, YAP and TAZ translocate to the nucleus as the matrix stiffens, increasing proliferation and inducing transcription [17]. While YAP/TAZ nucleocytoplasmic localization almost entirely regulates the stiffness dependent cellular transcriptome, inhibiting RhoA and RAP2 [15,18], which promote YAP/TAZ nuclear localization, does not abrogate all YAP/TAZ-dependent transcription, suggesting alternative pathways linking cytoskeletal tension to YAP/TAZ signaling [19].

Chaperone-assisted autophagy (CASA) component Bcl2-associated athanogene 3 (BAG3) may regulate mechanotransduction as BAG3 contains a WW-domain, allowing BAG3 to interact with LATS1/2 and AMOTL1/2, YAP/TAZ cytoplasmic inhibitors that interact with YAP/TAZ via WW domains [20,21]. BAG3 and the co-chaperones HspB8/Hsc70 and HspB1 present in the CASA complex recognize stretching of the actin-binding protein filamin C upon increasing cytoskeletal tension [22,23]. Whether BAG3 is involved in transducing mechanical signals in myofibers is not known as the functions of the CASA are complex and intertwined [24,25]. Elucidating the effects for changes in stiffness on cell behavior is extremely difficult in vivo, yet the majority of culture studies employ supraphysiologically stiff polystyrene substrates that over activate mechanotransduction pathways.

Synthetic hydrogels with well-defined mechanical properties and chemical composition avoid the use of supraphysiologically stiff substrates [26] and, more recently, dynamic hydrogels that can be physically softened [27–29] or stiffened [30,31] in the presence of cells mimic changes of stiffness in vivo. Dynamic hydrogels can determine kinetics of mechanotransduction pathways in real-time and identify mechanisms sensitive to changes in stiffness, rather than an equilibrium response to a hydrogel stiffness with an absolute magnitude [32,33]. To recapitulate the stiffening observed in muscle, we developed photostiffening poly(ethylene glycol) (PEG)-based hydrogels using a strain-promoted azide/alkyne cycloaddition (SPAAC) reaction [34]. Following initial hydrogel formation upon reaction of azide (-N₃) and dibenzocyclooctyne (DBCO) functionalized PEGs, formulations containing excess DBCO groups can undergo a photoinitiated, secondary crosslinking reaction in cytocompatible conditions [35]. Using this reaction, we precisely tune the initial hydrogel modulus and then photostiffen the matrix an order of magnitude to study cellular responses to changes of the physical microenvironment.

We found BAG3 transduces mechanical signals in myoblasts and myotubes by redistributing the subcellular location of YAP/TAZ. Depleting BAG3 desensitizes muscle cells to matrix stiffness, as regulation of YAP/TAZ subcellular localization becomes stiffness-independent. Deactivating the Hippo pathway overrides BAG3 depletion and promotes YAP/TAZ nuclear translocation, indicating that BAG3 interacts with upstream cytoplasmic inhibitors of YAP/TAZ [20]. Furthermore, BAG3 knockdown profoundly affects muscle cell differentiation morphology while Hippo pathway deactivation partially rescues the myotube morphology. In summary, BAG3 mediates muscle cell mechanotransduction and mechanosensitive myogenic differentiation through YAP/TAZ.

Results:

BAG3 mechanotransduction is dependent on YAP/TAZ.

Hydrogels with tunable mechanical properties were synthesized using poly(ethylene glycol) (PEG)-based hydrogels via a strain-promoted azide/alkyne cycloaddition (SPAAC) reaction. In a typical formulation, 4-arm 10 kDa PEG-N₃ and 8-arm 20 kDa PEG-DBCO (5 wt%) macromers were polymerized for 5 min at room temperature (Fig 1A). By varying the DBCO:N₃ stoichiometric ratio between 1:5 to 1:2, Young’s moduli of the SPAAC hydrogels was tailored between E’ = 1 to 20 kPa using shear rheology, which spans the range of mechanical properties measured during muscle regeneration (Fig. 1B) [17]. An azide-functionalized fibronectin-mimetic sequence (N₃-KRGDS, 1mM) was incorporated into the hydrogels to promote cell adhesion.

Figure 1: BAG3 modulates YAP/TAZ mechanotransduction.

A) Structure of the end-functionalized poly(ethylene glycol) macromers and azide-functionalized cell adhesion peptide (N₃-KRGDS) used to synthesize hydrogels via SPAAC reaction. B) Rheological traces monitor network evolution over 300 seconds. n=3. C) Representative images of C2C12 cells cultured on E’ = 32 kPa SPAAC hydrogels with or without 8 h HSPi treatment. D) YAP/TAZ Nuc:Cyto ratio of C2C12 cells cultured on E’ = 4 to 32 kPa hydrogels with or without HSPi. n > 135 cells, 3 independent hydrogels. * < 0.05 and *** < 0.001 in a one-way ANOVA test. E) Protein and mRNA expression (F) from C2C12 cells after BAG3 knockdown (shBAG3 cells) and compared to lysates from control cells (shNT cells). n = 3. G) mRNA expression of BAG3, YAP, TAZ and nuclear YAP/TAZ targets ANKRD1 and CTGF. n=3. H) Representative images of shNT and shBAG3 C2C12 cells immunoreactive for YAP/TAZ, phalloidin labeled, and DAPI labeled, cultured on E’ = 32 kPa hydrogels for 72 h. I) YAP/TAZ Nuc:Cyto ratio of shBAG3 and shNT cells cultured on E’ = 2 to 32 kPa. n > 122 cells, 3 independent hydrogels. *,^# < 0.05 and ***,^# < 0.001 in a 2-way ANOVA test, where *,*** compares shNT and shBAG3 cells at specific stiffness values and ^#,^### compares each cell relative to E’ = 4 kPa stiffness. J) YAP/TAZ Nuc:Cyto ratio of shBAG3 and shNT cells cultured on E’ = 4 and 32 kPa hydrogels as a function of culture time. n > 85 cells, 3 independent hydrogels. * < 0.05 and *** < 0.001 in a one-way ANOVA test that compares between E’ = 4 and 32 kPa hydrogels for each timepoint. Panels C and H are composed of several individual cells merged together.

To assess if chaperone-assisted autophagy (CASA) influences mechanotransduction in myoblasts (C2C12 cells), we disrupted CASA function, using VER-155008 (HSC70i), an inhibitor of HSC70-BAG3 interactions [36]. C2C12 cells were cultured on E’ = 4–32 kPa SPAAC hydrogels for 48 h and treated with HSC70i (5 μM) or vehicle control for another 24 h. HSC70i treatment significantly increased YAP/TAZ nuclear to cytoplasmic intensity ratio (YAP/TAZ Nuc:Cyto ratio) in C2C12 cells at every stiffness value (Fig. 1, C and D). Since the HSC70/HspB8/BAG3 complex is responsible for degradation and lysosomal trafficking of stretched filamin C [20], we hypothesize that inhibiting this complex would free BAG3, promote binding to YAP/TAZ cytoplasmic inhibitors, releasing YAP/TAZ, allowing their nuclear translocation.

Since HSC70i treatment could non-specifically inhibit BAG3 interactions with other proteins such as Hsp70, [37] we knocked down (KD) BAG3 in C2C12 cells with small hairpin RNAs to BAG3 (shBAG3 cells), which reduced BAG3 for at least 120h as measured by qPCR (Fig. S1). In parallel, a non-targeting shRNA (Sigma Millipore, SHC002V) was introduced to C2C12 cells as a control (shNT cells). BAG3 protein (Fig. 1E) and mRNA expression (Fig. 1F) were reduced in BAG3 shRNA transduced (shBAG3) cells compared to shNT cells. To determine the influence of BAG3 KD on YAP/TAZ transcripts, we quantified gene expression levels of YAP, TAZ, ANKRD1, and CTGF; the latter two are target genes of nuclear YAP/TAZ [15]. While BAG3 KD did not change expression of YAP or TAZ, CTGF and ANKRD1 expression were reduced, indicating cytoplasmic retention of YAP/TAZ (Fig. 1G). The YAP/TAZ Nuc:Cyto ratio in shBAG3 cells was lower compared to shNT cells when cultured on E’ = 4–32 kPa hydrogels for 48 h (Fig. 1, H and I) and YAP/TAZ localization was independent from substrate stiffness (E’ = 4 – 32 kPa) in shBAG3 cells after 48 h of culture (Fig. 1J). Control cells were mechanoresponsive between 24–120 h on hydrogels, where YAP/TAZ Nuc:Cyto ratio increased the first 48 h and subsequently decreased between 48–120 h on both E’ = 4 and 32 kPa hydrogels.

BAG3 knockdown desensitizes myoblast mechanosensing

To determine if BAG3 depletion affects stiffness-induced YAP/TAZ nuclear translocation, we designed SPAAC hydrogels that photostiffen from E’ = 4 to 32 kPa in the presence λ = 365 nm light (I = 10 mW/cm²) and 2 mM LAP photoinitiator (Fig. 2, A and B) [35]. In situ stiffening was initiated 24 h after seeding shNT and shBAG3 C2C12 cells; YAP/TAZ nuclear localization was monitored for an additional 48 h after stiffening. In parallel, shBAG3 and shNT cells were cultured on hydrogels with a constant modulus (i.e., either E’ = 4 or 32 kPa) and treated with the identical light dose 24 h post-seeding without the photoinitiator. The shNT cells were mechanoresponsive, as the YAP/TAZ Nuc:Cyto ratio increased for 48 h post-stiffening to levels indistinguishable from YAP/TAZ in shNT cells cultured on constant modulus E’ = 32 kPa hydrogels. In contrast, YAP/TAZ localization in shBAG3 cells did not increase post-stiffening (Fig. 2, C, D and Fig. S2). Furthermore, after 48 h post stiffening, there were no statistically significant differences in the YAP/TAZ Nuc:Cyto ratio in shBAG3 cells cultured on either E’ = 4 or 32 kPa static hydrogels, indicating BAG3 depletion desensitized C2C12 cells to changes in matrix stiffness. BAG3 appears to interact with YAP/TAZ cytoplasmic inhibitors in stiff matrices, releasing YAP/TAZ, and translocating YAP/TAZ to the nucleus (Fig. 2E). BAG3 depletion did not affect upstream cell-matrix interactions, as focal adhesion size and area were unaltered in shBAG3 cells compared to shNT cells cultured on E’ = 4 and 32 kPa hydrogels and on glass (Fig. S3).

Figure 2: BAG3 knockdown desensitizes C2C12 cells to matrix stiffness.

A) Schematic illustration of the SPAAC in situ stiffening reaction, which takes place upon light irradiation if the initial formulation contains excess DBCO groups. B) Young’s modulus (E’) measurement of a SPAAC hydrogel with rheology. Hydrogel was composed of a DBCO:N₃ stoichiometric ratio of 4:1, and irradiated with 365 nm light with 5 mW/cm² intensity for 120 s with 2 mM LAP. Normalized YAP/TAZ Nuc:Cyto ratio of (C) shNT and (D) shBAG3 cells cultured on stiff (E’= 32 kPa), soft (E’ = 4 kPa), and in situ stiffened (E’ = 4 → 32 kPa) hydrogels. In situ stiffening was carried out 24 h after seeding. *** < 0.001 in a one-way ANOVA test comparing means obtained on E’ = 4 and 32 kPa hydrogels, and ### < 0.001 in a one-way ANOVA test comparing means w.r.t to 24 h post-seeding timepoint. n > 155 cells, 3 independent hydrogels. E) Proposed mechanism for BAG3 regulation of YAP/TAZ mechanotransduction.

BAG3 influences stiffness-dependent myotube morphology

Since myoblast differentiation depends on substrate stiffness [38] and BAG3 regulates mechanosensing, we asked if BAG3 alters myotube formation upon differentiation of C2C12 cells. C2C12 cells transduced with either a BAG3 shRNA or a non-targeting shRNA were differentiated for 3 d on gelatin coated glass (E’ > 50 GPa) and immunoreactivity for myosin (MF20) and myogenin (proteins induced upon differentiation) were assayed in C2C12 cell derived myotubes. While shNT cells fused, forming narrow myotubes on glass, shBAG3 cells fused, forming enlarged myotubes with more myonuclei compared to controls (Fig. 3A). To determine if reduced mechanosensing in shBAG3 cells contributes to the large myotube morphology, we differentiated shNT cells on E’ = 4, 12, and 32 kPa and shBAG3 cells on E’ = 32 kPa hydrogels. The diameters of the myotubes formed by shNT cells increased on E’ = 32 kPa compared to glass, while enlarged and rounded myotubes formed on softer matrices (E’ = 4 kPa). BAG3 depleted myotubes formed almost spherical aggregates on E’ = 32 kPa. In summary, reduced mechanosensing either due to BAG3 depletion or decreased substate stiffness increased myotube diameter (Fig. 3B), increased myonuclei (Fig. 3C), decreased aspect ratio (Fig. 3D), and percentage of myogenin⁺ nuclei within the myotubes (Fig 3E).

Figure 3: BAG3 influences stiffness dependent changes in myotube morphology.

A) Representative images of myotubes derived from shNT and shBAG3 C2C12 cells 3 d post-differentiation cultured on glass and E’ = 32 and 4 kPa hydrogels. Myotubes are immunoreactive for MF20 and myogenin. Nuclei are labeled with DAPI. Quantification of the B) mean myotube diameter, C) nuclei per myotube D) % myogenin⁺ nuclei in the myotubes, and (E) myotube aspect ratio. Straight lines show the mean and dotted lines show the 25^th and 75^th quartiles. n > 43 myotubes, 3 independent hydrogels. For all data, * < 0.05, ** < 0.01 and *** < 0.001 in a student’s t-test.

Hippo pathway inhibition overrides reduced YAP/TAZ nuclear localization in BAG3 depleted myoblasts and partially reverts the differentiated syncytia morphology

BAG3 regulates YAP/TAZ nuclear translocation by binding to its cytoplasmic inhibitors LATS1/2, AMOTL1/2 and 14–3-3 through a WW-domain [20]. We focused on LATS1/2, which retains YAP/TAZ in the cytoplasm upon phosphorylation by MST1/2 if the Hippo pathway is active [39]. If the Hippo pathway is inactive, LATS1/2 cannot bind to YAP/TAZ and thus, YAP/TAZ localization is independent of BAG3, (Fig. 4A) only if BAG3 interacts with YAP/TAZ entirely through LATS1/2. To test this hypothesis, we inhibited the Hippo pathway with a small molecule inhibitor of MST1/2 (MSTi), XMU-MP-1 [40]. When shBAG3 and shNT myoblasts were treated with MSTi (1 μM, 6 h) on E’ = 4 kPa hydrogels, YAP/TAZ nuclear localization in shBAG3 C2C12 cells were indistinguishable from shNT cells. (Fig. 4 B and C). Furthermore, the pYAP/YAP protein level ratio in shBAG3 cells has decreased to levels indistinguishable from shNT cells upon MSTi (Fig. S4). While BAG3 depletion causes retention of pYAP in the cytoplasm, MSTi completely overrode this effect of reduced BAG3 restoring nuclear localization of YAP/TAZ. Therefore, BAG3 interacts upstream of YAP/TAZ and downstream of MSTi with the Hippo pathway (LATS1/2) to regulate YAP/TAZ translocation.

Figure 4: Hippo pathway inhibition rescues YAP/TAZ signaling and myotube morphology of BAG3 KD cells.

A) Proposed mechanism that overrides reduced YAP/TAZ nuclear translocation in BAG3 depleted cells. B) Representative shNT and shBAG3 C2C12 cells cultured on E’ = 4 kPa hydrogels with or without 1 μM XMU-MP-1 (MSTi) treatment for 6 hours. Cells are immunolabeled for YAP/TAZ, phalloidin, and DAPI. These images are composed of several individual cells merged together. C) Quantification of YAP/TAZ localization with and without MSTi treatment on E’ = 4 kPa hydrogels. n > 187 cells, 3 independent hydrogels. D) Representative images of syncytia derived from shNT and shBAG3 cells after differentiation on glass for 3 d with or without 2 μM MSTi. Syncytia were immunolabeled for MF20, myogenin, and stained with DAPI. Quantification of the E) mean myotube diameter, F) nuclei per myotube, G) %myogenin⁺ nuclei in myotubes H) and myotube aspect ratio following MSTi treatment. n > 43 myotubes, 3 independent hydrogels. I) Representative images of YAP/TAZ immunolabeled myotubes formed by shBAG3 and shNT cells after a 3d treatment with MSTi (2 μM). J) Quantification of YAP/TAZ Nuc:Cyto ratio and K) fraction of myonuclei with nuclear YAP/TAZ. n > 161 myonuclei, 3 independent hydrogels. For all data, * < 0.05, ** < 0.01 and *** < 0.001 in a student’s t-test.

Since Hippo pathway inhibition restored YAP/TAZ nuclear localization in shBAG3 myoblasts, next, we tested if MSTi reverts the morphology of enlarged myotubes into narrow ones in shBAG3 cells differentiated on glass. MSTi treatment partially reverted the morphology of shBAG3 derived myotubes (Fig. 4D) by decreasing myotube diameter (Fig. 4E), myonuclei per myotube (Fig. 4F), and increasing percentage of myogenin⁺ myonuclei (Fig. 4G) compared to controls. However, in shNT cells, MST1/2 inhibition induced formation of enlarged myotubes (Fig. 4H), presumably arising from YAP/TAZ activation, which induces myofiber hypertrophy in vivo [41]. Syncytia formed on hydrogels (E’ = 4 and 32 kPa) detached prematurely upon MSTi treatment, preventing testing if Hippo pathway inhibition would restore myotube morphology on hydrogels. In the absence of MSTi, YAP/TAZ Nuc:Cyto ratio was 1.2 in shNT cells myotubes, whereas YAP/TAZ are largely excluded from the nucleus in differentiated shBAG3 cells (Fig. 4, I, J and K). MSTi induced nuclear localization of YAP/TAZ in >60 and 99% of differentiated shBAG3 and shNT cells, respectively, suggesting BAG3 regulation of stiffness-dependent myotube morphology is partly regulated by YAP/TAZ.

Discussion:

Using photostiffening SPAAC hydrogels with well-defined elastic moduli and chemical composition, we demonstrate that BAG3 regulates the stiffness-dependent YAP/TAZ signaling in myoblasts. Depleting BAG3 reduces YAP/TAZ nuclear localization, causing desensitization of the myoblasts to stiffness changes, altering myotube morphology and myoblast fusion. The CASA complex containing BAG3 allows cellular adaptation to environmental stress by selectively recognizing damaged proteins containing KFERQ-like motifs and trafficking them to the lysosomes for degradation [42,43]. By changing conformation in response to stress, the CASA complex increases BAG3 expression on stiff substrates [20]. Therefore, the effects of BAG3 depletion in myoblasts suggests supraphysiological stiffness is perceived as an environmental stressor in muscle cells and thus, BAG3 chaperone activity may help adapt cells to physical stiffness of the microenvironment.

As a chaperone, BAG3 relies on protein interactions to process proteins and transduce those interactions to intracellular signals. Our data demonstrate that Hippo pathway kinases are major intracellular mediators of BAG3 on stiffness dependent YAP/TAZ localization. Inhibition of MST1/2 in the Hippo pathway rescues YAP/TAZ signaling in BAG3 depleted myoblasts. Thus, BAG3 requires LATS1/2 to promote nuclear translocation of YAP/TAZ. However, BAG3 may alter YAP/TAZ phosphorylation and regulate YAP and TAZ subcellular localization through interactions with proteins other than LATS1/2 as BAG3 binds to Hippo kinases NDR1/2 (STK38) [44], which directly phosphorylates YAP/TAZ [45]. Second, BAG3 modulates actin dynamics and binds to PZDGEF, linking focal adhesions to YAP/TAZ dephosphorylation through RAP2 mediated MST1/2 activation [19,46]. Therefore, BAG3 may broadly influence mechanotransduction signals impinging on YAP/TAZ localization via intracellular interactions beyond directly binding to LATS1/2.

During myoblast differentiation, YAP is downregulated [47,48], suggesting YAP has decreased activity in differentiated cells (myotubes). Yet, myotube morphology is severely disrupted upon inhibition of BAG3, demonstrating YAP and TAZ mechanotransduction regulates myotube morphology. BAG3 depletion and/or culture of myoblasts on soft substrates results in irregular and large spherical myotubes upon differentiation that are unrecognizable as myotubes. Surprisingly, similar enlarged myotubes arise when a mechanosensitive calcium channel, PIEZO1, is depleted in myoblasts, suggesting mechanosensing pathways dictate myotube structure [49]. Why myoblasts fuse into enlarged myotubes upon when mechanotransduction signaling is disrupted is unexplored. Since the extracellular matrix provides anchor points for sarcomere formation [50,51], softer substrates may alter sarcomere assembly, alignment of myofibrils and actomyosin contractility, causing aberrant differentiation morphology through Rho/ROCK inactivation [49], decreasing YAP and TAZ nuclear localization.[18] Accordingly, we found promoting YAP and TAZ nuclear localization partially rescues myotube morphology in BAG3 depleted cells. Thus, myogenesis appears mechanically dependent relying on mechanosensitive pathways and their downstream effectors to regulate myotube morphology.

Hydrogel cultures with precisely tuned mechanical properties improve our understanding of how cells interact with their surrounding microenvironment. While C2C12 cells differentiate forming sarcomere-like structures on polyacrylamide based hydrogels with muscle-like stiffness (E’ = 12 kPa) that cannot be achieved on another stiffness [38], we found stiffer SPAAC hydrogels promote normal cylindrical myotube formation on E’ = 32 kPa hydrogels. The discrepancy between the mechanical properties that promote differentiation and normal myotube morphology could be due to differences in substrate geometry (flat vs micropatterned surfaces) in the prior published study [38], profoundly influencing mechanotransduction [52]. Furthermore, the chemical composition, the ligand accessibility, and the concentration of the binding ligands (i.e. N₃-GRGDS compared to collagen) can alter YAP/TAZ localization and, thus, differentiation [53]. As myoblasts differentiate into myotubes, YAP/TAZ localization may more accurately reflect how cells perceive microenvironment stiffness and determine myotube morphology, rather than the hydrogel elastic moduli as previously reported.

Finally, how reducing mechanotransduction and the subsequent alterations in myotube morphology and myoblast fusion may influence muscle function in vivo or affect muscle formation is unknown. However, BAG3 disruption via inactivating mutations or deletions disintegrates Z-discs, affecting Z-disc integrity [54], leading to a variety of myopathies and early lethality [24,55]. In myofibers, YAP is required for muscle hypertrophy [41]. Thus, impaired YAP/TAZ signaling in myofibers lacking BAG3 may contribute to muscle atrophy and exacerbate myofiber structure, accelerating myopathic disease progression.

Materials and Methods:

Hydrogel Synthesis:

Synthesis of 8-arm, 20 kDa PEG-DBCO, 4-arm 10 kDa PEG-N₃ and N₃-KRGDS were carried out using previous reports [35,56]. Hydrogels were synthesized by mixing precursor solutions containing PEG-DBCO (5 wt%), PEG-N₃ (0.2–0.5 equiv. N₃ with respect to DBCO groups), 1 mM of N₃-KRGDS and 2 mM of lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) in PBS, pH 7.4. 15 μL of this solution was immediately transferred on a Sigmacote® coated coverslip. An N₃ functionalized coverslip was placed on top of the hydrogel solution, and hydrogel formation was allowed to continue for 10 min. To fabricate E’ = 32 kPa stiff hydrogels, in situ stiffening reaction was carried out immediately after initial gel formation by 2 min 365 nm light irradiation (I_o = 5 mW/cm²).

Rheology:

Hydrogels were in situ fabricated on a shear rheometer (TA instruments Ares HR3) equipped with a light guide accessory and connected to an Omnicure 1000 light source. The storage modulus (G’) of the hydrogels were monitored in the predetermined viscoelastic range (1% oscillatory strain, 1 Hz frequency) for 5 min. In situ stiffening was carried out for 2 min. at I_o = 5 mW/cm² using 365 nm monochromatic light. Plateau G’ values were converted to Young’s modulus (E’) using the equation E’ = 2G’(1+v), where v is the Poisson’s ratio and assumed to be 0.5 for an incompressible material.

C2C12 Cell Culture and Differentiation:

Myoblast (C2C12) cell line was obtained from ATCC. C2C12 cells were maintained under 40% confluency during expansion and all experiments were performed with P20 or less. Cells were cultured at 5% CO₂ and 37 °C in growth medium (high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) with fetal bovine serum (20% v/v, Life Technologies), sodium pyruvate (1% v/v, Sigma), L-glutamine (1% v/v, Gibco), penicillin-streptomycin (1% v/v, Gibco) and Fungizone (0.1%). To determine the influence of HSC70i (Fig. 1C), C2C12 cells were seeded at a density of 1000 cells/cm², cultured for 48 h and treated with 5 μM of VER-155008 [37] or DMSO for 24 h. To determine the effect of MSTi (Fig. 4A), C2C12 cells were treated with 1 μM of XMU-MP-1 [40] or DMSO for 6 h, 48 h post-seeding (1000 cells/cm²). For myogenic differentiation, C2C12 cells were seeded at a density of 3000 cells/cm². After 72 h, C2C12 cells reached to ~90% confluency, and the growth medium was replaced with low serum differentiation media (high-glucose DMEM with horse serum (5% v/v, Life Technologies), penicillin-streptomycin (1% v/v, Gibco), and insulin-transferrin-selenium supplement (1x, ThermoFisher) for 3 d. Differentiation media was changed every day to prevent starvation.

shRNA knockdown of BAG3:

shRNA lentiviral particles targeting BAG3 (TRCN0000294937) was obtained from Functional Genomics Facility of the University of Colorado Cancer Center. Non-targeting lentiviral particles (shNT) were obtained from Sigma Millipore (SHC002V). C2C12 cells at 40% confluency in growth medium were infected with lentiviral particles (MOI 3–10 for shNT, 100 for shBAG3) together with 6 μg/mL polybrene. Cells were split the next day to prevent high confluency and premature differentiation. After 24 h, C2C12 cells were treated with 2 μg/mL Puromycin for 12 d. Cells were split 2x throughout Puromycin selection to prevent high confluency. Surviving cells were collected and expanded. Successful shRNA knockdown was measured using Western Blotting and quantitative polymerase chain reaction (qPCR).

Protein isolation and western blotting:

Cells were lysed with NP40 Buffer (ThermoFisher) supplemented with Halt protease and phosphatase inhibitors (ThermoFisher) for 10 min on ice. Protein extracts were quantified with a micro BCA kit (BioRad) and cell lysate was denatured in Laemmli SDS Buffer (1x, Alfa Aesar) at 95 °C for 5 min. 5–10 μg of protein was loaded into precast gels (4–12% mini-PROTEAN TGX, BioRad), ran for ~1 h at 120V, and then transferred to nitrocellulose blotting membranes (0.45um, GE Healthcare) for 1.5 h at 0.4 A at 4 °C using standard protocols. Blotting membranes were blocked with skim milk powder (5%) in tris buffered saline with Tween® 20 (TBST, 0.05% w/v Tween® 20) for 1 h at room temperature. Primary antibodies were incubated overnight at 4 °C in 5% BSA in TBST. The membranes were then washed 3x with TBST for 10 min. Secondary antibodies were diluted in 5% BSA in TBST and incubated for 1 h at room temperature. The following primary and secondary antibodies were used: anti-BAG3 (1:5000, ProteinTech), anti-Histone H3 (1:10000, Abcam), anti-YAP (1:2000, Cell Signaling), anti-pYAP (1:2000, Cell Signaling), antimouse-HRP (1:5000, Jackson ImmunoResearch), and antirabbit-HRP (1:5000, Jackson ImmunoResearch). The ECL substrate (Pierce West Dura, ThermoFisher) was added and the chemiluminescence was captured using an ImageQuant LAS 4000 detector.

mRNA isolation and quantification via qRT-PCR:

RNA was extracted and purified using a RNeasy Mini Kit (Qiagen). RNA was converted to cDNA using iScript Reverse Transcription Supermix (BioRad) and an Eppendorf Mastercycler. 10 ng of cDNA was mixed with SybrGreen Mix (BioRad) and amplified via an iCycler machine (BioRad). Relative mRNA levels were measured by normalizing to GAPDH by using custom primers (Invitrogen) below:

Gene	Forward Sequence (5’ – 3’)	Reverse Sequence (5’ – 3’)
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
YAP1	TGAGCCCAAGTCCCACTC	TGTGAGTGTCCCAGGAGAAA
WWTR1	AGCTCAGATCCTTTCCTCAATG	TAACCCCAGGCCACTGTCT
ANKRD1	CCTGCGAGGCTGATCTCAAT	GGTCTTCCCAGCACAGTTCTT
CTGF	GTGTGCACTGCCAAAGATGG	CTTTGGAAGGACTCACCGCT

Immunocytochemistry:

C2C12 cells and myotubes were fixed in 4% (PFA) for 15 min. at room temperature, washed 3x for with PBS (10 min each), permeabilized with PBS containing 0.1% Triton X-100 for 1 h and blocked with PBS containing 5% BSA for 1 h at room temperature. Cells were incubated with the primary antibodies in PBS + 5% BSA overnight at 4 °C. Primary antibodies were: Anti-YAP (1:250, SC-101199, Santa Cruz Biotechnology), anti-Paxillin (1:250, Y112, Abcam), anti-MF20 (1:250, eBioscience) and anti-myogenin (1:250, F5D, Santa Cruz Biotechnology). After primary labeling, samples were washed 3x in PBS (10 min. each), and secondary staining was carried PBS + 5% BSA for 1 h at room temperature, and finally, samples were washed 3x with PBS. Secondary antibodies used were goat-anti-mouse IgG Alexa Fluor (AF) 555 (anti-YAP/TAZ, 1:500, ThermoFisher), goat-anti-rabbit AF488 (anti-Paxillin, 1:500, ThermoFisher), goat-anti-mouse IgG2β AF488 (anti-MF20, 1:500, ThermoFisher), goat-anti-mouse IgGγ1 AF647 (myogenin, 1:500, ThermoFisher), donkey-anti-mouse IgG2α AF555 (Anti-YAP/TAZ, 1:500, ThermoFisher), AF 488 or 555 phalloidin (anti-actin, 1:400, ThermoFisher) and DAPI (2 μg/mL, Sigma).

Imaging and Analysis:

For YAP/TAZ Nuc:Cyto ratio quantification in myoblasts, samples were imaged on an Operetta High-Content Imaging System (Perkin Elmer), and analyzed using Harmony software (Perkin Elmer). Nucleus (DAPI) and the Cytoplasm (phalloidin) were gated using DAPI and phalloidin signal, respectively. Final myoblasts images of YAP/TAZ were created by merging representative individual cells into a single image. To image focal adhesions of C2C12 myoblasts, as well as myotubes, a Zeiss LSM710 scanning confocal microscope equipped with a 20x water immersion objective (N.A. 1.0) was used. Myotube characteristics were quantified using maximum intensity projection (MIP) images in FIJI. Myotubes were gated using MF20 to determine the aspect ratio, and nuclei inside the myotubes were gated using DAPI channel to determine nuclei/myotube and %myogenin⁺ nuclei. Myotube diameters were measured manually and reported as the average of 3 line scans per myotube. Focal adhesions were characterized using maximum intensity projections in FIJI.

Highlights:

• Hydrogel stiffness controls myoblast differentiation via mechanosensing

• BAG3 knockdown impairs YAP/TAZ mechanotransduction in myoblast cells

• Hippo pathway rescues YAP/TAZ signaling and differentiation after BAG3 knockdown